Rroxscaffold_7G00203720

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
OG0000195
Physical Location & Seq
Forward (+)
52638044 .. 52638829
786 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00203720.1

Sequence Viewer

Length: 705 bp
ATGCAAGTCGAATATGATTACGGTGATGTTGATGTACAAGAAAGTGAACTTGGTTATGAAAGTTCCAATGCAAATGATTCCCATGAAGAGGATGTTTTTTCTAGTGAGGAGGATGCGAAGTTTGAAGTAATGCACCACAATCCCTTATTCATTGAGGTCGTACTTGAACATGATTCCGATGAGGAGGATGACTTATCTAGTGGGGAGGATAAGGAGTTTAAAATCATACATCATAATCCCTTATTCATTGAGGTAGATATTCTCATGCCTCCCACATCCAAGGAGATCTATCATGAGTTTCCCAAGGTGGAGAGTAGAACATTGAGCACTTATGTTCTTTATGGGAAAATTGAGATTAAGGTATTTTTACCTCTCAATCCACCATTAAGTGGTCAATGTTTCTACAATGAGGTGATGGATTGGCAAGGAAAAAAAGCACTTGCACTCACCCTTTCCCATCACTCTCAAGAGCTTCTACCACGTATTGTTCCTATGAGCATCAATTCTAGACCACTTGAGAGGGAGGAGGCAAGTATATTGATACCTAGAAGAAAAATTGAGAAGAAGAGGAAAATTAAGAAGCTACACTTTTGGCCACCAATTGGAGTATTCTTTTGTAGCTCTTGGTCTTGCCTCTATGATATATCAAGGAGTCCCTTAGCCCCAAACAATAGGGTGGTCGCACTTGAGAAGTATTCACCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

234

Amino Acids

27.15

Weight (kDa)

5.03

Isoelectric Point (pI)

63.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000195)

