Rmu_sc0002235.1_g000022

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002235.1
OG0000195
Physical Location & Seq
Reverse (-)
83879 .. 84634
756 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002235.1_g000022.1.cds

Sequence Viewer

Length: 756 bp
atggttcccgaagcatatcctcatgagcaagcgtatgagtctaggaggccttctcttgaagaattgttagctcaattgcaagcgtcccaagctcgattgcaagcttctcaagaaatgcttgaacattccaatgagcaacttgaagcaagttttacacaagagctacccttcacaatttttcatgaacaagagtctttctttgaccaagtggaccctatctcaatagaagaagtgtatatcgagcatcttgagcaaaagtcttttattcacgttgaaaatgatgatagtggtgttgatgtacaagaaagtgagcttggttataaaagtttcgatgcaggtagggtgagagaccacacttcggaggaatgggtgcaatattggaaatctaagcttcctaatggaggggcgatatttgaagatgattccgaagaagaggatgtcttgtctagtgaggaggatgcagaattcaaagtcatacaccataatcctttgttcattgaggaggatgctgagcttgaagtcatacaccataatcccttattcattgaggccaatattcccaaggaggaagagagtccttcaataccatgtaatgatgaagaagttgaaaagccaaggactttctctcctcccacatccaaggagatccatcatgagcttcccaaggtggagagtaggacattgagaacttatgttcttaatgagaggattgggatcaaagtacttttacctctcaatccacctttaagtggttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

251

Amino Acids

28.96

Weight (kDa)

4.45

Isoelectric Point (pI)

68.22

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000195)

Species Orthologous Gene IDs
fragaria_vesca FvH4_6g25780 FvH4_6g25920
rosa_chinensis RchiOBHm_Chr1g0366971 RchiOBHm_Chr1g0372841 RchiOBHm_Chr2g0146841 RchiOBHm_Chr2g0154821 RchiOBHm_Chr2g0159611 RchiOBHm_Chr3g0452071 RchiOBHm_Chr3g0453731 RchiOBHm_Chr3g0457891 RchiOBHm_Chr3g0471041 RchiOBHm_Chr3g0473741 RchiOBHm_Chr4g0427761 RchiOBHm_Chr5g0041301 RchiOBHm_Chr5g0076511 RchiOBHm_Chr6g0281431 RchiOBHm_Chr7g0180511
rosa_multiflora Rmu_sc0000082.1_g000052 Rmu_sc0000125.1_g000058 Rmu_sc0000147.1_g000108 Rmu_sc0000210.1_g000011 Rmu_sc0000229.1_g000006 Rmu_sc0000245.1_g000013 Rmu_sc0000897.1_g000016 Rmu_sc0001059.1_g000005 Rmu_sc0001336.1_g000059 Rmu_sc0001464.1_g000025 Rmu_sc0001630.1_g000013 Rmu_sc0001790.1_g000012 Rmu_sc0001939.1_g000003 Rmu_sc0002132.1_g000013 Rmu_sc0002235.1_g000008 Rmu_sc0002235.1_g000022 Rmu_sc0002548.1_g000030 Rmu_sc0002564.1_g000018 Rmu_sc0002652.1_g000001 Rmu_sc0002759.1_g000007 Rmu_sc0002759.1_g000011 Rmu_sc0002799.1_g000012 Rmu_sc0002858.1_g000033 Rmu_sc0002882.1_g000041 Rmu_sc0003032.1_g000030 Rmu_sc0003033.1_g000041 Rmu_sc0003044.1_g000038 Rmu_sc0003072.1_g000004 Rmu_sc0003264.1_g000025 Rmu_sc0003304.1_g000034 Rmu_sc0003416.1_g000002 Rmu_sc0003613.1_g000010 Rmu_sc0003762.1_g000009 Rmu_sc0003776.1_g000028 Rmu_sc0003859.1_g000025 