Rmu_sc0001790.1_g000012

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001790.1
OG0000195
Physical Location & Seq
Forward (+)
61087 .. 62105
1019 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001790.1_g000012.1.cds

Sequence Viewer

Length: 939 bp
atgggcatgcctcaagagacatttgtacccgatgcatatccacaagatgaagcttatgagcctaggaaggaatttgttgaaggacaactagctcaattgcaagcttcccaagctctattacaagcttctcaagctagaatttcacaagagaacttggttcccgaagcatatcctcatgagcaagtgtatgagtctaggatgccttatcttgaagaattgctagctcaattgcaagcttcccaagctcaattgcaagcttctcaagaaatgcttacatattccaatgagcaacttcaggctagtcttgcacaagagctaccattcaccatttatgagcatgaatctttctttgaccaagtgaagcctatttcaagagaagaagtgtatatcgagcatcttaagcaagagtcttttatgcaagttgaaaatgatgatagtgatgttgatgtacaagaaattgagcttggttatgaaagtttcaatgcaaatgattccgaagaagatgatggcttatctagtaaggaggatgcggagtttgaagtcatacaccataatccctcgttcattgaggaggatgcggagcttcaagttatataccataatcccttattaattgaggctaatattcccatggaggaagatagtccttcaatactttgtgatgatgaagaaattgaagagccaaggattttctctcctcgtacatctaaagagatccatcatgagcttcctaaggtggagagtaggacattgagcacttatgttcttaatggaaagattgagattaaggcatttttatctctcaatccaccattaagtggtcaatgtttctacagtgaggtgatggattggaaaggaaaacttacactcaaccttttcagtcactctcaagagcttctaccacctattgttcctatgagcatcattaacaccacttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

312

Amino Acids

35.78

Weight (kDa)

4.21

Isoelectric Point (pI)

71.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000195)

