Rmu_sc0001059.1_g000005

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001059.1
OG0000195
Physical Location & Seq
Forward (+)
13894 .. 15108
1215 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001059.1_g000005.1.cds

Sequence Viewer

Length: 1215 bp
atgtatcaagagacatttgtacctgatgcatatccacaaaatgaagcttatgagcctaggaaggaattcgttgaaggactactagctcaattgcaagcctctcaacaagcctctcaagttagtatttcacaagagaccatagctcccgaagcatatcctcatgagcaagcatatgagtctaggaggccttctcttgaagaattgctagctcaattgcaagcttcccaagcccacttgcaagcctcacaagctcaattgcaagcttctcaagaaatgattgcacattccaacgagcaacttaaggctagtcttgcacaagagccacccttcaccatttatgagcatgaatctttgtttgaccaagtggagcctaattcaagagaagaagtatattatgagcatcatgaacaagagttgcctattcaagatagagatggtgatgttcatgaacaagaaagtgagcttggttatgaaagtttcaatgcaagtggggtgagagactacacttcggcggaatgggtacaatattggaaatctaagcttctaaatgaaggtgagatatttgaagatgattctgaagaagatgatgtcttgtctagtgaggaggatgaggagtttgaagttatacaccataatcccttgttcattgaggaggatgcggagcttcaagccatatatcataatcccttattcattgaggttgatatttccatggaggaagaaagtccttcaatactttgtgatgatgaagaaattgaagagttaaggactttctctcctcctacatccaagaagatccatcatgagcttctcaaggtggagagtaggacattgagcacttacattcttaatgagaggattgggatcaaggtacttttacctcccaatccaccattaagtggtcaatgtttctacaatgaggtgatggattggaaaggaaatggagcacttgcactcaccctttcccatcactctcaagagcttctaccacctattgttcctatgagtatcatttctaatccacttgagaaggagaaggcaaggatattggctcctagaagaaaaattgagaagaagaggaaaattaagaagctacacttttgcttgccatttggaatattcataagtagttcttggtcttgcctctatgatacatcaaggagtcctttagccccaaacaatagggtggtcgtacttgagaagtatccaccttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

404

Amino Acids

46.48

Weight (kDa)

4.62

Isoelectric Point (pI)

67.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000195)

