Rmu_sc0002759.1_g000011

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002759.1
OG0000195
Physical Location & Seq
Forward (+)
53634 .. 60224
6591 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002759.1_g000011.1.cds

Sequence Viewer

Length: 2556 bp
atggatcgatggagttatggatgtgatgatcgtaggagatatgagcaacaaagtttctatagtggaggttatcaagaatggaatacatatgccgagagtcctatgccttgttacaaccaagcttgtgccttgtgtaattctccgtggcattcaccatttgagtgttctttgagatttgaatacccggattttatgcaagagtatgagtacaagatggggatggataaagagacatgtgtacccgaagcatatccacaaaagcaagcttttgagcctaggaagccatcacttgaagaacaacttgctcaattggaagcctccaatgctcaattgcaagcctcccaagctcaatgtctagcctcccaagctcgattgcatgctaaattggaagcctttaatgctcaattgcaagcttctcaagaaatgacttcacattccaatgagcaacttgagcctagtcttgagcaagagccaccattcaccatttgtcatgagcaagattctttctttgatcaagtggagcctaattcaagagaagaagtatattttgagcatcatgagcaagagttgcctcttcatgatcgagagggtgatgttcatgtacaagaaagtgtgcttggttatgaaaattttgaagcaagtgggttgagagactacactttggaggaaccggtgcaatattggaaatctaatcttcacaatgaagaagagaaatatgaagatgattccgaagaagaggataacttgtttagtgaggaggatgtggagcatgaagacttacaccatattcccttaattgttgaggccgatattcccaacgaggaagaaagtccttcaataccttgtgatgatgaagaaattaaagagtcaaggactttctctcctcccacatccatggagatccatcatgagcctcctaaggtggagagtaaaacgttgagcacttatgtacttaatgagaagattgagcttaaggtacttttacctctcaatccaccattaagtggtcaatgtttctacaatgaggtgatggattggaaaggaagtggagcacatgcactcaccctttcccatcactctcaagagcttttaccacctattgttcctaagagcatcatttctacaccacttgagaaggagaaggcaaggtttgcccctagaagaaaaattgagaagaagaggaagattaagaagctacacttttggttaccaattggattattcatggatatctcttggtcttgcctctatgacacaccaaggattcccttatccccaaacaatagagtggtcgcacttgagaaccttccattccgggaaggccggttctctctctcttcctcacgagccaaagacgacggaaacagagcccttcttcgccggcatctatctcccacttccggccatctttggacgagcaaccacgtccaacagcttcgcctcactcctctgaagtcgtctgtggcaaccttgcacggcggcgcggcccctagcggcggcggcgacccgctccggccaccaaaacttccaatccttggctccatgaactcgcctcaacttgctgatcatcatactagaaggatcgcacctggagtgaccggtttcacgttcgtcggagctcggtcgaaggaatcgaggcctgaaattgaagtttttacgtcgaaaatcgagctcgccggtttctgcatttcttcgcctgtttctggaaaaattcccgccaccttcatactgttcaaggtaattttcgaccccttccggtcattttcagacttcgtgctagttatgaaaattgttgggcttgatgagatgaagaggagcagccaggcctcgacaccattggcggtggtcggcggcggctctgtcctttttccggcgacccttttccggccacctccggggaccaccaactctggctaccactccactacaccgccaccatcaagaaaacgagcgaaggacgacgacccaacccaagaagaatcaccgaaaaacaccgtctctagcctacgcacgcggcaactatggcagcgacgccactgttcctcttttccttttgatttccagccaccatctcaccacaccgccatcacctctgcactcaacaggaaacggagatcaaaacccaaaagtttgaccaccagccggcctgaaaagaaaacgaagcgtgctccattgctggagccaacaagtctgggttcttcgttcttcaatctccagccacgtgttttaccaccagccggcctgaacagaaaacgaagcgtgctccattgccggagtcgacaagtctgggttcttcgttcatcaatctccagccacgatgatccaagggcgatccgtgaggatccgaccgttggatcgtcgtataaatccgatctaaccgttggatcgtcgtataaatctgatccgaccgttggatcatcgtataaatccgatccgactgttggatcatcgtataaattcgatctgaccgttggatcgtcgtataaatctgatccgaccgttggatcatcgtataaatccgatctgaccgttggatcgtcgtataagttcgattag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

851

Amino Acids

96.16

Weight (kDa)

6.09

Isoelectric Point (pI)

66.03

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000195)

Species Orthologous Gene IDs
fragaria_vesca FvH4_6g25780 FvH4_6g25920
rosa_chinensis RchiOBHm_Chr1g0366971 RchiOBHm_Chr1g0372841 RchiOBHm_Chr2g0146841 RchiOBHm_Chr2g0154821 RchiOBHm_Chr2g0159611 RchiOBHm_Chr3g0452071 RchiOBHm_Chr3g0453731 RchiOBHm_Chr3g0457891 RchiOBHm_Chr3g0471041 RchiOBHm_Chr3g0473741 RchiOBHm_Chr4g0427761 RchiOBHm_Chr5g0041301 RchiOBHm_Chr5g0076511 RchiOBHm_Chr6g0281431 RchiOBHm_Chr7g0180511
rosa_multiflora Rmu_sc0000082.1_g000052 Rmu_sc0000125.1_g000058 Rmu_sc0000147.1_g000108 Rmu_sc0000210.1_g000011 Rmu_sc0000229.1_g000006 Rmu_sc0000245.1_g000013 Rmu_sc0000897.1_g000016 Rmu_sc0001059.1_g000005 Rmu_sc0001336.1_g000059 Rmu_sc0001464.1_g000025 Rmu_sc0001630.1_g000013 Rmu_sc0001790.1_g000012 Rmu_sc0001939.1_g000003 Rmu_sc0002132.1_g000013 Rmu_sc0002235.1_g000008 Rmu_sc0002235.1_g000022 Rmu_sc0002548.1_g000030 Rmu_sc0002564.1_g000018 Rmu_sc0002652.1_g000001 Rmu_sc0002759.1_g000007 Rmu_sc0002759.1_g000011 Rmu_sc0002799.1_g000012 Rmu_sc0002858.1_g000033 Rmu_sc0002882.1_g000041 Rmu_sc0003032.1_g000030 Rmu_sc0003033.1_g000041 Rmu_sc0003044.1_g000038 Rmu_sc0003072.1_g000004 Rmu_sc0003264.1_g000025 Rmu_sc0003304.1_g000034 Rmu_sc0003416.1_g000002 Rmu_sc0003613.1_g000010 Rmu_sc0003762.1_g000009 Rmu_sc0003776.1_g000028 Rmu_sc0003859.1_g000025 Rmu_sc0004553.1_g000014 Rmu_sc0004866.1_g000002 Rmu_sc0004941.1_g000047 Rmu_sc0005777.1_g000002 Rmu_sc0005958.1_g000001 Rmu_sc0006573.1_g000001 Rmu_sc0006912.1_g000005 Rmu_sc0006968.1_g000002 