Rmu_sc0004553.1_g000014 Rmu_sc0004866.1_g000002 Rmu_sc0004941.1_g000047 Rmu_sc0005777.1_g000002 Rmu_sc0005958.1_g000001 Rmu_sc0006573.1_g000001 Rmu_sc0006912.1_g000005 Rmu_sc0006968.1_g000002 Rmu_sc0006986.1_g000020 Rmu_sc0007258.1_g000016 Rmu_sc0007803.1_g000001 Rmu_sc0008479.1_g000003 Rmu_sc0008506.1_g000012 Rmu_sc0009199.1_g000005 Rmu_sc0009431.1_g000008 Rmu_sc0009611.1_g000005 Rmu_sc0014287.1_g000001 Rmu_sc0014768.1_g000001 Rmu_sc0020577.1_g000001 Rmu_sc0028131.1_g000001 Rmu_sc0029371.1_g000001 Rmu_sc0034219.1_g000001 Rmu_ssc0000252.1_g000026 Rmu_ssc0000252.1_g000027 Rmu_ssc0000398.1_g000023 Rmu_ssc0000482.1_g000020
rosa_roxburghii Rroxscaffold_158G00443700 Rroxscaffold_1G00001910 Rroxscaffold_1G00001960 Rroxscaffold_1G00002400 Rroxscaffold_1G00015110 Rroxscaffold_1G00015140 Rroxscaffold_1G00028870 Rroxscaffold_1G00028930 Rroxscaffold_1G00031320 Rroxscaffold_1G00031990 Rroxscaffold_1G00060310 Rroxscaffold_1G00063330 Rroxscaffold_1G00071570 Rroxscaffold_2G00084360 Rroxscaffold_2G00084370 Rroxscaffold_2G00088550 Rroxscaffold_2G00088560 Rroxscaffold_2G00089850 Rroxscaffold_2G00095470 Rroxscaffold_2G00103510 Rroxscaffold_2G00114380 Rroxscaffold_2G00119580 Rroxscaffold_2G00122990 Rroxscaffold_2G00125720 Rroxscaffold_3G00223380 Rroxscaffold_3G00230410 Rroxscaffold_3G00233640 Rroxscaffold_3G00234580 Rroxscaffold_3G00241070 Rroxscaffold_4G00282590 Rroxscaffold_4G00309420 Rroxscaffold_4G00309430 Rroxscaffold_4G00314030 Rroxscaffold_4G00314610 Rroxscaffold_4G00316420 Rroxscaffold_4G00319130 Rroxscaffold_4G00319140 Rroxscaffold_4G00319350 Rroxscaffold_4G00324170 Rroxscaffold_4G00324230 Rroxscaffold_5G00346540 Rroxscaffold_5G00346580 Rroxscaffold_5G00346790 Rroxscaffold_5G00349270 Rroxscaffold_5G00350530 Rroxscaffold_5G00373500 Rroxscaffold_5G00378950 Rroxscaffold_5G00378960 Rroxscaffold_5G00381870 Rroxscaffold_6G00388230 Rroxscaffold_6G00389700 Rroxscaffold_6G00389810 Rroxscaffold_6G00391690 Rroxscaffold_6G00391820 Rroxscaffold_6G00391830 Rroxscaffold_6G00393500 Rroxscaffold_6G00396180 Rroxscaffold_6G00396460 Rroxscaffold_6G00418900 Rroxscaffold_6G00423330 Rroxscaffold_7G00173340 Rroxscaffold_7G00176630 Rroxscaffold_7G00181910 Rroxscaffold_7G00191850 Rroxscaffold_7G00199230 Rroxscaffold_7G00199250 Rroxscaffold_7G00203720 Rroxscaffold_7G00204410 Rroxscaffold_7G00204420 Rroxscaffold_7G00212090 Rroxscaffold_7G00215450
rosa_rugosa Rorug07G0321500
rosa_samantha Rh3BG349100 Rh4AG240700
rosa_wichuraiana Rw0G011180 Rw1G003000 Rw5G028290 Rw6G011280

