Rroxscaffold_4G00319130

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
OG0000195
Physical Location & Seq
Reverse (-)
46636925 .. 46638011
1087 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00319130.1

Sequence Viewer

Length: 684 bp
ATGGCCGGAGATCAGTTCCTCCACCGAGTGCGTATAGGGAGGGAGAAAGAAGAGCAAGCTTTTGAGCCTAGGAAGCCATCACTTGAAGAACAACTAGCTCAATTGGAAGCCTCTAATGCTCAATTGCAAGCCTCCCAAGCTCGATTGCAAGCTAAATTGCAAGCCTTCAATGCTCAATTGCAAGCTTCTCAAGAAATGATTTCACATTCCAATGAGCAACTTGAGCCTAGTGTTGCACAAGAGCCACCATTCACCATTTGTCATGAGCAAGATTCTTTCTTTGAACAAGTGGAGCCTAATTCAAGAGAAGGAGTATATTTTGAGCATCATGAGCAAGAGTTGCCTCTTCAAGATCGAGAGGGTGATGTTCATGAACTCGAAAGTGTGCTTGGTTATGAAAATTTTGAAGCAAGTGAGTTGAGAGACTACACTTTGGAGGAACCGGTGCAATATTGGAAATCTAATCTTCACAATGAAGAAGAGAAATATGAAGTTGATTCCAAAGAAGAGGATAGCTTGTTTAGTGAGGAGGATGTGGAGCTTGAAGACTTACACCATATTTTCTTAATTGTTGAGGCCGATATTCCCAAGGAGGAAGAGAGTCCTTCAATACCTTGTGATGATGAAGAAATTGAAGAGCCAAGGACTTTCTCTCCCTCCCACATCCACGGAGATCCATCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

227

Amino Acids

26.34

Weight (kDa)

4.31

Isoelectric Point (pI)

74.01

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000195)