Rmu_sc0006986.1_g000020 Rmu_sc0007258.1_g000016 Rmu_sc0007803.1_g000001 Rmu_sc0008479.1_g000003 Rmu_sc0008506.1_g000012 Rmu_sc0009199.1_g000005 Rmu_sc0009431.1_g000008 Rmu_sc0009611.1_g000005 Rmu_sc0014287.1_g000001 Rmu_sc0014768.1_g000001 Rmu_sc0020577.1_g000001 Rmu_sc0028131.1_g000001 Rmu_sc0029371.1_g000001 Rmu_sc0034219.1_g000001 Rmu_ssc0000252.1_g000026 Rmu_ssc0000252.1_g000027 Rmu_ssc0000398.1_g000023 Rmu_ssc0000482.1_g000020
rosa_roxburghii Rroxscaffold_158G00443700 Rroxscaffold_1G00001910 Rroxscaffold_1G00001960 Rroxscaffold_1G00002400 Rroxscaffold_1G00015110 Rroxscaffold_1G00015140 Rroxscaffold_1G00028870 Rroxscaffold_1G00028930 Rroxscaffold_1G00031320 Rroxscaffold_1G00031990 Rroxscaffold_1G00060310 Rroxscaffold_1G00063330 Rroxscaffold_1G00071570 Rroxscaffold_2G00084360 Rroxscaffold_2G00084370 Rroxscaffold_2G00088550 Rroxscaffold_2G00088560 Rroxscaffold_2G00089850 Rroxscaffold_2G00095470 Rroxscaffold_2G00103510 Rroxscaffold_2G00114380 Rroxscaffold_2G00119580 Rroxscaffold_2G00122990 Rroxscaffold_2G00125720 Rroxscaffold_3G00223380 Rroxscaffold_3G00230410 Rroxscaffold_3G00233640 Rroxscaffold_3G00234580 Rroxscaffold_3G00241070 Rroxscaffold_4G00282590 Rroxscaffold_4G00309420 Rroxscaffold_4G00309430 Rroxscaffold_4G00314030 Rroxscaffold_4G00314610 Rroxscaffold_4G00316420 Rroxscaffold_4G00319130 Rroxscaffold_4G00319140 Rroxscaffold_4G00319350 Rroxscaffold_4G00324170 Rroxscaffold_4G00324230 Rroxscaffold_5G00346540 Rroxscaffold_5G00346580 Rroxscaffold_5G00346790 Rroxscaffold_5G00349270 Rroxscaffold_5G00350530 Rroxscaffold_5G00373500 Rroxscaffold_5G00378950 Rroxscaffold_5G00378960 Rroxscaffold_5G00381870 Rroxscaffold_6G00388230 Rroxscaffold_6G00389700 Rroxscaffold_6G00389810 Rroxscaffold_6G00391690 Rroxscaffold_6G00391820 Rroxscaffold_6G00391830 Rroxscaffold_6G00393500 Rroxscaffold_6G00396180 Rroxscaffold_6G00396460 Rroxscaffold_6G00418900 Rroxscaffold_6G00423330 Rroxscaffold_7G00173340 Rroxscaffold_7G00176630 Rroxscaffold_7G00181910 Rroxscaffold_7G00191850 Rroxscaffold_7G00199230 Rroxscaffold_7G00199250 Rroxscaffold_7G00203720 Rroxscaffold_7G00204410 Rroxscaffold_7G00204420 Rroxscaffold_7G00212090 Rroxscaffold_7G00215450
rosa_rugosa Rorug07G0321500
rosa_samantha Rh3BG349100 Rh4AG240700