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 321
Acc36I ACCTGC 1 cut(s) 326
AclWI GGATC 2 cut(s) 640, 722
AcsI RAATTY 1 cut(s) 464
AfaI GTAC 2 cut(s) 300, 723
AfiI CCNNNNNNNGG 3 cut(s) 358, 401, 749
AgsI TTSAA 9 cut(s) 59, 122, 143, 275, 416, 469, 518, 582, 608
AjuI GAANNNNNNNTTGG 2 cut(s) 297, 329
AluBI AGCT 8 cut(s) 71, 92, 104, 163, 313, 391, 514, 658
AluI AGCT 8 cut(s) 71, 92, 104, 163, 313, 391, 514, 658
Alw26I GTCTC 1 cut(s) 342
AlwI GGATC 2 cut(s) 640, 722
AoxI GGCC 2 cut(s) 47, 549
ApoI RAATTY 1 cut(s) 464
AspS9I GGNCC 1 cut(s) 211
AsuHPI GGTGA 1 cut(s) 355
AvaII GGWCC 1 cut(s) 211
BccI CCATC 1 cut(s) 657
BcoDI GTCTC 1 cut(s) 342
BfaI CTAG 2 cut(s) 42, 447
BfuAI ACCTGC 1 cut(s) 326
BlpI GCTNAGC 1 cut(s) 510
BmcAI AGTACT 1 cut(s) 723
Bme18I GGWCC 1 cut(s) 211
BmgT120I GGNCC 1 cut(s) 211
BmiI GGNNCC 2 cut(s) 6, 213
BmsI GCATC 4 cut(s) 253, 322, 448, 496
BplI GAGNNNNNCTC 2 cut(s) 37, 69
Bpu1102I GCTNAGC 1 cut(s) 510
BpuEI CTTGAG 2 cut(s) 93, 269
BsaBI GATNNNNATC 1 cut(s) 713
BsaI GGTCTC 1 cut(s) 342
BsaJI CCNNGG 4 cut(s) 561, 614, 639, 663
BsaXI ACNNNNNCTCC 2 cut(s) 610, 640
Bsc4I CCNNNNNNNGG 3 cut(s) 358, 401, 749
Bse8I GATNNNNATC 1 cut(s) 713
BseDI CCNNGG 4 cut(s) 561, 614, 639, 663
BseGI GGATG 4 cut(s) 442, 463, 511, 635
BseJI GATNNNNATC 1 cut(s) 713
BseLI CCNNNNNNNGG 3 cut(s) 358, 401, 749
BseMII CTCAG 1 cut(s) 501
BseRI GAGGAG 3 cut(s) 467, 515, 618
BshFI GGCC 2 cut(s) 49, 551
BslFI GGGAC 1 cut(s) 70
BslI CCNNNNNNNGG 3 cut(s) 358, 401, 749
BsmAI GTCTC 1 cut(s) 342
BsmFI GGGAC 1 cut(s) 70
BsnI GGCC 2 cut(s) 49, 551
Bso31I GGTCTC 1 cut(s) 342
Bsp1407I TGTACA 1 cut(s) 298
Bsp143I GATC 2 cut(s) 645, 714
Bsp1720I GCTNAGC 1 cut(s) 510
BspANI GGCC 2 cut(s) 49, 551
BspCNI CTCAG 1 cut(s) 502
BspHI TCATGA 3 cut(s) 22, 181, 652
BspLI GGNNCC 2 cut(s) 6, 213
BspMI ACCTGC 1 cut(s) 326
BspPI GGATC 2 cut(s) 640, 722
BspTNI GGTCTC 1 cut(s) 342
BsrGI TGTACA 1 cut(s) 298
BssECI CCNNGG 4 cut(s) 561, 614, 639, 663
BssMI GATC 2 cut(s) 645, 714
BssT1I CCWWGG 4 cut(s) 561, 614, 639, 663
Bst6I CTCTTC 2 cut(s) 426, 564
BstAUI TGTACA 1 cut(s) 298
BstC8I GCNNGC 3 cut(s) 30, 81, 102
BstDEI CTNAG 2 cut(s) 387, 510
BstENI CCTNNNNNAGG 1 cut(s) 399
BstF5I GGATG 4 cut(s) 442, 463, 511, 635
BstKTI GATC 2 cut(s) 648, 717
BstMAI GTCTC 1 cut(s) 342
BstMBI GATC 2 cut(s) 645, 714
BstMWI GCNNNNNNNGC 2 cut(s) 89, 250
BstX2I RGATCY 1 cut(s) 645
BstYI RGATCY 1 cut(s) 645
BsuRI GGCC 2 cut(s) 49, 551
BtsCI GGATG 4 cut(s) 442, 463, 511, 635
BveI ACCTGC 1 cut(s) 326
Cac8I GCNNGC 3 cut(s) 30, 81, 102
CciI TCATGA 3 cut(s) 22, 181, 652
Cfr13I GGNCC 1 cut(s) 211
CseI GACGC 1 cut(s) 72
Csp6I GTAC 2 cut(s) 299, 722
CviAII CATG 4 cut(s) 23, 182, 588, 653
CviQI GTAC 2 cut(s) 299, 722
DdeI CTNAG 2 cut(s) 387, 510
DpnI GATC 2 cut(s) 647, 716
DpnII GATC 2 cut(s) 645, 714
Eam1104I CTCTTC 2 cut(s) 426, 564
EarI CTCTTC 2 cut(s) 426, 564
Eco130I CCWWGG 4 cut(s) 561, 614, 639, 663
