Rroxscaffold_1G00028930

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
OG0000195
Physical Location & Seq
Reverse (-)
37341973 .. 37342824
852 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00028930.1

Sequence Viewer

Length: 852 bp
ATGGATCAATGGAGCTATGGATGGGATGATCGTAGGGGATATGAGCAACAAAGTTATAATGGTGAAGGTTATCAAGAATGGAATCCCTATGCCGAAAGTCCTATGCCTTGTTACAACCAACCTTGTGCTTTGTGTAATTCTCCGTGGCATTCACCTTTTAAGTGTTCTTTGAGGTTTGAGTACGCGGATTTTATGCAAGAATATGAGTACAAGATGGGGATGTATCAAGAGACATGTGTACCCGAAGCATATCCACAAGAGCAAGCTTTTGAGCCTAGGAAGCCATCACTTGAAGAACAACTAGCTCAATTGGAAGCCTCTAATGCTCAATTGCAAGCCTCCCAAGCTCGGTGTCTAGCCTCTCAAGCTCGATTGCACGCTAAATTGGAAGCCTTTAATGCTCAATTGCAAGCTTCTCAAGAAATGACTTCACATTCCAATGAGCAACTTGAGTCCGGTCTTGAGCAAGAGCCACCATTCACCATTTGTCATGAGCAAGATTCTTTCTTTGATCAAGTGGAGCTTATTTCAAGAGAAGGAGTATATTTTGAGCATCATGAGCAAGAGTTGCCTCTTCAAGATCGAGAGAGTGATGTTCATATACTTGAAAGTGTGTTTGGTTATGGAAATTTTGAAGCAAGTGGGTTGAGAGACTACACTTCGGAGGAACCGGTGCAATATTGGAAATCTAATCTTCACAATGAAAATGAGGTATATGAAGTTGATTCCGAAGAAGATGATAGCTTGTCTAGTGAGGAGGATGCGGAGCTTGAAGAGCTATACCATGATCCCTTAATCCTTGAGGCCGATATTTCCAAGGAGGAAGAGAGTCCTTTAATGCGGTGTACTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

283

Amino Acids

33.05

Weight (kDa)

4.2

Isoelectric Point (pI)

67.98

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000195)

Species Orthologous Gene IDs
fragaria_vesca FvH4_6g25780 FvH4_6g25920
rosa_chinensis RchiOBHm_Chr1g0366971 RchiOBHm_Chr1g0372841 RchiOBHm_Chr2g0146841 RchiOBHm_Chr2g0154821 RchiOBHm_Chr2g0159611 RchiOBHm_Chr3g0452071 RchiOBHm_Chr3g0453731 RchiOBHm_Chr3g0457891 RchiOBHm_Chr3g0471041 RchiOBHm_Chr3g0473741 RchiOBHm_Chr4g0427761 RchiOBHm_Chr5g0041301 RchiOBHm_Chr5g0076511 RchiOBHm_Chr6g0281431 RchiOBHm_Chr7g0180511
rosa_multiflora Rmu_sc0000082.1_g000052 Rmu_sc0000125.1_g000058 Rmu_sc0000147.1_g000108 Rmu_sc0000210.1_g000011 Rmu_sc0000229.1_g000006 Rmu_sc0000245.1_g000013 Rmu_sc0000897.1_g000016 Rmu_sc0001059.1_g000005 Rmu_sc0001336.1_g000059 Rmu_sc0001464.1_g000025 Rmu_sc0001630.1_g000013 Rmu_sc0001790.1_g000012 Rmu_sc0001939.1_g000003 Rmu_sc0002132.1_g000013 Rmu_sc0002235.1_g000008 Rmu_sc0002235.1_g000022 Rmu_sc0002548.1_g000030 Rmu_sc0002564.1_g000018 Rmu_sc0002652.1_g000001 Rmu_sc0002759.1_g000007 Rmu_sc0002759.1_g000011 Rmu_sc0002799.1_g000012 Rmu_sc0002858.1_g000033 Rmu_sc0002882.1_g000041 Rmu_sc0003032.1_g000030 Rmu_sc0003033.1_g000041 Rmu_sc0003044.1_g000038 Rmu_sc0003072.1_g000004 Rmu_sc0003264.1_g000025 Rmu_sc0003304.1_g000034 Rmu_sc0003416.1_g000002 Rmu_sc0003613.1_g000010 Rmu_sc0003762.1_g000009 Rmu_sc0003776.1_g000028 Rmu_sc0003859.1_g000025 Rmu_sc0004553.1_g000014 Rmu_sc0004866.1_g000002 Rmu_sc0004941.1_g000047 Rmu_sc0005777.1_g000002 Rmu_sc0005958.1_g000001 Rmu_sc0006573.1_g000001 Rmu_sc0006912.1_g000005 Rmu_sc0006968.1_g000002 Rmu_sc0006986.1_g000020 Rmu_sc0007258.1_g000016 Rmu_sc0007803.1_g000001 Rmu_sc0008479.1_g000003 Rmu_sc0008506.1_g000012 Rmu_sc0009199.1_g000005 Rmu_sc0009431.1_g000008 Rmu_sc0009611.1_g000005 Rmu_sc0014287.1_g000001 Rmu_sc0014768.1_g000001 Rmu_sc0020577.1_g000001 Rmu_sc0028131.1_g000001 Rmu_sc0029371.1_g000001 Rmu_sc0034219.1_g000001 Rmu_ssc0000252.1_g000026 Rmu_ssc0000252.1_g000027 Rmu_ssc0000398.1_g000023 Rmu_ssc0000482.1_g000020
rosa_roxburghii Rroxscaffold_158G00443700 Rroxscaffold_1G00001910 Rroxscaffold_1G00001960 Rroxscaffold_1G00002400 Rroxscaffold_1G00015110 Rroxscaffold_1G00015140 Rroxscaffold_1G00028870 Rroxscaffold_1G00028930 Rroxscaffold_1G00031320 Rroxscaffold_1G00031990 Rroxscaffold_1G00060310 Rroxscaffold_1G00063330 Rroxscaffold_1G00071570 Rroxscaffold_2G00084360 Rroxscaffold_2G00084370 Rroxscaffold_2G00088550 Rroxscaffold_2G00088560 Rroxscaffold_2G00089850 Rroxscaffold_2G00095470 Rroxscaffold_2G00103510 Rroxscaffold_2G00114380 Rroxscaffold_2G00119580 Rroxscaffold_2G00122990 Rroxscaffold_2G00125720 Rroxscaffold_3G00223380 Rroxscaffold_3G00230410 Rroxscaffold_3G00233640 Rroxscaffold_3G00234580 Rroxscaffold_3G00241070 Rroxscaffold_4G00282590 Rroxscaffold_4G00309420 Rroxscaffold_4G00309430 Rroxscaffold_4G00314030 Rroxscaffold_4G00314610 Rroxscaffold_4G00316420 Rroxscaffold_4G00319130 Rroxscaffold_4G00319140 Rroxscaffold_4G00319350 Rroxscaffold_4G00324170 Rroxscaffold_4G00324230 Rroxscaffold_5G00346540 Rroxscaffold_5G00346580 Rroxscaffold_5G00346790 Rroxscaffold_5G00349270 Rroxscaffold_5G00350530 Rroxscaffold_5G00373500 Rroxscaffold_5G00378950 Rroxscaffold_5G00378960 Rroxscaffold_5G00381870 Rroxscaffold_6G00388230 Rroxscaffold_6G00389700 Rroxscaffold_6G00389810 Rroxscaffold_6G00391690 Rroxscaffold_6G00391820 Rroxscaffold_6G00391830 Rroxscaffold_6G00393500 Rroxscaffold_6G00396180 Rroxscaffold_6G00396460 Rroxscaffold_6G00418900 Rroxscaffold_6G00423330 Rroxscaffold_7G00173340 Rroxscaffold_7G00176630 Rroxscaffold_7G00181910 Rroxscaffold_7G00191850 Rroxscaffold_7G00199230 Rroxscaffold_7G00199250 Rroxscaffold_7G00203720 Rroxscaffold_7G00204410 Rroxscaffold_7G00204420 Rroxscaffold_7G00212090 Rroxscaffold_7G00215450
rosa_rugosa Rorug07G0321500
rosa_samantha Rh3BG349100 Rh4AG240700
rosa_wichuraiana Rw0G011180 Rw1G003000 Rw5G028290 Rw6G011280