rosa_wichuraiana Rw0G011180 Rw1G003000 Rw5G028290 Rw6G011280

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 2 cut(s) 1004, 1535
AccBSI CCGCTC 1 cut(s) 1510
AccI GTMKAC 1 cut(s) 2278
AccII CGCG 2 cut(s) 1484, 2014
AclI AACGTT 1 cut(s) 935
AcoI YGGCCR 3 cut(s) 1402, 1514, 1886
AcsI RAATTY 3 cut(s) 628, 1710, 2456
AcuI CTGAAG 1 cut(s) 1472
AcvI CACGTG 1 cut(s) 2222
AcyI GRCGYC 1 cut(s) 2032
AfaI GTAC 5 cut(s) 209, 240, 603, 951, 978
AflII CTTAAG 1 cut(s) 971
AflIII ACRYGT 2 cut(s) 233, 2221
AgeI ACCGGT 2 cut(s) 670, 1598
AgsI TTSAA 8 cut(s) 179, 293, 531, 635, 837, 1649, 1735, 2209
AjiI CACGTC 1 cut(s) 1426
AjnI CCWGG 2 cut(s) 1588, 1821
AjuI GAANNNNNNNTTGG 2 cut(s) 600, 632
AloI GAACNNNNNNTCC 2 cut(s) 1310, 1342
Alw21I GWGCWC 6 cut(s) 944, 1054, 1621, 1674, 2170, 2265
Alw26I GTCTC 3 cut(s) 224, 645, 2002
ApeKI GCWGC 2 cut(s) 1818, 2026
ApoI RAATTY 3 cut(s) 628, 1710, 2456
AsiGI ACCGGT 2 cut(s) 670, 1598
AspA2I CCTAGG 1 cut(s) 275
AspLEI GCGC 1 cut(s) 1484
AspS9I GGNCC 2 cut(s) 1486, 1899
AsuC2I CCSGG 3 cut(s) 185, 1316, 1896
AsuHPI GGTGA 8 cut(s) 144, 472, 602, 1039, 1054, 1974, 2066, 2080
AvaII GGWCC 1 cut(s) 1899
AvrII CCTAGG 1 cut(s) 275
AxyI CCTNAGG 1 cut(s) 918
BaeI ACNNNNGTAYC 2 cut(s) 222, 255
BamHI GGATCC 1 cut(s) 2341
BanII GRGCYC 3 cut(s) 1372, 1621, 1674
BauI CACGAG 1 cut(s) 1344
BbrPI CACGTG 1 cut(s) 2222
BbsI GAAGAC 1 cut(s) 780
Bbv12I GWGCWC 6 cut(s) 944, 1054, 1621, 1674, 2170, 2265
BbvI GCAGC 2 cut(s) 1830, 2038
BceAI ACGGC 1 cut(s) 1492
BciT130I CCWGG 2 cut(s) 1590, 1823
BclI TGATCA 2 cut(s) 511, 1564
BcnI CCSGG 3 cut(s) 185, 1316, 1896
BcoDI GTCTC 3 cut(s) 224, 645, 2002
BfaI CTAG 8 cut(s) 276, 356, 456, 1158, 1491, 1575, 1778, 2001
BfmI CTRYAG 1 cut(s) 58
BfrI CTTAAG 1 cut(s) 971
BlnI CCTAGG 1 cut(s) 275
Bme1390I CCNGG 5 cut(s) 185, 1316, 1590, 1823, 1896
Bme18I GGWCC 1 cut(s) 1899
BmgBI CACGTC 1 cut(s) 1426
BmgT120I GGNCC 2 cut(s) 1486, 1899
BmiI GGNNCC 7 cut(s) 522, 669, 1488, 1540, 1900, 2181, 2343
BmrFI CCNGG 5 cut(s) 185, 1316, 1590, 1823, 1896
BmsI GCATC 3 cut(s) 562, 1122, 1393
BpiI GAAGAC 1 cut(s) 780
BpmI CTGGAG 4 cut(s) 1611, 2198, 2198, 2293
BpuEI CTTGAG 6 cut(s) 402, 470, 482, 1065, 1151, 1319
BpuMI CCSGG 3 cut(s) 185, 1316, 1896
Bsa29I ATCGAT 1 cut(s) 7