Eco147I AGGCCT 1 cut(s) 49
Eco31I GGTCTC 1 cut(s) 342
Eco47I GGWCC 1 cut(s) 211
EcoNI CCTNNNNNAGG 1 cut(s) 399
EcoRI GAATTC 1 cut(s) 464
EcoT14I CCWWGG 4 cut(s) 561, 614, 639, 663
ErhI CCWWGG 4 cut(s) 561, 614, 639, 663
FaeI CATG 4 cut(s) 26, 185, 591, 656
FalI AAGNNNNNCTT 2 cut(s) 102, 134
FaqI GGGAC 1 cut(s) 70
FatI CATG 4 cut(s) 22, 181, 587, 652
FokI GGATG 4 cut(s) 449, 470, 518, 622
FspBI CTAG 2 cut(s) 42, 447
HaeIII GGCC 2 cut(s) 49, 551
HgaI GACGC 1 cut(s) 72
Hin1II CATG 4 cut(s) 26, 185, 591, 656
HindIII AAGCTT 2 cut(s) 102, 389
HinfI GANTC 4 cut(s) 38, 191, 422, 574
HphI GGTGA 1 cut(s) 355
Hpy166II GTNNAC 1 cut(s) 211
Hpy188I TCNGA 2 cut(s) 361, 427
Hpy188III TCNNGA 7 cut(s) 8, 23, 56, 110, 182, 248, 653
Hpy8I GTNNAC 1 cut(s) 211
HpyAV CCTTC 3 cut(s) 60, 178, 588
HpyCH4IV ACGT 1 cut(s) 270
HpyCH4V TGCA 5 cut(s) 79, 100, 335, 373, 461
HpyF10VI GCNNNNNNNGC 2 cut(s) 89, 250
HpyF3I CTNAG 2 cut(s) 387, 510
HpySE526I ACGT 1 cut(s) 270
Hsp92II CATG 4 cut(s) 26, 185, 591, 656
Kzo9I GATC 2 cut(s) 645, 714
LpnPI CCDG 1 cut(s) 321
LweI GCATC 4 cut(s) 253, 322, 448, 496
MaeI CTAG 2 cut(s) 42, 447
MaeII ACGT 1 cut(s) 270
MalI GATC 2 cut(s) 647, 716
MboI GATC 2 cut(s) 645, 714
MboII GAAGA 7 cut(s) 71, 239, 428, 440, 443, 581, 611
MfeI CAATTG 1 cut(s) 74
MflI RGATCY 1 cut(s) 645
MluCI AATT 4 cut(s) 62, 74, 174, 464
MlyI GAGTC 3 cut(s) 47, 200, 583
MseI TTAA 3 cut(s) 699, 746, 754
MslI CAYNNNNRTG 1 cut(s) 129
MunI CAATTG 1 cut(s) 74
MwoI GCNNNNNNNGC 2 cut(s) 89, 250
NdeII GATC 2 cut(s) 645, 714
NlaIII CATG 4 cut(s) 26, 185, 591, 656
NlaIV GGNNCC 2 cut(s) 6, 213
PagI TCATGA 3 cut(s) 22, 181, 652
PceI AGGCCT 1 cut(s) 49
PfeI GAWTC 1 cut(s) 422
PleI GAGTC 3 cut(s) 46, 199, 582
PpsI GAGTC 3 cut(s) 46, 199, 582
PsiI TTATAA 1 cut(s) 321
PspN4I GGNNCC 2 cut(s) 6, 213
PspPI GGNCC 1 cut(s) 211
PsuI RGATCY 1 cut(s) 645
RsaI GTAC 2 cut(s) 300, 723
RsaNI GTAC 2 cut(s) 299, 722
RseI CAYNNNNRTG 1 cut(s) 129
SaqAI TTAA 3 cut(s) 699, 746, 754
Sau3AI GATC 2 cut(s) 645, 714
Sau96I GGNCC 1 cut(s) 211
ScaI AGTACT 1 cut(s) 723
SchI GAGTC 3 cut(s) 47, 200, 583
SfaNI GCATC 4 cut(s) 253, 322, 448, 496
SinI GGWCC 1 cut(s) 211
SmiMI CAYNNNNRTG 1 cut(s) 129
SmlI CTYRAG 2 cut(s) 108, 248
SmoI CTYRAG 2 cut(s) 108, 248
Sse9I AATT 4 cut(s) 62, 74, 174, 464
SseBI AGGCCT 1 cut(s) 49
SspI AATATT 2 cut(s) 377, 556
SspMI CTAG 2 cut(s) 42, 447
StuI AGGCCT 1 cut(s) 49
StyI CCWWGG 4 cut(s) 561, 614, 639, 663
TaiI ACGT 1 cut(s) 273
TaqI TCGA 3 cut(s) 94, 240, 330
TasI AATT 4 cut(s) 62, 74, 174, 464
TatI WGTACW 2 cut(s) 298, 721
TfiI GAWTC 1 cut(s) 422
Tru1I TTAA 3 cut(s) 699, 746, 754
Tru9I TTAA 3 cut(s) 699, 746, 754
TspDTI ATGAA 5 cut(s) 170, 198, 484, 532, 612
VpaK11BI GGWCC 1 cut(s) 211
XagI CCTNNNNNAGG 1 cut(s) 399
XapI RAATTY 1 cut(s) 464
XspI CTAG 2 cut(s) 42, 447
ZrmI AGTACT 1 cut(s) 723
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.