Species Orthologous Gene IDs
fragaria_vesca FvH4_6g25780 FvH4_6g25920
rosa_chinensis RchiOBHm_Chr1g0366971 RchiOBHm_Chr1g0372841 RchiOBHm_Chr2g0146841 RchiOBHm_Chr2g0154821 RchiOBHm_Chr2g0159611 RchiOBHm_Chr3g0452071 RchiOBHm_Chr3g0453731 RchiOBHm_Chr3g0457891 RchiOBHm_Chr3g0471041 RchiOBHm_Chr3g0473741 RchiOBHm_Chr4g0427761 RchiOBHm_Chr5g0041301 RchiOBHm_Chr5g0076511 RchiOBHm_Chr6g0281431 RchiOBHm_Chr7g0180511
rosa_multiflora Rmu_sc0000082.1_g000052 Rmu_sc0000125.1_g000058 Rmu_sc0000147.1_g000108 Rmu_sc0000210.1_g000011 Rmu_sc0000229.1_g000006 Rmu_sc0000245.1_g000013 Rmu_sc0000897.1_g000016 Rmu_sc0001059.1_g000005 Rmu_sc0001336.1_g000059 Rmu_sc0001464.1_g000025 Rmu_sc0001630.1_g000013 Rmu_sc0001790.1_g000012 Rmu_sc0001939.1_g000003 Rmu_sc0002132.1_g000013 Rmu_sc0002235.1_g000008 Rmu_sc0002235.1_g000022 Rmu_sc0002548.1_g000030 Rmu_sc0002564.1_g000018 Rmu_sc0002652.1_g000001 Rmu_sc0002759.1_g000007 Rmu_sc0002759.1_g000011 Rmu_sc0002799.1_g000012 Rmu_sc0002858.1_g000033 Rmu_sc0002882.1_g000041 Rmu_sc0003032.1_g000030 Rmu_sc0003033.1_g000041 Rmu_sc0003044.1_g000038 Rmu_sc0003072.1_g000004 Rmu_sc0003264.1_g000025 Rmu_sc0003304.1_g000034 Rmu_sc0003416.1_g000002 Rmu_sc0003613.1_g000010 Rmu_sc0003762.1_g000009 Rmu_sc0003776.1_g000028 Rmu_sc0003859.1_g000025 Rmu_sc0004553.1_g000014 Rmu_sc0004866.1_g000002 Rmu_sc0004941.1_g000047 Rmu_sc0005777.1_g000002 Rmu_sc0005958.1_g000001 Rmu_sc0006573.1_g000001 Rmu_sc0006912.1_g000005 Rmu_sc0006968.1_g000002 Rmu_sc0006986.1_g000020 Rmu_sc0007258.1_g000016 Rmu_sc0007803.1_g000001 Rmu_sc0008479.1_g000003 Rmu_sc0008506.1_g000012 Rmu_sc0009199.1_g000005 Rmu_sc0009431.1_g000008 Rmu_sc0009611.1_g000005 Rmu_sc0014287.1_g000001 Rmu_sc0014768.1_g000001 Rmu_sc0020577.1_g000001 Rmu_sc0028131.1_g000001 Rmu_sc0029371.1_g000001 Rmu_sc0034219.1_g000001 Rmu_ssc0000252.1_g000026 Rmu_ssc0000252.1_g000027 Rmu_ssc0000398.1_g000023 Rmu_ssc0000482.1_g000020
rosa_roxburghii Rroxscaffold_158G00443700 Rroxscaffold_1G00001910 Rroxscaffold_1G00001960 Rroxscaffold_1G00002400 Rroxscaffold_1G00015110 Rroxscaffold_1G00015140 Rroxscaffold_1G00028870 Rroxscaffold_1G00028930 Rroxscaffold_1G00031320 Rroxscaffold_1G00031990 Rroxscaffold_1G00060310 Rroxscaffold_1G00063330 Rroxscaffold_1G00071570 Rroxscaffold_2G00084360 Rroxscaffold_2G00084370 Rroxscaffold_2G00088550 Rroxscaffold_2G00088560 Rroxscaffold_2G00089850 Rroxscaffold_2G00095470 Rroxscaffold_2G00103510 Rroxscaffold_2G00114380 Rroxscaffold_2G00119580 Rroxscaffold_2G00122990 Rroxscaffold_2G00125720 Rroxscaffold_3G00223380 Rroxscaffold_3G00230410 Rroxscaffold_3G00233640 Rroxscaffold_3G00234580 Rroxscaffold_3G00241070 Rroxscaffold_4G00282590 Rroxscaffold_4G00309420 Rroxscaffold_4G00309430 Rroxscaffold_4G00314030 Rroxscaffold_4G00314610 Rroxscaffold_4G00316420 Rroxscaffold_4G00319130 Rroxscaffold_4G00319140 Rroxscaffold_4G00319350 Rroxscaffold_4G00324170 Rroxscaffold_4G00324230 Rroxscaffold_5G00346540 Rroxscaffold_5G00346580 Rroxscaffold_5G00346790 Rroxscaffold_5G00349270 Rroxscaffold_5G00350530 Rroxscaffold_5G00373500 Rroxscaffold_5G00378950 Rroxscaffold_5G00378960 Rroxscaffold_5G00381870 Rroxscaffold_6G00388230 Rroxscaffold_6G00389700 Rroxscaffold_6G00389810 Rroxscaffold_6G00391690 Rroxscaffold_6G00391820 Rroxscaffold_6G00391830 Rroxscaffold_6G00393500 Rroxscaffold_6G00396180 Rroxscaffold_6G00396460 Rroxscaffold_6G00418900 Rroxscaffold_6G00423330 Rroxscaffold_7G00173340 Rroxscaffold_7G00176630 Rroxscaffold_7G00181910 Rroxscaffold_7G00191850 Rroxscaffold_7G00199230 Rroxscaffold_7G00199250 Rroxscaffold_7G00203720 Rroxscaffold_7G00204410 Rroxscaffold_7G00204420 Rroxscaffold_7G00212090 Rroxscaffold_7G00215450
rosa_rugosa Rorug07G0321500
rosa_samantha Rh3BG349100 Rh4AG240700
rosa_wichuraiana Rw0G011180 Rw1G003000 Rw5G028290 Rw6G011280