BsaAI YACGTR 1 cut(s) 2222
BsaHI GRCGYC 1 cut(s) 2032
BsaJI CCNNGG 7 cut(s) 143, 275, 894, 1259, 1534, 1895, 2324
BsaWI WCCGGW 3 cut(s) 670, 1598, 1755
BsaXI ACNNNNNCTCC 2 cut(s) 865, 895
Bse118I RCCGGY 7 cut(s) 670, 1323, 1380, 1598, 1676, 2142, 2237
Bse21I CCTNAGG 1 cut(s) 918
Bse3DI GCAATG 2 cut(s) 2171, 2266
BseBI CCWGG 2 cut(s) 1590, 1823
BseCI ATCGAT 1 cut(s) 7
BseDI CCNNGG 7 cut(s) 143, 275, 894, 1259, 1534, 1895, 2324
BseGI GGATG 4 cut(s) 26, 225, 766, 890
BseMI GCAATG 2 cut(s) 2171, 2266
BseRI GAGGAG 4 cut(s) 770, 873, 1437, 1828
BseXI GCAGC 2 cut(s) 1830, 2038
BsgI GTGCAG 1 cut(s) 2079
Bsh1236I CGCG 2 cut(s) 1484, 2014
Bsh1285I CGRYCG 4 cut(s) 1625, 2349, 2409, 2499
BshTI ACCGGT 2 cut(s) 670, 1598
BshVI ATCGAT 1 cut(s) 7
BsiEI CGRYCG 4 cut(s) 1625, 2349, 2409, 2499
BsiHKAI GWGCWC 6 cut(s) 944, 1054, 1621, 1674, 2170, 2265
BslFI GGGAC 1 cut(s) 1912
BsmAI GTCTC 3 cut(s) 224, 645, 2002
BsmBI CGTCTC 1 cut(s) 2002
BsmFI GGGAC 1 cut(s) 1912
BsmI GAATGC 1 cut(s) 148
Bsp1286I GDGCHC 7 cut(s) 944, 1054, 1372, 1621, 1674, 2170, 2265
Bsp1407I TGTACA 1 cut(s) 601
Bsp19I CCATGG 1 cut(s) 894
BspDI ATCGAT 1 cut(s) 7
BspFNI CGCG 2 cut(s) 1484, 2014
BspHI TCATGA 4 cut(s) 490, 556, 577, 907
BspLI GGNNCC 7 cut(s) 522, 669, 1488, 1540, 1900, 2181, 2343
BspTI CTTAAG 1 cut(s) 971
BsrBI CCGCTC 1 cut(s) 1510
BsrDI GCAATG 2 cut(s) 2171, 2266
BsrFI RCCGGY 7 cut(s) 670, 1323, 1380, 1598, 1676, 2142, 2237
BsrGI TGTACA 1 cut(s) 601
BssAI RCCGGY 7 cut(s) 670, 1323, 1380, 1598, 1676, 2142, 2237
BssECI CCNNGG 7 cut(s) 143, 275, 894, 1259, 1534, 1895, 2324
BssNI GRCGYC 1 cut(s) 2032
BssSI CACGAG 1 cut(s) 1344
BssT1I CCWWGG 5 cut(s) 275, 894, 1259, 1534, 2324
Bst2BI CACGAG 1 cut(s) 1344
Bst2UI CCWGG 2 cut(s) 1590, 1823
Bst6I CTCTTC 6 cut(s) 579, 702, 729, 1172, 1342, 1805
BstACI GRCGYC 1 cut(s) 2032
BstAFI CTTAAG 1 cut(s) 971
BstAPI GCANNNNNTGC 2 cut(s) 568, 1151
BstAUI TGTACA 1 cut(s) 601
BstBAI YACGTR 1 cut(s) 2222
BstDEI CTNAG 2 cut(s) 918, 1107
BstDSI CCRYGG 2 cut(s) 143, 894
BstEII GGTNACC 1 cut(s) 1206
BstF5I GGATG 4 cut(s) 26, 225, 766, 890
BstFNI CGCG 2 cut(s) 1484, 2014
BstHHI GCGC 1 cut(s) 1484
BstMAI GTCTC 3 cut(s) 224, 645, 2002
BstMCI CGRYCG 4 cut(s) 1625, 2349, 2409, 2499
BstNI CCWGG 2 cut(s) 1590, 1823