Species Orthologous Gene IDs
fragaria_vesca FvH4_6g25780 FvH4_6g25920
rosa_chinensis RchiOBHm_Chr1g0366971 RchiOBHm_Chr1g0372841 RchiOBHm_Chr2g0146841 RchiOBHm_Chr2g0154821 RchiOBHm_Chr2g0159611 RchiOBHm_Chr3g0452071 RchiOBHm_Chr3g0453731 RchiOBHm_Chr3g0457891 RchiOBHm_Chr3g0471041 RchiOBHm_Chr3g0473741 RchiOBHm_Chr4g0427761 RchiOBHm_Chr5g0041301 RchiOBHm_Chr5g0076511 RchiOBHm_Chr6g0281431 RchiOBHm_Chr7g0180511
rosa_multiflora Rmu_sc0000082.1_g000052 Rmu_sc0000125.1_g000058 Rmu_sc0000147.1_g000108 Rmu_sc0000210.1_g000011 Rmu_sc0000229.1_g000006 Rmu_sc0000245.1_g000013 Rmu_sc0000897.1_g000016 Rmu_sc0001059.1_g000005 Rmu_sc0001336.1_g000059 Rmu_sc0001464.1_g000025 Rmu_sc0001630.1_g000013 Rmu_sc0001790.1_g000012 Rmu_sc0001939.1_g000003 Rmu_sc0002132.1_g000013 Rmu_sc0002235.1_g000008 Rmu_sc0002235.1_g000022 Rmu_sc0002548.1_g000030 Rmu_sc0002564.1_g000018 Rmu_sc0002652.1_g000001 Rmu_sc0002759.1_g000007 Rmu_sc0002759.1_g000011 Rmu_sc0002799.1_g000012 Rmu_sc0002858.1_g000033 Rmu_sc0002882.1_g000041 Rmu_sc0003032.1_g000030 Rmu_sc0003033.1_g000041 Rmu_sc0003044.1_g000038 Rmu_sc0003072.1_g000004 Rmu_sc0003264.1_g000025 Rmu_sc0003304.1_g000034 Rmu_sc0003416.1_g000002 Rmu_sc0003613.1_g000010 Rmu_sc0003762.1_g000009 Rmu_sc0003776.1_g000028 Rmu_sc0003859.1_g000025 Rmu_sc0004553.1_g000014 Rmu_sc0004866.1_g000002 Rmu_sc0004941.1_g000047 Rmu_sc0005777.1_g000002 Rmu_sc0005958.1_g000001 Rmu_sc0006573.1_g000001 Rmu_sc0006912.1_g000005 Rmu_sc0006968.1_g000002 Rmu_sc0006986.1_g000020 Rmu_sc0007258.1_g000016 Rmu_sc0007803.1_g000001 Rmu_sc0008479.1_g000003 Rmu_sc0008506.1_g000012 Rmu_sc0009199.1_g000005 Rmu_sc0009431.1_g000008 Rmu_sc0009611.1_g000005 Rmu_sc0014287.1_g000001 Rmu_sc0014768.1_g000001 Rmu_sc0020577.1_g000001 Rmu_sc0028131.1_g000001 Rmu_sc0029371.1_g000001 Rmu_sc0034219.1_g000001 Rmu_ssc0000252.1_g000026 Rmu_ssc0000252.1_g000027 Rmu_ssc0000398.1_g000023 Rmu_ssc0000482.1_g000020
rosa_roxburghii Rroxscaffold_158G00443700 Rroxscaffold_1G00001910 Rroxscaffold_1G00001960 Rroxscaffold_1G00002400 Rroxscaffold_1G00015110 Rroxscaffold_1G00015140 Rroxscaffold_1G00028870 Rroxscaffold_1G00028930 Rroxscaffold_1G00031320 Rroxscaffold_1G00031990 Rroxscaffold_1G00060310 Rroxscaffold_1G00063330 Rroxscaffold_1G00071570 Rroxscaffold_2G00084360 Rroxscaffold_2G00084370 Rroxscaffold_2G00088550 Rroxscaffold_2G00088560 Rroxscaffold_2G00089850 Rroxscaffold_2G00095470 Rroxscaffold_2G00103510 Rroxscaffold_2G00114380 Rroxscaffold_2G00119580 Rroxscaffold_2G00122990 Rroxscaffold_2G00125720 Rroxscaffold_3G00223380 Rroxscaffold_3G00230410 Rroxscaffold_3G00233640 Rroxscaffold_3G00234580 Rroxscaffold_3G00241070 Rroxscaffold_4G00282590 Rroxscaffold_4G00309420 Rroxscaffold_4G00309430 Rroxscaffold_4G00314030 Rroxscaffold_4G00314610 Rroxscaffold_4G00316420 Rroxscaffold_4G00319130 Rroxscaffold_4G00319140 Rroxscaffold_4G00319350 Rroxscaffold_4G00324170 Rroxscaffold_4G00324230 Rroxscaffold_5G00346540 Rroxscaffold_5G00346580 Rroxscaffold_5G00346790 Rroxscaffold_5G00349270 Rroxscaffold_5G00350530 Rroxscaffold_5G00373500 Rroxscaffold_5G00378950 Rroxscaffold_5G00378960 Rroxscaffold_5G00381870 Rroxscaffold_6G00388230 Rroxscaffold_6G00389700 Rroxscaffold_6G00389810 Rroxscaffold_6G00391690 Rroxscaffold_6G00391820 Rroxscaffold_6G00391830 Rroxscaffold_6G00393500 Rroxscaffold_6G00396180 Rroxscaffold_6G00396460 Rroxscaffold_6G00418900 Rroxscaffold_6G00423330 Rroxscaffold_7G00173340 Rroxscaffold_7G00176630 Rroxscaffold_7G00181910 Rroxscaffold_7G00191850 Rroxscaffold_7G00199230 Rroxscaffold_7G00199250 Rroxscaffold_7G00203720 Rroxscaffold_7G00204410 Rroxscaffold_7G00204420 Rroxscaffold_7G00212090 Rroxscaffold_7G00215450
rosa_rugosa Rorug07G0321500
rosa_samantha Rh3BG349100 Rh4AG240700
rosa_wichuraiana Rw0G011180 Rw1G003000 Rw5G028290 Rw6G011280