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 2 cut(s) 389, 602
AcoI YGGCCR 1 cut(s) 593
AfaI GTAC 2 cut(s) 36, 162
AfiI CCNNNNNNNGG 3 cut(s) 88, 389, 602
AgsI TTSAA 2 cut(s) 125, 167
AjuI GAANNNNNNNTTGG 2 cut(s) 33, 65
AluBI AGCT 3 cut(s) 472, 583, 621
AluI AGCT 3 cut(s) 472, 583, 621
Alw21I GWGCWC 1 cut(s) 329
AoxI GGCC 1 cut(s) 593
AsuHPI GGTGA 4 cut(s) 35, 424, 439, 690
BalI TGGCCA 1 cut(s) 595
Bbv12I GWGCWC 1 cut(s) 329
BccI CCATC 2 cut(s) 409, 465
BfaI CTAG 4 cut(s) 102, 198, 507, 546
BglII AGATCT 1 cut(s) 285
BmsI GCATC 2 cut(s) 103, 507
Bpu10I CCTNAGC 1 cut(s) 658
BpuEI CTTGAG 2 cut(s) 450, 536
BsaAI YACGTR 1 cut(s) 482
BsaJI CCNNGG 2 cut(s) 279, 303
Bsc4I CCNNNNNNNGG 3 cut(s) 88, 389, 602
BseDI CCNNGG 2 cut(s) 279, 303
BseGI GGATG 4 cut(s) 97, 118, 193, 275
BseLI CCNNNNNNNGG 3 cut(s) 88, 389, 602
BseRI GAGGAG 3 cut(s) 122, 197, 539
BshFI GGCC 1 cut(s) 595
BsiHKAI GWGCWC 1 cut(s) 329
BslFI GGGAC 1 cut(s) 639
BslI CCNNNNNNNGG 3 cut(s) 88, 389, 602
BsmFI GGGAC 1 cut(s) 639
BsnI GGCC 1 cut(s) 595
Bsp1286I GDGCHC 1 cut(s) 329
Bsp1407I TGTACA 1 cut(s) 34
Bsp143I GATC 1 cut(s) 285
BspANI GGCC 1 cut(s) 595
BspHI TCATGA 1 cut(s) 292
BsrGI TGTACA 1 cut(s) 34
BssECI CCNNGG 2 cut(s) 279, 303
BssMI GATC 1 cut(s) 285
BssT1I CCWWGG 2 cut(s) 279, 303
Bst4CI ACNGT 1 cut(s) 23
Bst6I CTCTTC 2 cut(s) 81, 560
BstAUI TGTACA 1 cut(s) 34
BstBAI YACGTR 1 cut(s) 482
BstDEI CTNAG 1 cut(s) 658
BstF5I GGATG 4 cut(s) 97, 118, 193, 275
BstKTI GATC 1 cut(s) 288
BstMBI GATC 1 cut(s) 285
BstX2I RGATCY 1 cut(s) 285
BstYI RGATCY 1 cut(s) 285
BsuRI GGCC 1 cut(s) 595
BtsCI GGATG 4 cut(s) 97, 118, 193, 275
CciI TCATGA 1 cut(s) 292
Csp6I GTAC 2 cut(s) 35, 161
CviAII CATG 4 cut(s) 83, 170, 265, 293
CviJI RGCY 5 cut(s) 472, 583, 595, 621, 662
CviKI_1 RGCY 5 cut(s) 472, 583, 595, 621, 662
CviQI GTAC 2 cut(s) 35, 161
DdeI CTNAG 1 cut(s) 658
DpnI GATC 1 cut(s) 287
DpnII GATC 1 cut(s) 285
DraI TTTAAA 1 cut(s) 220
EaeI YGGCCR 1 cut(s) 593
Eam1104I CTCTTC 2 cut(s) 81, 560
EarI CTCTTC 2 cut(s) 81, 560
Eco130I CCWWGG 2 cut(s) 279, 303
EcoT14I CCWWGG 2 cut(s) 279, 303
ErhI CCWWGG 2 cut(s) 279, 303
FaeI CATG 4 cut(s) 86, 173, 268, 296
FalI AAGNNNNNCTT 2 cut(s) 572, 604
FaqI GGGAC 1 cut(s) 639