BstNSI RCATGY 3 cut(s) 237, 380, 1058
BstPI GGTNACC 1 cut(s) 1206
BstSCI CCNGG 5 cut(s) 183, 1314, 1588, 1821, 1894
BstSFI CTRYAG 1 cut(s) 58
BstUI CGCG 2 cut(s) 1484, 2014
BstV1I GCAGC 2 cut(s) 1830, 2038
BstV2I GAAGAC 1 cut(s) 780
BstX2I RGATCY 2 cut(s) 900, 2341
BstXI CCANNNNNNTGG 1 cut(s) 895
BstYI RGATCY 2 cut(s) 900, 2341
Bsu15I ATCGAT 1 cut(s) 7
Bsu36I CCTNAGG 1 cut(s) 918
BsuTUI ATCGAT 1 cut(s) 7
BtgI CCRYGG 2 cut(s) 143, 894
BtrI CACGTC 1 cut(s) 1426
BtsCI GGATG 4 cut(s) 26, 225, 766, 890
BtsIMutI CAGTG 1 cut(s) 2035
CciI TCATGA 4 cut(s) 490, 556, 577, 907
CfoI GCGC 1 cut(s) 1484
Cfr10I RCCGGY 7 cut(s) 670, 1323, 1380, 1598, 1676, 2142, 2237
Cfr13I GGNCC 2 cut(s) 1486, 1899
ClaI ATCGAT 1 cut(s) 7
CseI GACGC 1 cut(s) 2040
Csp6I GTAC 5 cut(s) 208, 239, 602, 950, 977
CspAI ACCGGT 2 cut(s) 670, 1598
CviQI GTAC 5 cut(s) 208, 239, 602, 950, 977
DdeI CTNAG 2 cut(s) 918, 1107
EaeI YGGCCR 3 cut(s) 1402, 1514, 1886
Eam1104I CTCTTC 6 cut(s) 579, 702, 729, 1172, 1342, 1805
EarI CTCTTC 6 cut(s) 579, 702, 729, 1172, 1342, 1805
Ecl136II GAGCTC 2 cut(s) 1619, 1672
Eco130I CCWWGG 5 cut(s) 275, 894, 1259, 1534, 2324
Eco147I AGGCCT 2 cut(s) 1639, 1826
Eco24I GRGCYC 3 cut(s) 1372, 1621, 1674
Eco32I GATATC 1 cut(s) 1231
Eco47I GGWCC 1 cut(s) 1899
Eco53kI GAGCTC 2 cut(s) 1619, 1672
Eco57I CTGAAG 1 cut(s) 1472
Eco72I CACGTG 1 cut(s) 2222
Eco81I CCTNAGG 1 cut(s) 918
Eco91I GGTNACC 1 cut(s) 1206
EcoICRI GAGCTC 2 cut(s) 1619, 1672
EcoO65I GGTNACC 1 cut(s) 1206
EcoRII CCWGG 2 cut(s) 1588, 1821
EcoRV GATATC 1 cut(s) 1231
EcoT14I CCWWGG 5 cut(s) 275, 894, 1259, 1534, 2324
EcoT38I GRGCYC 3 cut(s) 1372, 1621, 1674
ErhI CCWWGG 5 cut(s) 275, 894, 1259, 1534, 2324
Esp3I CGTCTC 1 cut(s) 2002
FalI AAGNNNNNCTT 4 cut(s) 285, 317, 1184, 1216
FaqI GGGAC 1 cut(s) 1912
FauI CCCGC 2 cut(s) 1515, 1723
FauNDI CATATG 1 cut(s) 88
FbaI TGATCA 2 cut(s) 511, 1564
FblI GTMKAC 1 cut(s) 2278
FokI GGATG 4 cut(s) 33, 232, 773, 877
FriOI GRGCYC 3 cut(s) 1372, 1621, 1674
FspBI CTAG 8 cut(s) 276, 356, 456, 1158, 1491, 1575, 1778, 2001
GlaI GCGC 1 cut(s) 1483
GsuI CTGGAG 4 cut(s) 1611, 2198, 2198, 2293
HgaI GACGC 1 cut(s) 2040
HhaI GCGC 1 cut(s) 1484
Hin1I GRCGYC 1 cut(s) 2032
Hin6I GCGC 1 cut(s) 1482
HinP1I GCGC 1 cut(s) 1482