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 57
AccII CGCG 1 cut(s) 185
AciI CCGC 3 cut(s) 185, 764, 841
AclWI GGATC 2 cut(s) 12, 782
AcsI RAATTY 1 cut(s) 628
AfaI GTAC 4 cut(s) 182, 209, 240, 847
AfiI CCNNNNNNNGG 1 cut(s) 348
AflIII ACRYGT 1 cut(s) 233
AgeI ACCGGT 1 cut(s) 670
AgsI TTSAA 6 cut(s) 293, 531, 578, 608, 635, 773
AjuI GAANNNNNNNTTGG 2 cut(s) 600, 632
Alw26I GTCTC 2 cut(s) 224, 645
AlwI GGATC 2 cut(s) 12, 782
AoxI GGCC 1 cut(s) 804
ApoI RAATTY 1 cut(s) 628
AsiGI ACCGGT 1 cut(s) 670
AspA2I CCTAGG 1 cut(s) 275
AsuHPI GGTGA 3 cut(s) 74, 144, 472
AvrII CCTAGG 1 cut(s) 275
BaeI ACNNNNGTAYC 2 cut(s) 222, 255
BccI CCATC 3 cut(s) 15, 208, 292
BclI TGATCA 1 cut(s) 511
BcoDI GTCTC 2 cut(s) 224, 645
BfaI CTAG 4 cut(s) 276, 302, 356, 750
BlnI CCTAGG 1 cut(s) 275
BmiI GGNNCC 1 cut(s) 669
BmsI GCATC 2 cut(s) 562, 751
BpuEI CTTGAG 5 cut(s) 348, 402, 470, 482, 821
BsaJI CCNNGG 3 cut(s) 143, 275, 816
BsaWI WCCGGW 2 cut(s) 455, 670
Bsc4I CCNNNNNNNGG 1 cut(s) 348
Bse118I RCCGGY 1 cut(s) 670
BseDI CCNNGG 3 cut(s) 143, 275, 816
BseGI GGATG 4 cut(s) 26, 31, 225, 766
BseLI CCNNNNNNNGG 1 cut(s) 348
BseRI GAGGAG 1 cut(s) 770
Bsh1236I CGCG 1 cut(s) 185
BshFI GGCC 1 cut(s) 806
BshTI ACCGGT 1 cut(s) 670
BsiSI CCGG 2 cut(s) 456, 671
BslI CCNNNNNNNGG 1 cut(s) 348
BsmAI GTCTC 2 cut(s) 224, 645
BsmI GAATGC 1 cut(s) 148
BsnI GGCC 1 cut(s) 806
Bsp143I GATC 5 cut(s) 4, 28, 511, 580, 787
BspACI CCGC 3 cut(s) 185, 764, 841
BspANI GGCC 1 cut(s) 806
BspFNI CGCG 1 cut(s) 185
BspHI TCATGA 2 cut(s) 490, 556
BspLI GGNNCC 1 cut(s) 669
BspPI GGATC 2 cut(s) 12, 782
BspQI GCTCTTC 1 cut(s) 768
BsrFI RCCGGY 1 cut(s) 670
BssAI RCCGGY 1 cut(s) 670
BssECI CCNNGG 3 cut(s) 143, 275, 816
BssMI GATC 5 cut(s) 4, 28, 511, 580, 787
BssT1I CCWWGG 2 cut(s) 275, 816
Bst6I CTCTTC 3 cut(s) 579, 768, 819
BstAPI GCANNNNNTGC 1 cut(s) 568
BstC8I GCNNGC 4 cut(s) 264, 336, 378, 411
BstDSI CCRYGG 1 cut(s) 143
BstF5I GGATG 4 cut(s) 26, 31, 225, 766
