Rmu_sc0029371.1_g000001

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0029371.1
OG0000195
Physical Location & Seq
Reverse (-)
1673 .. 2857
1185 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0029371.1_g000001.1.cds

Sequence Viewer

Length: 1185 bp
atgggcatgtatcaagagacatttatacccaatacatatccacaagaagaagcttatgagcctagtaaggaatttgttgacggactactagctcaattgcacgcctcccaagctctattacaagcctctcaagttagtatttcacaagagaccatggttcccgaagcatatcctcatgagcaagcatatgagtctaggagaccttctcttgaagaattgctagctcaattgcaagcttcccaagcccaattgcaagcctcacaagctcaattgcaagcttctcaagaaatacttatacataccaatgagcaacttgagactagtcttgcacaagagccacccttcaccatttatgagcatgaatctttctttgaccaagtggagcctatttcaagagaagaagtgtatatcgagcatcttgagcaagaatcctttatgcaagttgaaaatgatgatagtgatgttgatgtacaagaaattgaggttggttatgaaagtttcaatgcaagtggggtgagagactacacttcggaggaaccggtgcaatattggaaatctaatcttcacaatgaagaggaggtatatgaagttgattccgaagaagaggatagcttgtctagtgaggaagatgtggagcttgaagacttacaccatgatcccttaatcgttgaggtcgatattcccaaagagaaagagagtcattcaataccttgtgatgatgaagaaattgaagagccaaggactttctctcctcccacatccacggaaatccatcatgagcttcctaaggtggattgtagaatattgagcacttacattcttaatgagaggattgagatcaaggtactttcacctctcaatccaccattaagtggtcaatgtttctacaatgaggtgatggattggaaaggaaatgaagcacttgcactcaccctttcccatcactctcgagagcttcaaccacctattgttcctatgagcatcatttctaatccacttaagagggagaaggcaaggttggctcctagaagaaaaattgagaagagggggaagactaaaaagctacacttttggccaccaattggagtattcttttgtagctcttggtcttgcctctatgatacatcaatgagtcccttagccccaaacaatagggtggtcgtacttgagaagtattcaccttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

394

Amino Acids

45.32

Weight (kDa)

4.48

Isoelectric Point (pI)

68.54

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000195)