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 899
AciI CCGC 2 cut(s) 512, 659
AclWI GGATC 2 cut(s) 790, 872
AcsI RAATTY 1 cut(s) 65
AcuI CTGAAG 1 cut(s) 597
AfaI GTAC 4 cut(s) 21, 522, 873, 1194
AfiI CCNNNNNNNGG 1 cut(s) 899
AflII CTTAAG 1 cut(s) 299
AjuI GAANNNNNNNTTGG 2 cut(s) 447, 479
Alw21I GWGCWC 2 cut(s) 839, 949
Alw26I GTCTC 3 cut(s) 5, 128, 492
AlwI GGATC 2 cut(s) 790, 872
AoxI GGCC 1 cut(s) 185
ApoI RAATTY 1 cut(s) 65
Asp700I GAANNNNTTC 1 cut(s) 65
AspA2I CCTAGG 1 cut(s) 56
AsuHPI GGTGA 6 cut(s) 322, 449, 505, 566, 934, 949
AsuNHI GCTAGC 1 cut(s) 205
AvrII CCTAGG 1 cut(s) 56
BaeI ACNNNNGTAYC 1 cut(s) 36
Bbv12I GWGCWC 2 cut(s) 839, 949
BccI CCATC 4 cut(s) 428, 807, 919, 975
BciVI GTATCC 1 cut(s) 1215
BcoDI GTCTC 3 cut(s) 5, 128, 492
BfaI CTAG 7 cut(s) 57, 83, 180, 206, 306, 597, 1056
BfrI CTTAAG 1 cut(s) 299
BfuI GTATCC 1 cut(s) 1215
BlnI CCTAGG 1 cut(s) 56
BmiI GGNNCC 2 cut(s) 369, 1053
BmsI GCATC 3 cut(s) 16, 409, 646
BmtI GCTAGC 1 cut(s) 209
BplI GAGNNNNNCTC 2 cut(s) 175, 207
BpuEI CTTGAG 5 cut(s) 99, 252, 797, 960, 1046
BsaBI GATNNNNATC 2 cut(s) 30, 863
BsaI GGTCTC 1 cut(s) 128
BsaJI CCNNGG 2 cut(s) 56, 711
BsaXI ACNNNNNCTCC 4 cut(s) 127, 157, 760, 790
Bsc4I CCNNNNNNNGG 1 cut(s) 899
Bse8I GATNNNNATC 2 cut(s) 30, 863
BseDI CCNNGG 2 cut(s) 56, 711
BseGI GGATG 3 cut(s) 613, 661, 785
BseJI GATNNNNATC 2 cut(s) 30, 863
BseLI CCNNNNNNNGG 1 cut(s) 899
BseRI GAGGAG 4 cut(s) 617, 626, 665, 768
BshFI GGCC 1 cut(s) 187
BsiHKAI GWGCWC 2 cut(s) 839, 949
BslI CCNNNNNNNGG 1 cut(s) 899
BsmAI GTCTC 3 cut(s) 5, 128, 492
BsnI GGCC 1 cut(s) 187
Bso31I GGTCTC 1 cut(s) 128
Bsp1286I GDGCHC 2 cut(s) 839, 949
Bsp143I GATC 2 cut(s) 795, 864
Bsp19I CCATGG 1 cut(s) 711
BspACI CCGC 2 cut(s) 512, 659
BspANI GGCC 1 cut(s) 187
BspHI TCATGA 4 cut(s) 160, 403, 445, 802
BspLI GGNNCC 2 cut(s) 369, 1053
BspOI GCTAGC 1 cut(s) 209
BspPI GGATC 2 cut(s) 790, 872
BspTI CTTAAG 1 cut(s) 299
BspTNI GGTCTC 1 cut(s) 128
BssECI CCNNGG 2 cut(s) 56, 711
BssMI GATC 2 cut(s) 795, 864
BssT1I CCWWGG 2 cut(s) 56, 711
Bst6I CTCTTC 2 cut(s) 753, 1070