HincII GTYRAC 1 cut(s) 2279
HindII GTYRAC 1 cut(s) 2279
HindIII AAGCTT 3 cut(s) 120, 264, 411
HinfI GANTC 8 cut(s) 97, 500, 725, 866, 1264, 1631, 1979, 2275
HphI GGTGA 8 cut(s) 144, 472, 602, 1039, 1054, 1974, 2066, 2080
Hpy166II GTNNAC 2 cut(s) 239, 2279
Hpy8I GTNNAC 2 cut(s) 239, 2279
Hpy99I CGWCG 9 cut(s) 1361, 1616, 1663, 1964, 2034, 2362, 2392, 2482, 2542
HpyCH4IV ACGT 5 cut(s) 935, 1425, 1607, 1658, 2221
HpyCH4V TGCA 9 cut(s) 196, 334, 376, 409, 676, 1058, 1474, 1686, 2096
HpyF3I CTNAG 2 cut(s) 918, 1107
HpySE526I ACGT 5 cut(s) 935, 1425, 1607, 1658, 2221
Hsp92I GRCGYC 1 cut(s) 2032
HspAI GCGC 1 cut(s) 1482
KroI GCCGGC 3 cut(s) 1380, 2142, 2237
KroNI GCCGGC 3 cut(s) 1382, 2144, 2239
Ksp22I TGATCA 2 cut(s) 511, 1564
Lsp1109I GCAGC 2 cut(s) 1830, 2038
LweI GCATC 3 cut(s) 562, 1122, 1393
MaeI CTAG 8 cut(s) 276, 356, 456, 1158, 1491, 1575, 1778, 2001
MaeII ACGT 5 cut(s) 935, 1425, 1607, 1658, 2221
MaeIII GTNAC 3 cut(s) 110, 1206, 1594
MbiI CCGCTC 1 cut(s) 1510
MfeI CAATTG 4 cut(s) 308, 329, 404, 1212
MflI RGATCY 2 cut(s) 900, 2341
MhlI GDGCHC 7 cut(s) 944, 1054, 1372, 1621, 1674, 2170, 2265
MlyI GAGTC 3 cut(s) 106, 875, 2284
MroNI GCCGGC 3 cut(s) 1380, 2142, 2237
MseI TTAA 7 cut(s) 396, 794, 861, 954, 972, 1001, 1188
MslI CAYNNNNRTG 3 cut(s) 160, 438, 893
MspCI CTTAAG 1 cut(s) 971
MspR9I CCNGG 5 cut(s) 185, 1316, 1590, 1823, 1896
MunI CAATTG 4 cut(s) 308, 329, 404, 1212
Mva1269I GAATGC 1 cut(s) 148
MvaI CCWGG 2 cut(s) 1590, 1823
MvnI CGCG 2 cut(s) 1484, 2014
NaeI GCCGGC 3 cut(s) 1382, 2144, 2239
NciI CCSGG 3 cut(s) 185, 1316, 1896
NcoI CCATGG 1 cut(s) 894
NdeI CATATG 1 cut(s) 88
NgoMIV GCCGGC 3 cut(s) 1380, 2142, 2237
NlaIV GGNNCC 7 cut(s) 522, 669, 1488, 1540, 1900, 2181, 2343
NmeAIII GCCGAG 1 cut(s) 118
NmuCI GTSAC 1 cut(s) 1594
NspI RCATGY 3 cut(s) 237, 380, 1058
PaeI GCATGC 1 cut(s) 380
PagI TCATGA 4 cut(s) 490, 556, 577, 907
PceI AGGCCT 2 cut(s) 1639, 1826
PciI ACATGT 1 cut(s) 233
PcsI WCGNNNNNNNCGW 2 cut(s) 1631, 2466
PctI GAATGC 1 cut(s) 148
PdiI GCCGGC 3 cut(s) 1382, 2144, 2239
PfeI GAWTC 5 cut(s) 500, 725, 1264, 1631, 1979
PflMI CCANNNNNTGG 2 cut(s) 1004, 1535
PfoI TCCNGGA 1 cut(s) 1314
PinAI ACCGGT 2 cut(s) 670, 1598
PleI GAGTC 3 cut(s) 105, 874, 2283
PmaCI CACGTG 1 cut(s) 2222
PmlI CACGTG 1 cut(s) 2222