Species Orthologous Gene IDs
fragaria_vesca FvH4_6g25780 FvH4_6g25920
rosa_chinensis RchiOBHm_Chr1g0366971 RchiOBHm_Chr1g0372841 RchiOBHm_Chr2g0146841 RchiOBHm_Chr2g0154821 RchiOBHm_Chr2g0159611 RchiOBHm_Chr3g0452071 RchiOBHm_Chr3g0453731 RchiOBHm_Chr3g0457891 RchiOBHm_Chr3g0471041 RchiOBHm_Chr3g0473741 RchiOBHm_Chr4g0427761 RchiOBHm_Chr5g0041301 RchiOBHm_Chr5g0076511 RchiOBHm_Chr6g0281431 RchiOBHm_Chr7g0180511
rosa_multiflora Rmu_sc0000082.1_g000052 Rmu_sc0000125.1_g000058 Rmu_sc0000147.1_g000108 Rmu_sc0000210.1_g000011 Rmu_sc0000229.1_g000006 Rmu_sc0000245.1_g000013 Rmu_sc0000897.1_g000016 Rmu_sc0001059.1_g000005 Rmu_sc0001336.1_g000059 Rmu_sc0001464.1_g000025 Rmu_sc0001630.1_g000013 Rmu_sc0001790.1_g000012 Rmu_sc0001939.1_g000003 Rmu_sc0002132.1_g000013 Rmu_sc0002235.1_g000008 Rmu_sc0002235.1_g000022 Rmu_sc0002548.1_g000030 Rmu_sc0002564.1_g000018 Rmu_sc0002652.1_g000001 Rmu_sc0002759.1_g000007 Rmu_sc0002759.1_g000011 Rmu_sc0002799.1_g000012 Rmu_sc0002858.1_g000033 Rmu_sc0002882.1_g000041 Rmu_sc0003032.1_g000030 Rmu_sc0003033.1_g000041 Rmu_sc0003044.1_g000038 Rmu_sc0003072.1_g000004 Rmu_sc0003264.1_g000025 Rmu_sc0003304.1_g000034 Rmu_sc0003416.1_g000002 Rmu_sc0003613.1_g000010 Rmu_sc0003762.1_g000009 Rmu_sc0003776.1_g000028 Rmu_sc0003859.1_g000025 Rmu_sc0004553.1_g000014 Rmu_sc0004866.1_g000002 Rmu_sc0004941.1_g000047 Rmu_sc0005777.1_g000002 Rmu_sc0005958.1_g000001 Rmu_sc0006573.1_g000001 Rmu_sc0006912.1_g000005 Rmu_sc0006968.1_g000002 Rmu_sc0006986.1_g000020 Rmu_sc0007258.1_g000016 Rmu_sc0007803.1_g000001 Rmu_sc0008479.1_g000003 Rmu_sc0008506.1_g000012 Rmu_sc0009199.1_g000005 Rmu_sc0009431.1_g000008 Rmu_sc0009611.1_g000005 Rmu_sc0014287.1_g000001 Rmu_sc0014768.1_g000001 Rmu_sc0020577.1_g000001 Rmu_sc0028131.1_g000001 Rmu_sc0029371.1_g000001 Rmu_sc0034219.1_g000001 Rmu_ssc0000252.1_g000026 Rmu_ssc0000252.1_g000027 Rmu_ssc0000398.1_g000023 Rmu_ssc0000482.1_g000020
rosa_roxburghii Rroxscaffold_158G00443700 Rroxscaffold_1G00001910 Rroxscaffold_1G00001960 Rroxscaffold_1G00002400 Rroxscaffold_1G00015110 Rroxscaffold_1G00015140 Rroxscaffold_1G00028870 Rroxscaffold_1G00028930 Rroxscaffold_1G00031320 Rroxscaffold_1G00031990 Rroxscaffold_1G00060310 Rroxscaffold_1G00063330 Rroxscaffold_1G00071570 Rroxscaffold_2G00084360 Rroxscaffold_2G00084370 Rroxscaffold_2G00088550 Rroxscaffold_2G00088560 Rroxscaffold_2G00089850 Rroxscaffold_2G00095470 Rroxscaffold_2G00103510 Rroxscaffold_2G00114380 Rroxscaffold_2G00119580 Rroxscaffold_2G00122990 Rroxscaffold_2G00125720 Rroxscaffold_3G00223380 Rroxscaffold_3G00230410 Rroxscaffold_3G00233640 Rroxscaffold_3G00234580 Rroxscaffold_3G00241070 Rroxscaffold_4G00282590 Rroxscaffold_4G00309420 Rroxscaffold_4G00309430 Rroxscaffold_4G00314030 Rroxscaffold_4G00314610 Rroxscaffold_4G00316420 Rroxscaffold_4G00319130 Rroxscaffold_4G00319140 Rroxscaffold_4G00319350 Rroxscaffold_4G00324170 Rroxscaffold_4G00324230 Rroxscaffold_5G00346540 Rroxscaffold_5G00346580 Rroxscaffold_5G00346790 Rroxscaffold_5G00349270 Rroxscaffold_5G00350530 Rroxscaffold_5G00373500 Rroxscaffold_5G00378950 Rroxscaffold_5G00378960 Rroxscaffold_5G00381870 Rroxscaffold_6G00388230 Rroxscaffold_6G00389700 Rroxscaffold_6G00389810 Rroxscaffold_6G00391690 Rroxscaffold_6G00391820 Rroxscaffold_6G00391830 Rroxscaffold_6G00393500 Rroxscaffold_6G00396180 Rroxscaffold_6G00396460 Rroxscaffold_6G00418900 Rroxscaffold_6G00423330 Rroxscaffold_7G00173340 Rroxscaffold_7G00176630 Rroxscaffold_7G00181910 Rroxscaffold_7G00191850 Rroxscaffold_7G00199230 Rroxscaffold_7G00199250 Rroxscaffold_7G00203720 Rroxscaffold_7G00204410 Rroxscaffold_7G00204420 Rroxscaffold_7G00212090 Rroxscaffold_7G00215450
rosa_rugosa Rorug07G0321500
rosa_samantha Rh3BG349100 Rh4AG240700
rosa_wichuraiana Rw0G011180 Rw1G003000 Rw5G028290 Rw6G011280