Species Orthologous Gene IDs
fragaria_vesca FvH4_6g25780 FvH4_6g25920
rosa_chinensis RchiOBHm_Chr1g0366971 RchiOBHm_Chr1g0372841 RchiOBHm_Chr2g0146841 RchiOBHm_Chr2g0154821 RchiOBHm_Chr2g0159611 RchiOBHm_Chr3g0452071 RchiOBHm_Chr3g0453731 RchiOBHm_Chr3g0457891 RchiOBHm_Chr3g0471041 RchiOBHm_Chr3g0473741 RchiOBHm_Chr4g0427761 RchiOBHm_Chr5g0041301 RchiOBHm_Chr5g0076511 RchiOBHm_Chr6g0281431 RchiOBHm_Chr7g0180511
rosa_multiflora Rmu_sc0000082.1_g000052 Rmu_sc0000125.1_g000058 Rmu_sc0000147.1_g000108 Rmu_sc0000210.1_g000011 Rmu_sc0000229.1_g000006 Rmu_sc0000245.1_g000013 Rmu_sc0000897.1_g000016 Rmu_sc0001059.1_g000005 Rmu_sc0001336.1_g000059 Rmu_sc0001464.1_g000025 Rmu_sc0001630.1_g000013 Rmu_sc0001790.1_g000012 Rmu_sc0001939.1_g000003 Rmu_sc0002132.1_g000013 Rmu_sc0002235.1_g000008 Rmu_sc0002235.1_g000022 Rmu_sc0002548.1_g000030 Rmu_sc0002564.1_g000018 Rmu_sc0002652.1_g000001 Rmu_sc0002759.1_g000007 Rmu_sc0002759.1_g000011 Rmu_sc0002799.1_g000012 Rmu_sc0002858.1_g000033 Rmu_sc0002882.1_g000041 Rmu_sc0003032.1_g000030 Rmu_sc0003033.1_g000041 Rmu_sc0003044.1_g000038 Rmu_sc0003072.1_g000004 Rmu_sc0003264.1_g000025 Rmu_sc0003304.1_g000034 Rmu_sc0003416.1_g000002 Rmu_sc0003613.1_g000010 Rmu_sc0003762.1_g000009 Rmu_sc0003776.1_g000028 Rmu_sc0003859.1_g000025 Rmu_sc0004553.1_g000014 Rmu_sc0004866.1_g000002 Rmu_sc0004941.1_g000047 Rmu_sc0005777.1_g000002 Rmu_sc0005958.1_g000001 Rmu_sc0006573.1_g000001 Rmu_sc0006912.1_g000005 Rmu_sc0006968.1_g000002 Rmu_sc0006986.1_g000020 Rmu_sc0007258.1_g000016 Rmu_sc0007803.1_g000001 Rmu_sc0008479.1_g000003 Rmu_sc0008506.1_g000012 Rmu_sc0009199.1_g000005 Rmu_sc0009431.1_g000008 Rmu_sc0009611.1_g000005 Rmu_sc0014287.1_g000001 Rmu_sc0014768.1_g000001 Rmu_sc0020577.1_g000001 Rmu_sc0028131.1_g000001 Rmu_sc0029371.1_g000001 Rmu_sc0034219.1_g000001 Rmu_ssc0000252.1_g000026 Rmu_ssc0000252.1_g000027 Rmu_ssc0000398.1_g000023 Rmu_ssc0000482.1_g000020
rosa_roxburghii Rroxscaffold_158G00443700 Rroxscaffold_1G00001910 Rroxscaffold_1G00001960 Rroxscaffold_1G00002400 Rroxscaffold_1G00015110 Rroxscaffold_1G00015140 Rroxscaffold_1G00028870 Rroxscaffold_1G00028930 Rroxscaffold_1G00031320 Rroxscaffold_1G00031990 Rroxscaffold_1G00060310 Rroxscaffold_1G00063330 Rroxscaffold_1G00071570 Rroxscaffold_2G00084360 Rroxscaffold_2G00084370 Rroxscaffold_2G00088550 Rroxscaffold_2G00088560 Rroxscaffold_2G00089850 Rroxscaffold_2G00095470 Rroxscaffold_2G00103510 Rroxscaffold_2G00114380 Rroxscaffold_2G00119580 Rroxscaffold_2G00122990 Rroxscaffold_2G00125720 Rroxscaffold_3G00223380 Rroxscaffold_3G00230410 Rroxscaffold_3G00233640 Rroxscaffold_3G00234580 Rroxscaffold_3G00241070 Rroxscaffold_4G00282590 Rroxscaffold_4G00309420 Rroxscaffold_4G00309430 Rroxscaffold_4G00314030 Rroxscaffold_4G00314610 Rroxscaffold_4G00316420 Rroxscaffold_4G00319130 Rroxscaffold_4G00319140 Rroxscaffold_4G00319350 Rroxscaffold_4G00324170 Rroxscaffold_4G00324230 Rroxscaffold_5G00346540 Rroxscaffold_5G00346580 Rroxscaffold_5G00346790 Rroxscaffold_5G00349270 Rroxscaffold_5G00350530 Rroxscaffold_5G00373500 Rroxscaffold_5G00378950 Rroxscaffold_5G00378960 Rroxscaffold_5G00381870 Rroxscaffold_6G00388230 Rroxscaffold_6G00389700 Rroxscaffold_6G00389810 Rroxscaffold_6G00391690 Rroxscaffold_6G00391820 Rroxscaffold_6G00391830 Rroxscaffold_6G00393500 Rroxscaffold_6G00396180 Rroxscaffold_6G00396460 Rroxscaffold_6G00418900 Rroxscaffold_6G00423330 Rroxscaffold_7G00173340 Rroxscaffold_7G00176630 Rroxscaffold_7G00181910 Rroxscaffold_7G00191850 Rroxscaffold_7G00199230 Rroxscaffold_7G00199250 Rroxscaffold_7G00203720 Rroxscaffold_7G00204410 Rroxscaffold_7G00204420 Rroxscaffold_7G00212090 Rroxscaffold_7G00215450
rosa_rugosa Rorug07G0321500
rosa_samantha Rh3BG349100 Rh4AG240700
rosa_wichuraiana Rw0G011180 Rw1G003000 Rw5G028290 Rw6G011280