BstAFI CTTAAG 1 cut(s) 299
BstC8I GCNNGC 7 cut(s) 96, 168, 207, 219, 240, 261, 1106
BstDEI CTNAG 1 cut(s) 537
BstDSI CCRYGG 1 cut(s) 711
BstF5I GGATG 3 cut(s) 613, 661, 785
BstKTI GATC 2 cut(s) 798, 867
BstMAI GTCTC 3 cut(s) 5, 128, 492
BstMBI GATC 2 cut(s) 795, 864
BstMWI GCNNNNNNNGC 4 cut(s) 149, 227, 248, 311
BstX2I RGATCY 1 cut(s) 795
BstYI RGATCY 1 cut(s) 795
BsuI GTATCC 1 cut(s) 1215
BsuRI GGCC 1 cut(s) 187
BtgI CCRYGG 1 cut(s) 711
BtsCI GGATG 3 cut(s) 613, 661, 785
Cac8I GCNNGC 7 cut(s) 96, 168, 207, 219, 240, 261, 1106
CciI TCATGA 4 cut(s) 160, 403, 445, 802
Csp6I GTAC 4 cut(s) 20, 521, 872, 1193
CspCI CAANNNNNGTGG 2 cut(s) 469, 504
CviAII CATG 6 cut(s) 161, 344, 404, 446, 712, 803
CviQI GTAC 4 cut(s) 20, 521, 872, 1193
DdeI CTNAG 1 cut(s) 537
DpnI GATC 2 cut(s) 797, 866
DpnII GATC 2 cut(s) 795, 864
Eam1104I CTCTTC 2 cut(s) 753, 1070
EarI CTCTTC 2 cut(s) 753, 1070
EciI GGCGGA 1 cut(s) 527
Eco130I CCWWGG 2 cut(s) 56, 711
Eco147I AGGCCT 1 cut(s) 187
Eco31I GGTCTC 1 cut(s) 128
Eco57I CTGAAG 1 cut(s) 597
EcoRI GAATTC 1 cut(s) 65
EcoT14I CCWWGG 2 cut(s) 56, 711
EcoT22I ATGCAT 1 cut(s) 31
ErhI CCWWGG 2 cut(s) 56, 711
FaeI CATG 6 cut(s) 164, 347, 407, 449, 715, 806
FalI AAGNNNNNCTT 6 cut(s) 1082, 1114, 1117, 1149, 1150, 1182
FatI CATG 6 cut(s) 160, 343, 403, 445, 711, 802
FauNDI CATATG 1 cut(s) 172
FokI GGATG 3 cut(s) 620, 668, 772
FspBI CTAG 7 cut(s) 57, 83, 180, 206, 306, 597, 1056
HaeIII GGCC 1 cut(s) 187
Hin1II CATG 6 cut(s) 164, 347, 407, 449, 715, 806
HindIII AAGCTT 4 cut(s) 45, 219, 261, 539
HinfI GANTC 4 cut(s) 176, 347, 572, 1162
HphI GGTGA 6 cut(s) 322, 449, 505, 566, 934, 949
Hpy188I TCNGA 1 cut(s) 577
HpyAV CCTTC 8 cut(s) 55, 68, 198, 337, 545, 738, 1024, 1030
HpyCH4V TGCA 9 cut(s) 29, 94, 217, 238, 259, 281, 314, 485, 953
HpyF10VI GCNNNNNNNGC 4 cut(s) 149, 227, 248, 311
HpyF3I CTNAG 1 cut(s) 537
Hsp92II CATG 6 cut(s) 164, 347, 407, 449, 715, 806
Kzo9I GATC 2 cut(s) 795, 864
LmnI GCTCC 5 cut(s) 148, 367, 661, 944, 1057
LpnPI CCDG 1 cut(s) 36
LweI GCATC 3 cut(s) 16, 409, 646