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 2 cut(s) 872, 1082
AclWI GGATC 1 cut(s) 650
AcoI YGGCCR 1 cut(s) 1073
AcsI RAATTY 1 cut(s) 71
AfaI GTAC 3 cut(s) 471, 846, 1164
AfiI CCNNNNNNNGG 2 cut(s) 872, 1082
AflII CTTAAG 1 cut(s) 998
AgeI ACCGGT 1 cut(s) 538
AgsI TTSAA 8 cut(s) 212, 393, 446, 502, 641, 705, 731, 959
AhlI ACTAGT 1 cut(s) 320
AjuI GAANNNNNNNTTGG 4 cut(s) 468, 500, 1001, 1033
Alw21I GWGCWC 1 cut(s) 812
Alw26I GTCTC 5 cut(s) 11, 143, 193, 311, 513
AlwI GGATC 1 cut(s) 650
Ama87I CYCGRG 1 cut(s) 948
AoxI GGCC 1 cut(s) 1073
ApoI RAATTY 1 cut(s) 71
AsiGI ACCGGT 1 cut(s) 538
AsuHPI GGTGA 6 cut(s) 337, 526, 843, 907, 922, 1170
AsuNHI GCTAGC 1 cut(s) 220
AvaI CYCGRG 1 cut(s) 948
AxyI CCTNAGG 1 cut(s) 786
BalI TGGCCA 1 cut(s) 1075
BbsI GAAGAC 2 cut(s) 648, 1058
Bbv12I GWGCWC 1 cut(s) 812
BccI CCATC 3 cut(s) 780, 892, 948
BcoDI GTCTC 5 cut(s) 11, 143, 193, 311, 513
BcuI ACTAGT 1 cut(s) 320
BfaI CTAG 7 cut(s) 63, 89, 195, 221, 321, 618, 1026
BfrI CTTAAG 1 cut(s) 998
BmeT110I CYCGRG 1 cut(s) 948
BmiI GGNNCC 4 cut(s) 159, 384, 537, 1023
BmsI GCATC 2 cut(s) 424, 990
BmtI GCTAGC 1 cut(s) 224
BpiI GAAGAC 2 cut(s) 648, 1058
BplI GAGNNNNNCTC 2 cut(s) 190, 222
Bpu10I CCTNAGC 1 cut(s) 1138
BpuEI CTTGAG 4 cut(s) 114, 267, 335, 440
BsaBI GATNNNNATC 1 cut(s) 836
BsaI GGTCTC 2 cut(s) 143, 193
BsaJI CCNNGG 3 cut(s) 153, 737, 762
BsaWI WCCGGW 1 cut(s) 538
BsaXI ACNNNNNCTCC 2 cut(s) 733, 763
Bsc4I CCNNNNNNNGG 2 cut(s) 872, 1082
Bse118I RCCGGY 1 cut(s) 538
Bse21I CCTNAGG 1 cut(s) 786
Bse8I GATNNNNATC 1 cut(s) 836
BseDI CCNNGG 3 cut(s) 153, 737, 762
BseGI GGATG 1 cut(s) 758
BseJI GATNNNNATC 1 cut(s) 836
BseLI CCNNNNNNNGG 2 cut(s) 872, 1082
BseRI GAGGAG 2 cut(s) 590, 741
BshFI GGCC 1 cut(s) 1075
BshTI ACCGGT 1 cut(s) 538
BsiHKAI GWGCWC 1 cut(s) 812
BsiHKCI CYCGRG 1 cut(s) 948
BsiSI CCGG 1 cut(s) 539
BslFI GGGAC 1 cut(s) 1119
BslI CCNNNNNNNGG 2 cut(s) 872, 1082
BsmAI GTCTC 5 cut(s) 11, 143, 193, 311, 513
BsmFI GGGAC 1 cut(s) 1119
BsnI GGCC 1 cut(s) 1075
Bso31I GGTCTC 2 cut(s) 143, 193
BsoBI CYCGRG 1 cut(s) 948
Bsp1286I GDGCHC 1 cut(s) 812
Bsp1407I TGTACA 1 cut(s) 469
Bsp143I GATC 2 cut(s) 655, 837
Bsp19I CCATGG 1 cut(s) 153
BspANI GGCC 1 cut(s) 1075
BspHI TCATGA 2 cut(s) 175, 775
BspLI GGNNCC 4 cut(s) 159, 384, 537, 1023
BspOI GCTAGC 1 cut(s) 224
BspPI GGATC 1 cut(s) 650
BspQI GCTCTTC 1 cut(s) 726
BspTI CTTAAG 1 cut(s) 998