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 668
AcoI YGGCCR 1 cut(s) 3
AcsI RAATTY 1 cut(s) 400
AdeI CACNNNGTG 1 cut(s) 28
AgeI ACCGGT 1 cut(s) 442
AgsI TTSAA 9 cut(s) 86, 169, 284, 303, 350, 407, 545, 609, 635
AjuI GAANNNNNNNTTGG 2 cut(s) 372, 404
AluBI AGCT 7 cut(s) 59, 98, 140, 152, 185, 516, 541
AluI AGCT 7 cut(s) 59, 98, 140, 152, 185, 516, 541
Alw26I GTCTC 1 cut(s) 417
AlwI GGATC 1 cut(s) 668
AoxI GGCC 2 cut(s) 3, 576
ApoI RAATTY 1 cut(s) 400
AsiGI ACCGGT 1 cut(s) 442
AspA2I CCTAGG 1 cut(s) 68
AsuHPI GGTGA 2 cut(s) 244, 374
AvrII CCTAGG 1 cut(s) 68
BbsI GAAGAC 1 cut(s) 552
BccI CCATC 1 cut(s) 85
BcoDI GTCTC 1 cut(s) 417
BfaI CTAG 3 cut(s) 69, 95, 228
BlnI CCTAGG 1 cut(s) 68
BmiI GGNNCC 2 cut(s) 294, 441
BmsI GCATC 1 cut(s) 334
BpiI GAAGAC 1 cut(s) 552
BpuEI CTTGAG 2 cut(s) 174, 242
BsaJI CCNNGG 4 cut(s) 68, 588, 641, 667
BsaWI WCCGGW 1 cut(s) 442
BsaXI ACNNNNNCTCC 2 cut(s) 637, 667
Bse118I RCCGGY 1 cut(s) 442
BseDI CCNNGG 4 cut(s) 68, 588, 641, 667
BseGI GGATG 2 cut(s) 538, 663
BseRI GAGGAG 1 cut(s) 542
BshFI GGCC 2 cut(s) 5, 578
BshTI ACCGGT 1 cut(s) 442
BsiSI CCGG 2 cut(s) 6, 443
BsmAI GTCTC 1 cut(s) 417
BsnI GGCC 2 cut(s) 5, 578
Bsp143I GATC 3 cut(s) 10, 352, 673
BspANI GGCC 2 cut(s) 5, 578
BspHI TCATGA 4 cut(s) 262, 328, 370, 680
BspLI GGNNCC 2 cut(s) 294, 441
BspPI GGATC 1 cut(s) 668
BspQI GCTCTTC 2 cut(s) 45, 630
BsrFI RCCGGY 1 cut(s) 442
BssAI RCCGGY 1 cut(s) 442
BssECI CCNNGG 4 cut(s) 68, 588, 641, 667
BssMI GATC 3 cut(s) 10, 352, 673
BssT1I CCWWGG 3 cut(s) 68, 588, 641
Bst6I CTCTTC 6 cut(s) 45, 351, 474, 501, 591, 630
BstAPI GCANNNNNTGC 1 cut(s) 340
BstC8I GCNNGC 5 cut(s) 57, 129, 150, 162, 183
BstDSI CCRYGG 1 cut(s) 667
BstF5I GGATG 2 cut(s) 538, 663
BstKTI GATC 3 cut(s) 13, 355, 676
BstMAI GTCTC 1 cut(s) 417
BstMBI GATC 3 cut(s) 10, 352, 673
BstMWI GCNNNNNNNGC 7 cut(s) 73, 116, 137, 170, 223, 331, 340
BstV2I GAAGAC 1 cut(s) 552
BstX2I RGATCY 1 cut(s) 673
BstYI RGATCY 1 cut(s) 673
BsuRI GGCC 2 cut(s) 5, 578
BtgI CCRYGG 1 cut(s) 667
BtsCI GGATG 2 cut(s) 538, 663
Cac8I GCNNGC 5 cut(s) 57, 129, 150, 162, 183
CciI TCATGA 4 cut(s) 262, 328, 370, 680
Cfr10I RCCGGY 1 cut(s) 442
CspAI ACCGGT 1 cut(s) 442
CviAII CATG 4 cut(s) 263, 329, 371, 681
DpnI GATC 3 cut(s) 12, 354, 675
DpnII GATC 3 cut(s) 10, 352, 673
DraIII CACNNNGTG 1 cut(s) 28
EaeI YGGCCR 1 cut(s) 3
Eam1104I CTCTTC 6 cut(s) 45, 351, 474, 501, 591, 630
EarI CTCTTC 6 cut(s) 45, 351, 474, 501, 591, 630
Eco130I CCWWGG 3 cut(s) 68, 588, 641