PpsI GAGTC 3 cut(s) 105, 874, 2283
Ppu21I YACGTR 1 cut(s) 2222
PscI ACATGT 1 cut(s) 233
Psp124BI GAGCTC 2 cut(s) 1621, 1674
Psp1406I AACGTT 1 cut(s) 935
Psp6I CCWGG 2 cut(s) 1588, 1821
PspCI CACGTG 1 cut(s) 2222
PspEI GGTNACC 1 cut(s) 1206
PspGI CCWGG 2 cut(s) 1588, 1821
PspN4I GGNNCC 7 cut(s) 522, 669, 1488, 1540, 1900, 2181, 2343
PspPI GGNCC 2 cut(s) 1486, 1899
PsuI RGATCY 2 cut(s) 900, 2341
RsaI GTAC 5 cut(s) 209, 240, 603, 951, 978
RsaNI GTAC 5 cut(s) 208, 239, 602, 950, 977
RseI CAYNNNNRTG 3 cut(s) 160, 438, 893
SacI GAGCTC 2 cut(s) 1621, 1674
SalI GTCGAC 1 cut(s) 2277
SaqAI TTAA 7 cut(s) 396, 794, 861, 954, 972, 1001, 1188
Sau96I GGNCC 2 cut(s) 1486, 1899
SchI GAGTC 3 cut(s) 106, 875, 2284
ScrFI CCNGG 5 cut(s) 185, 1316, 1590, 1823, 1896
SduI GDGCHC 7 cut(s) 944, 1054, 1372, 1621, 1674, 2170, 2265
SfaNI GCATC 3 cut(s) 562, 1122, 1393
SfcI CTRYAG 1 cut(s) 58
SinI GGWCC 1 cut(s) 1899
SmiMI CAYNNNNRTG 3 cut(s) 160, 438, 893
SmlI CTYRAG 7 cut(s) 417, 449, 461, 971, 1080, 1130, 1298
SmoI CTYRAG 7 cut(s) 417, 449, 461, 971, 1080, 1130, 1298
SphI GCATGC 1 cut(s) 380
SseBI AGGCCT 2 cut(s) 1639, 1826
SspI AATATT 1 cut(s) 680
SspMI CTAG 8 cut(s) 276, 356, 456, 1158, 1491, 1575, 1778, 2001
SstI GAGCTC 2 cut(s) 1621, 1674
StuI AGGCCT 2 cut(s) 1639, 1826
StyD4I CCNGG 5 cut(s) 183, 1314, 1588, 1821, 1894
StyI CCWWGG 5 cut(s) 275, 894, 1259, 1534, 2324
TaiI ACGT 5 cut(s) 938, 1428, 1610, 1661, 2224
TaqII GACCGA 1 cut(s) 1611
TatI WGTACW 3 cut(s) 207, 601, 949
TauI GCSGC 8 cut(s) 1482, 1487, 1497, 1500, 1503, 1854, 1857, 2017
TfiI GAWTC 5 cut(s) 500, 725, 1264, 1631, 1979
Tru1I TTAA 7 cut(s) 396, 794, 861, 954, 972, 1001, 1188
Tru9I TTAA 7 cut(s) 396, 794, 861, 954, 972, 1001, 1188
TscAI CASTG 1 cut(s) 2042
TseFI GTSAC 1 cut(s) 1594
TseI GCWGC 2 cut(s) 1818, 2026
Tsp45I GTSAC 1 cut(s) 1594
TspGWI ACGGA 4 cut(s) 132, 1374, 2125, 2324
TspRI CASTG 1 cut(s) 2042
Van91I CCANNNNNTGG 2 cut(s) 1004, 1535
Vha464I CTTAAG 1 cut(s) 971
VpaK11BI GGWCC 1 cut(s) 1899
XapI RAATTY 3 cut(s) 628, 1710, 2456
XceI RCATGY 3 cut(s) 237, 380, 1058
XmaJI CCTAGG 1 cut(s) 275
XmiI GTMKAC 1 cut(s) 2278
XspI CTAG 8 cut(s) 276, 356, 456, 1158, 1491, 1575, 1778, 2001
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.