BspTNI GGTCTC 2 cut(s) 143, 193
BsrFI RCCGGY 1 cut(s) 538
BsrGI TGTACA 1 cut(s) 469
BssAI RCCGGY 1 cut(s) 538
BssECI CCNNGG 3 cut(s) 153, 737, 762
BssMI GATC 2 cut(s) 655, 837
BssT1I CCWWGG 2 cut(s) 153, 737
Bst6I CTCTTC 4 cut(s) 567, 597, 726, 1037
BstAFI CTTAAG 1 cut(s) 998
BstAUI TGTACA 1 cut(s) 469
BstC8I GCNNGC 6 cut(s) 102, 183, 222, 234, 255, 276
BstDEI CTNAG 2 cut(s) 786, 1138
BstDSI CCRYGG 2 cut(s) 153, 762
BstF5I GGATG 1 cut(s) 758
BstKTI GATC 2 cut(s) 658, 840
BstMAI GTCTC 5 cut(s) 11, 143, 193, 311, 513
BstMBI GATC 2 cut(s) 655, 837
BstMWI GCNNNNNNNGC 5 cut(s) 110, 242, 263, 421, 1019
BstNSI RCATGY 1 cut(s) 10
BstV2I GAAGAC 2 cut(s) 648, 1058
Bsu36I CCTNAGG 1 cut(s) 786
BsuRI GGCC 1 cut(s) 1075
BtgI CCRYGG 2 cut(s) 153, 762
BtsCI GGATG 1 cut(s) 758
Cac8I GCNNGC 6 cut(s) 102, 183, 222, 234, 255, 276
CciI TCATGA 2 cut(s) 175, 775
Cfr10I RCCGGY 1 cut(s) 538
Csp6I GTAC 3 cut(s) 470, 845, 1163
CspAI ACCGGT 1 cut(s) 538
CspCI CAANNNNNGTGG 2 cut(s) 490, 525
CviAII CATG 6 cut(s) 7, 154, 176, 359, 653, 776
CviQI GTAC 3 cut(s) 470, 845, 1163
DdeI CTNAG 2 cut(s) 786, 1138
DpnI GATC 2 cut(s) 657, 839
DpnII GATC 2 cut(s) 655, 837
EaeI YGGCCR 1 cut(s) 1073
Eam1104I CTCTTC 4 cut(s) 567, 597, 726, 1037
EarI CTCTTC 4 cut(s) 567, 597, 726, 1037
Eco130I CCWWGG 2 cut(s) 153, 737
Eco31I GGTCTC 2 cut(s) 143, 193
Eco81I CCTNAGG 1 cut(s) 786
Eco88I CYCGRG 1 cut(s) 948
EcoT14I CCWWGG 2 cut(s) 153, 737
ErhI CCWWGG 2 cut(s) 153, 737
FaeI CATG 6 cut(s) 10, 157, 179, 362, 656, 779
FalI AAGNNNNNCTT 4 cut(s) 276, 308, 1052, 1084
FaqI GGGAC 1 cut(s) 1119
FatI CATG 6 cut(s) 6, 153, 175, 358, 652, 775
FauNDI CATATG 1 cut(s) 187
FokI GGATG 1 cut(s) 745
FspBI CTAG 7 cut(s) 63, 89, 195, 221, 321, 618, 1026
HaeIII GGCC 1 cut(s) 1075
HapII CCGG 1 cut(s) 539
Hin1II CATG 6 cut(s) 10, 157, 179, 362, 656, 779
HincII GTYRAC 1 cut(s) 79
HindII GTYRAC 1 cut(s) 79
HindIII AAGCTT 3 cut(s) 51, 234, 276
HinfI GANTC 6 cut(s) 191, 362, 428, 593, 697, 1132
HpaII CCGG 1 cut(s) 539
HphI GGTGA 6 cut(s) 337, 526, 843, 907, 922, 1170
Hpy166II GTNNAC 1 cut(s) 79
Hpy188I TCNGA 2 cut(s) 532, 598
Hpy8I GTNNAC 1 cut(s) 79
HpyAV CCTTC 3 cut(s) 213, 352, 1003
HpyCH4V TGCA 9 cut(s) 100, 232, 253, 274, 329, 439, 506, 544, 926
HpyF10VI GCNNNNNNNGC 5 cut(s) 110, 242, 263, 421, 1019
HpyF3I CTNAG 2 cut(s) 786, 1138
Hsp92II CATG 6 cut(s) 10, 157, 179, 362, 656, 779