FatI CATG 4 cut(s) 82, 169, 264, 292
FokI GGATG 4 cut(s) 104, 125, 200, 262
FspBI CTAG 4 cut(s) 102, 198, 507, 546
HaeIII GGCC 1 cut(s) 595
Hin1II CATG 4 cut(s) 86, 173, 268, 296
HinfI GANTC 3 cut(s) 77, 173, 652
HphI GGTGA 4 cut(s) 35, 424, 439, 690
Hpy166II GTNNAC 1 cut(s) 47
Hpy188I TCNGA 1 cut(s) 178
Hpy188III TCNNGA 3 cut(s) 293, 467, 507
Hpy8I GTNNAC 1 cut(s) 47
HpyCH4III ACNGT 1 cut(s) 23
HpyCH4IV ACGT 1 cut(s) 481
HpyCH4V TGCA 4 cut(s) 4, 71, 133, 443
HpyF3I CTNAG 1 cut(s) 658
HpySE526I ACGT 1 cut(s) 481
Hsp92II CATG 4 cut(s) 86, 173, 268, 296
Kzo9I GATC 1 cut(s) 285
LweI GCATC 2 cut(s) 103, 507
MaeI CTAG 4 cut(s) 102, 198, 507, 546
MaeII ACGT 1 cut(s) 481
MalI GATC 1 cut(s) 287
MboI GATC 1 cut(s) 285
MboII GAAGA 4 cut(s) 98, 561, 574, 577
MfeI CAATTG 1 cut(s) 600
MflI RGATCY 1 cut(s) 285
MhlI GDGCHC 1 cut(s) 329
MlsI TGGCCA 1 cut(s) 595
MluCI AATT 5 cut(s) 348, 502, 555, 573, 600
MluNI TGGCCA 1 cut(s) 595
MlyI GAGTC 1 cut(s) 661
Mox20I TGGCCA 1 cut(s) 595
MscI TGGCCA 1 cut(s) 595
MseI TTAA 5 cut(s) 219, 357, 386, 576, 703
Msp20I TGGCCA 1 cut(s) 595
MunI CAATTG 1 cut(s) 600
NdeII GATC 1 cut(s) 285
NlaIII CATG 4 cut(s) 86, 173, 268, 296
PagI TCATGA 1 cut(s) 292
PfeI GAWTC 2 cut(s) 77, 173
PflMI CCANNNNNTGG 2 cut(s) 389, 602
PleI GAGTC 1 cut(s) 660
PpsI GAGTC 1 cut(s) 660
Ppu21I YACGTR 1 cut(s) 482
PsuI RGATCY 1 cut(s) 285
RsaI GTAC 2 cut(s) 36, 162
RsaNI GTAC 2 cut(s) 35, 161
SaqAI TTAA 5 cut(s) 219, 357, 386, 576, 703
Sau3AI GATC 1 cut(s) 285
SchI GAGTC 1 cut(s) 661
SduI GDGCHC 1 cut(s) 329
SfaNI GCATC 2 cut(s) 103, 507
SmlI CTYRAG 3 cut(s) 465, 515, 686
SmoI CTYRAG 3 cut(s) 465, 515, 686
Sse9I AATT 5 cut(s) 348, 502, 555, 573, 600
SspMI CTAG 4 cut(s) 102, 198, 507, 546
StyI CCWWGG 2 cut(s) 279, 303
TaaI ACNGT 1 cut(s) 23
TaiI ACGT 1 cut(s) 484
TaqI TCGA 1 cut(s) 9
TasI AATT 5 cut(s) 348, 502, 555, 573, 600
TatI WGTACW 1 cut(s) 34
TfiI GAWTC 2 cut(s) 77, 173
Tru1I TTAA 5 cut(s) 219, 357, 386, 576, 703
Tru9I TTAA 5 cut(s) 219, 357, 386, 576, 703
TspDTI ATGAA 4 cut(s) 72, 99, 139, 235
Van91I CCANNNNNTGG 2 cut(s) 389, 602
XbaI TCTAGA 1 cut(s) 506
XspI CTAG 4 cut(s) 102, 198, 507, 546
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.