BstFNI CGCG 1 cut(s) 185
BstKTI GATC 5 cut(s) 7, 31, 514, 583, 790
BstMAI GTCTC 2 cut(s) 224, 645
BstMBI GATC 5 cut(s) 4, 28, 511, 580, 787
BstMWI GCNNNNNNNGC 8 cut(s) 280, 323, 344, 365, 398, 559, 568, 775
BstNSI RCATGY 1 cut(s) 237
BstUI CGCG 1 cut(s) 185
BsuRI GGCC 1 cut(s) 806
BtgI CCRYGG 1 cut(s) 143
BtsCI GGATG 4 cut(s) 26, 31, 225, 766
Cac8I GCNNGC 4 cut(s) 264, 336, 378, 411
CciI TCATGA 2 cut(s) 490, 556
Cfr10I RCCGGY 1 cut(s) 670
Csp6I GTAC 4 cut(s) 181, 208, 239, 846
CspAI ACCGGT 1 cut(s) 670
CviAII CATG 4 cut(s) 234, 491, 557, 785
CviQI GTAC 4 cut(s) 181, 208, 239, 846
DpnI GATC 5 cut(s) 6, 30, 513, 582, 789
DpnII GATC 5 cut(s) 4, 28, 511, 580, 787
Eam1104I CTCTTC 3 cut(s) 579, 768, 819
EarI CTCTTC 3 cut(s) 579, 768, 819
Eco130I CCWWGG 2 cut(s) 275, 816
EcoT14I CCWWGG 2 cut(s) 275, 816
ErhI CCWWGG 2 cut(s) 275, 816
FaeI CATG 4 cut(s) 237, 494, 560, 788
FalI AAGNNNNNCTT 2 cut(s) 507, 539
FatI CATG 4 cut(s) 233, 490, 556, 784
FbaI TGATCA 1 cut(s) 511
FokI GGATG 4 cut(s) 33, 38, 232, 773
FspBI CTAG 4 cut(s) 276, 302, 356, 750
HaeIII GGCC 1 cut(s) 806
HapII CCGG 2 cut(s) 456, 671
Hin1II CATG 4 cut(s) 237, 494, 560, 788
HindIII AAGCTT 2 cut(s) 264, 411
HinfI GANTC 5 cut(s) 82, 452, 500, 725, 829
HpaII CCGG 2 cut(s) 456, 671
HphI GGTGA 3 cut(s) 74, 144, 472
Hpy166II GTNNAC 2 cut(s) 239, 846
Hpy188I TCNGA 2 cut(s) 664, 730
Hpy188III TCNNGA 9 cut(s) 74, 227, 419, 461, 491, 531, 557, 578, 584
Hpy8I GTNNAC 2 cut(s) 239, 846
HpyAV CCTTC 2 cut(s) 59, 530
HpyCH4V TGCA 5 cut(s) 196, 334, 376, 409, 676
HpyF10VI GCNNNNNNNGC 8 cut(s) 280, 323, 344, 365, 398, 559, 568, 775
Hsp92II CATG 4 cut(s) 237, 494, 560, 788
Ksp22I TGATCA 1 cut(s) 511
Kzo9I GATC 5 cut(s) 4, 28, 511, 580, 787
LguI GCTCTTC 1 cut(s) 768
LmnI GCTCC 3 cut(s) 12, 520, 766
LpnPI CCDG 2 cut(s) 469, 684
LweI GCATC 2 cut(s) 562, 751
MaeI CTAG 4 cut(s) 276, 302, 356, 750
MaeIII GTNAC 1 cut(s) 110
MalI GATC 5 cut(s) 6, 30, 513, 582, 789