MaeI CTAG 7 cut(s) 57, 83, 180, 206, 306, 597, 1056
MalI GATC 2 cut(s) 797, 866
MboI GATC 2 cut(s) 795, 864
MfeI CAATTG 3 cut(s) 89, 212, 254
MflI RGATCY 1 cut(s) 795
MhlI GDGCHC 2 cut(s) 839, 949
MluCI AATT 9 cut(s) 65, 89, 200, 212, 254, 373, 753, 1065, 1083
MlyI GAGTC 2 cut(s) 185, 1171
MmeI TCCRAC 1 cut(s) 312
Mph1103I ATGCAT 1 cut(s) 31
MroXI GAANNNNTTC 1 cut(s) 65
MseI TTAA 5 cut(s) 300, 764, 849, 896, 1086
MspCI CTTAAG 1 cut(s) 299
MunI CAATTG 3 cut(s) 89, 212, 254
MwoI GCNNNNNNNGC 4 cut(s) 149, 227, 248, 311
NcoI CCATGG 1 cut(s) 711
NdeI CATATG 1 cut(s) 172
NdeII GATC 2 cut(s) 795, 864
NheI GCTAGC 1 cut(s) 205
NlaIII CATG 6 cut(s) 164, 347, 407, 449, 715, 806
NlaIV GGNNCC 2 cut(s) 369, 1053
NsiI ATGCAT 1 cut(s) 31
PagI TCATGA 4 cut(s) 160, 403, 445, 802
PceI AGGCCT 1 cut(s) 187
PdmI GAANNNNTTC 1 cut(s) 65
PfeI GAWTC 2 cut(s) 347, 572
PflMI CCANNNNNTGG 1 cut(s) 899
PleI GAGTC 2 cut(s) 184, 1170
PpsI GAGTC 2 cut(s) 184, 1170
PspN4I GGNNCC 2 cut(s) 369, 1053
PsuI RGATCY 1 cut(s) 795
RsaI GTAC 4 cut(s) 21, 522, 873, 1194
RsaNI GTAC 4 cut(s) 20, 521, 872, 1193
SaqAI TTAA 5 cut(s) 300, 764, 849, 896, 1086
Sau3AI GATC 2 cut(s) 795, 864
SchI GAGTC 2 cut(s) 185, 1171
SduI GDGCHC 2 cut(s) 839, 949
SfaNI GCATC 3 cut(s) 16, 409, 646
SmlI CTYRAG 7 cut(s) 114, 267, 299, 812, 975, 1025, 1196
SmoI CTYRAG 7 cut(s) 114, 267, 299, 812, 975, 1025, 1196
Sse9I AATT 9 cut(s) 65, 89, 200, 212, 254, 373, 753, 1065, 1083
SseBI AGGCCT 1 cut(s) 187
SsiI CCGC 2 cut(s) 512, 659
SspI AATATT 2 cut(s) 527, 1119
SspMI CTAG 7 cut(s) 57, 83, 180, 206, 306, 597, 1056
StuI AGGCCT 1 cut(s) 187
StyI CCWWGG 2 cut(s) 56, 711
TasI AATT 9 cut(s) 65, 89, 200, 212, 254, 373, 753, 1065, 1083
TfiI GAWTC 2 cut(s) 347, 572
Tru1I TTAA 5 cut(s) 300, 764, 849, 896, 1086
Tru9I TTAA 5 cut(s) 300, 764, 849, 896, 1086
Van91I CCANNNNNTGG 1 cut(s) 899
Vha464I CTTAAG 1 cut(s) 299
XapI RAATTY 1 cut(s) 65
XmaJI CCTAGG 1 cut(s) 56
XmnI GAANNNNTTC 1 cut(s) 65
XspI CTAG 7 cut(s) 57, 83, 180, 206, 306, 597, 1056
Zsp2I ATGCAT 1 cut(s) 31
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.