Kzo9I GATC 2 cut(s) 655, 837
LguI GCTCTTC 1 cut(s) 726
LmnI GCTCC 3 cut(s) 382, 634, 1027
LpnPI CCDG 1 cut(s) 552
LweI GCATC 2 cut(s) 424, 990
MaeI CTAG 7 cut(s) 63, 89, 195, 221, 321, 618, 1026
MalI GATC 2 cut(s) 657, 839
MboI GATC 2 cut(s) 655, 837
MfeI CAATTG 5 cut(s) 95, 227, 248, 269, 1080
MhlI GDGCHC 1 cut(s) 812
MlsI TGGCCA 1 cut(s) 1075
MluNI TGGCCA 1 cut(s) 1075
MlyI GAGTC 3 cut(s) 200, 706, 1141
Mox20I TGGCCA 1 cut(s) 1075
MscI TGGCCA 1 cut(s) 1075
MseI TTAA 4 cut(s) 662, 822, 869, 999
MslI CAYNNNNRTG 1 cut(s) 303
Msp20I TGGCCA 1 cut(s) 1075
MspCI CTTAAG 1 cut(s) 998
MspI CCGG 1 cut(s) 539
MunI CAATTG 5 cut(s) 95, 227, 248, 269, 1080
MwoI GCNNNNNNNGC 5 cut(s) 110, 242, 263, 421, 1019
NcoI CCATGG 1 cut(s) 153
NdeI CATATG 1 cut(s) 187
NdeII GATC 2 cut(s) 655, 837
NheI GCTAGC 1 cut(s) 220
NlaIII CATG 6 cut(s) 10, 157, 179, 362, 656, 779
NlaIV GGNNCC 4 cut(s) 159, 384, 537, 1023
NspI RCATGY 1 cut(s) 10
PaeR7I CTCGAG 1 cut(s) 948
PagI TCATGA 2 cut(s) 175, 775
PciSI GCTCTTC 1 cut(s) 726
PcsI WCGNNNNNNNCGW 1 cut(s) 672
PfeI GAWTC 3 cut(s) 362, 428, 593
PflMI CCANNNNNTGG 2 cut(s) 872, 1082
PinAI ACCGGT 1 cut(s) 538
PleI GAGTC 3 cut(s) 199, 705, 1140
PpsI GAGTC 3 cut(s) 199, 705, 1140
PspN4I GGNNCC 4 cut(s) 159, 384, 537, 1023
RsaI GTAC 3 cut(s) 471, 846, 1164
RsaNI GTAC 3 cut(s) 470, 845, 1163
RseI CAYNNNNRTG 1 cut(s) 303
SapI GCTCTTC 1 cut(s) 726
SaqAI TTAA 4 cut(s) 662, 822, 869, 999
Sau3AI GATC 2 cut(s) 655, 837
SchI GAGTC 3 cut(s) 200, 706, 1141
SduI GDGCHC 1 cut(s) 812
SfaNI GCATC 2 cut(s) 424, 990
Sfr274I CTCGAG 1 cut(s) 948
SlaI CTCGAG 1 cut(s) 948
SmiMI CAYNNNNRTG 1 cut(s) 303
SmlI CTYRAG 7 cut(s) 129, 282, 314, 419, 948, 998, 1166
SmoI CTYRAG 7 cut(s) 129, 282, 314, 419, 948, 998, 1166
SpeI ACTAGT 1 cut(s) 320
SspI AATATT 2 cut(s) 548, 804
SspMI CTAG 7 cut(s) 63, 89, 195, 221, 321, 618, 1026
StyI CCWWGG 2 cut(s) 153, 737
TaqI TCGA 3 cut(s) 411, 675, 949
TatI WGTACW 1 cut(s) 469
TfiI GAWTC 3 cut(s) 362, 428, 593
Tru1I TTAA 4 cut(s) 662, 822, 869, 999
Tru9I TTAA 4 cut(s) 662, 822, 869, 999
TspDTI ATGAA 6 cut(s) 375, 507, 585, 600, 735, 930
TspGWI ACGGA 2 cut(s) 96, 779
Van91I CCANNNNNTGG 2 cut(s) 872, 1082
Vha464I CTTAAG 1 cut(s) 998
XapI RAATTY 1 cut(s) 71
XceI RCATGY 1 cut(s) 10
XhoI CTCGAG 1 cut(s) 948
XspI CTAG 7 cut(s) 63, 89, 195, 221, 321, 618, 1026
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.