EcoT14I CCWWGG 3 cut(s) 68, 588, 641
ErhI CCWWGG 3 cut(s) 68, 588, 641
FaeI CATG 4 cut(s) 266, 332, 374, 684
FaiI YATR 9 cut(s) 35, 264, 316, 330, 372, 396, 489, 558, 682
FatI CATG 4 cut(s) 262, 328, 370, 680
FokI GGATG 2 cut(s) 545, 650
FspBI CTAG 3 cut(s) 69, 95, 228
HaeIII GGCC 2 cut(s) 5, 578
HapII CCGG 2 cut(s) 6, 443
Hin1II CATG 4 cut(s) 266, 332, 374, 684
HindIII AAGCTT 2 cut(s) 57, 183
HinfI GANTC 3 cut(s) 272, 497, 601
HpaII CCGG 2 cut(s) 6, 443
HphI GGTGA 2 cut(s) 244, 374
Hpy188III TCNNGA 8 cut(s) 191, 263, 303, 329, 350, 356, 371, 681
HpyAV CCTTC 3 cut(s) 175, 302, 615
HpyCH4V TGCA 6 cut(s) 127, 148, 160, 181, 236, 448
HpyF10VI GCNNNNNNNGC 7 cut(s) 73, 116, 137, 170, 223, 331, 340
Hsp92II CATG 4 cut(s) 266, 332, 374, 684
Kzo9I GATC 3 cut(s) 10, 352, 673
LguI GCTCTTC 2 cut(s) 45, 630
LmnI GCTCC 2 cut(s) 292, 538
LpnPI CCDG 2 cut(s) 19, 456
LweI GCATC 1 cut(s) 334
MaeI CTAG 3 cut(s) 69, 95, 228
MalI GATC 3 cut(s) 12, 354, 675
MboI GATC 3 cut(s) 10, 352, 673
MfeI CAATTG 3 cut(s) 101, 122, 176
MflI RGATCY 1 cut(s) 673
MluCI AATT 8 cut(s) 101, 122, 155, 176, 298, 400, 567, 630
MlyI GAGTC 1 cut(s) 610
MseI TTAA 1 cut(s) 566
MslI CAYNNNNRTG 1 cut(s) 210
MspI CCGG 2 cut(s) 6, 443
MunI CAATTG 3 cut(s) 101, 122, 176
MwoI GCNNNNNNNGC 7 cut(s) 73, 116, 137, 170, 223, 331, 340
NdeII GATC 3 cut(s) 10, 352, 673
NlaIII CATG 4 cut(s) 266, 332, 374, 684
NlaIV GGNNCC 2 cut(s) 294, 441
PagI TCATGA 4 cut(s) 262, 328, 370, 680
PciSI GCTCTTC 2 cut(s) 45, 630
PfeI GAWTC 2 cut(s) 272, 497
PinAI ACCGGT 1 cut(s) 442
PleI GAGTC 1 cut(s) 609
PpsI GAGTC 1 cut(s) 609
PspN4I GGNNCC 2 cut(s) 294, 441
PsuI RGATCY 1 cut(s) 673
RseI CAYNNNNRTG 1 cut(s) 210
SapI GCTCTTC 2 cut(s) 45, 630
SaqAI TTAA 1 cut(s) 566
Sau3AI GATC 3 cut(s) 10, 352, 673
SchI GAGTC 1 cut(s) 610
SetI ASST 8 cut(s) 61, 100, 142, 154, 187, 518, 543, 616
SfaNI GCATC 1 cut(s) 334
SmiMI CAYNNNNRTG 1 cut(s) 210
SmlI CTYRAG 2 cut(s) 189, 221
SmoI CTYRAG 2 cut(s) 189, 221
Sse9I AATT 8 cut(s) 101, 122, 155, 176, 298, 400, 567, 630
SspI AATATT 1 cut(s) 452
SspMI CTAG 3 cut(s) 69, 95, 228
StyI CCWWGG 3 cut(s) 68, 588, 641
TaqI TCGA 3 cut(s) 142, 355, 378
TasI AATT 8 cut(s) 101, 122, 155, 176, 298, 400, 567, 630
TfiI GAWTC 2 cut(s) 272, 497
Tru1I TTAA 1 cut(s) 566
Tru9I TTAA 1 cut(s) 566
TspDTI ATGAA 6 cut(s) 359, 387, 411, 489, 504, 639
TspGWI ACGGA 1 cut(s) 684
XapI RAATTY 1 cut(s) 400
XmaJI CCTAGG 1 cut(s) 68
XspI CTAG 3 cut(s) 69, 95, 228
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.