MboI GATC 5 cut(s) 4, 28, 511, 580, 787
MboII GAAGA 7 cut(s) 305, 566, 686, 743, 746, 785, 836
MfeI CAATTG 3 cut(s) 308, 329, 404
MluCI AATT 6 cut(s) 136, 308, 329, 383, 404, 628
MlyI GAGTC 2 cut(s) 461, 838
MseI TTAA 4 cut(s) 159, 396, 794, 836
MslI CAYNNNNRTG 1 cut(s) 438
MspI CCGG 2 cut(s) 456, 671
MunI CAATTG 3 cut(s) 308, 329, 404
Mva1269I GAATGC 1 cut(s) 148
MvnI CGCG 1 cut(s) 185
MwoI GCNNNNNNNGC 8 cut(s) 280, 323, 344, 365, 398, 559, 568, 775
NdeII GATC 5 cut(s) 4, 28, 511, 580, 787
NlaIII CATG 4 cut(s) 237, 494, 560, 788
NlaIV GGNNCC 1 cut(s) 669
NspI RCATGY 1 cut(s) 237
PagI TCATGA 2 cut(s) 490, 556
PciI ACATGT 1 cut(s) 233
PciSI GCTCTTC 1 cut(s) 768
PctI GAATGC 1 cut(s) 148
PfeI GAWTC 3 cut(s) 82, 500, 725
PinAI ACCGGT 1 cut(s) 670
PleI GAGTC 2 cut(s) 460, 837
PpsI GAGTC 2 cut(s) 460, 837
PscI ACATGT 1 cut(s) 233
PsiI TTATAA 1 cut(s) 57
PspN4I GGNNCC 1 cut(s) 669
RsaI GTAC 4 cut(s) 182, 209, 240, 847
RsaNI GTAC 4 cut(s) 181, 208, 239, 846
RseI CAYNNNNRTG 1 cut(s) 438
SapI GCTCTTC 1 cut(s) 768
SaqAI TTAA 4 cut(s) 159, 396, 794, 836
Sau3AI GATC 5 cut(s) 4, 28, 511, 580, 787
SchI GAGTC 2 cut(s) 461, 838
SfaNI GCATC 2 cut(s) 562, 751
SmiMI CAYNNNNRTG 1 cut(s) 438
SmlI CTYRAG 5 cut(s) 363, 417, 449, 461, 800
SmoI CTYRAG 5 cut(s) 363, 417, 449, 461, 800
Sse9I AATT 6 cut(s) 136, 308, 329, 383, 404, 628
SsiI CCGC 3 cut(s) 185, 764, 841
SspI AATATT 1 cut(s) 680
SspMI CTAG 4 cut(s) 276, 302, 356, 750
StyI CCWWGG 2 cut(s) 275, 816
TaqI TCGA 2 cut(s) 370, 583
TasI AATT 6 cut(s) 136, 308, 329, 383, 404, 628
TatI WGTACW 2 cut(s) 207, 845
TfiI GAWTC 3 cut(s) 82, 500, 725
Tru1I TTAA 4 cut(s) 159, 396, 794, 836
Tru9I TTAA 4 cut(s) 159, 396, 794, 836
TspDTI ATGAA 3 cut(s) 587, 717, 732
TspGWI ACGGA 1 cut(s) 132
XapI RAATTY 1 cut(s) 628
XceI RCATGY 1 cut(s) 237
XmaJI CCTAGG 1 cut(s) 275
XspI CTAG 4 cut(s) 276, 302, 356, 750
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.