Species Orthologous Gene IDs
fragaria_vesca FvH4_6g25780 FvH4_6g25920
rosa_chinensis RchiOBHm_Chr1g0366971 RchiOBHm_Chr1g0372841 RchiOBHm_Chr2g0146841 RchiOBHm_Chr2g0154821 RchiOBHm_Chr2g0159611 RchiOBHm_Chr3g0452071 RchiOBHm_Chr3g0453731 RchiOBHm_Chr3g0457891 RchiOBHm_Chr3g0471041 RchiOBHm_Chr3g0473741 RchiOBHm_Chr4g0427761 RchiOBHm_Chr5g0041301 RchiOBHm_Chr5g0076511 RchiOBHm_Chr6g0281431 RchiOBHm_Chr7g0180511
rosa_multiflora Rmu_sc0000082.1_g000052 Rmu_sc0000125.1_g000058 Rmu_sc0000147.1_g000108 Rmu_sc0000210.1_g000011 Rmu_sc0000229.1_g000006 Rmu_sc0000245.1_g000013 Rmu_sc0000897.1_g000016 Rmu_sc0001059.1_g000005 Rmu_sc0001336.1_g000059 Rmu_sc0001464.1_g000025 Rmu_sc0001630.1_g000013 Rmu_sc0001790.1_g000012 Rmu_sc0001939.1_g000003 Rmu_sc0002132.1_g000013 Rmu_sc0002235.1_g000008 Rmu_sc0002235.1_g000022 Rmu_sc0002548.1_g000030 Rmu_sc0002564.1_g000018 Rmu_sc0002652.1_g000001 Rmu_sc0002759.1_g000007 Rmu_sc0002759.1_g000011 Rmu_sc0002799.1_g000012 Rmu_sc0002858.1_g000033 Rmu_sc0002882.1_g000041 Rmu_sc0003032.1_g000030 Rmu_sc0003033.1_g000041 Rmu_sc0003044.1_g000038 Rmu_sc0003072.1_g000004 Rmu_sc0003264.1_g000025 Rmu_sc0003304.1_g000034 Rmu_sc0003416.1_g000002 Rmu_sc0003613.1_g000010 Rmu_sc0003762.1_g000009 Rmu_sc0003776.1_g000028 Rmu_sc0003859.1_g000025 Rmu_sc0004553.1_g000014 Rmu_sc0004866.1_g000002 Rmu_sc0004941.1_g000047 Rmu_sc0005777.1_g000002 Rmu_sc0005958.1_g000001 Rmu_sc0006573.1_g000001 Rmu_sc0006912.1_g000005 Rmu_sc0006968.1_g000002 Rmu_sc0006986.1_g000020 Rmu_sc0007258.1_g000016 Rmu_sc0007803.1_g000001 Rmu_sc0008479.1_g000003 Rmu_sc0008506.1_g000012 Rmu_sc0009199.1_g000005 Rmu_sc0009431.1_g000008 Rmu_sc0009611.1_g000005 Rmu_sc0014287.1_g000001 Rmu_sc0014768.1_g000001 Rmu_sc0020577.1_g000001 Rmu_sc0028131.1_g000001 Rmu_sc0029371.1_g000001 Rmu_sc0034219.1_g000001 Rmu_ssc0000252.1_g000026 Rmu_ssc0000252.1_g000027 Rmu_ssc0000398.1_g000023 Rmu_ssc0000482.1_g000020
rosa_roxburghii Rroxscaffold_158G00443700 Rroxscaffold_1G00001910 Rroxscaffold_1G00001960 Rroxscaffold_1G00002400 Rroxscaffold_1G00015110 Rroxscaffold_1G00015140 Rroxscaffold_1G00028870 Rroxscaffold_1G00028930 Rroxscaffold_1G00031320 Rroxscaffold_1G00031990 Rroxscaffold_1G00060310 Rroxscaffold_1G00063330 Rroxscaffold_1G00071570 Rroxscaffold_2G00084360 Rroxscaffold_2G00084370 Rroxscaffold_2G00088550 Rroxscaffold_2G00088560 Rroxscaffold_2G00089850 Rroxscaffold_2G00095470 Rroxscaffold_2G00103510 Rroxscaffold_2G00114380 Rroxscaffold_2G00119580 Rroxscaffold_2G00122990 Rroxscaffold_2G00125720 Rroxscaffold_3G00223380 Rroxscaffold_3G00230410 Rroxscaffold_3G00233640 Rroxscaffold_3G00234580 Rroxscaffold_3G00241070 Rroxscaffold_4G00282590 Rroxscaffold_4G00309420 Rroxscaffold_4G00309430 Rroxscaffold_4G00314030 Rroxscaffold_4G00314610 Rroxscaffold_4G00316420 Rroxscaffold_4G00319130 Rroxscaffold_4G00319140 Rroxscaffold_4G00319350 Rroxscaffold_4G00324170 Rroxscaffold_4G00324230 Rroxscaffold_5G00346540 Rroxscaffold_5G00346580 Rroxscaffold_5G00346790 Rroxscaffold_5G00349270 Rroxscaffold_5G00350530 Rroxscaffold_5G00373500 Rroxscaffold_5G00378950 Rroxscaffold_5G00378960 Rroxscaffold_5G00381870 Rroxscaffold_6G00388230 Rroxscaffold_6G00389700 Rroxscaffold_6G00389810 Rroxscaffold_6G00391690 Rroxscaffold_6G00391820 Rroxscaffold_6G00391830 Rroxscaffold_6G00393500 Rroxscaffold_6G00396180 Rroxscaffold_6G00396460 Rroxscaffold_6G00418900 Rroxscaffold_6G00423330 Rroxscaffold_7G00173340 Rroxscaffold_7G00176630 Rroxscaffold_7G00181910 Rroxscaffold_7G00191850 Rroxscaffold_7G00199230 Rroxscaffold_7G00199250 Rroxscaffold_7G00203720 Rroxscaffold_7G00204410 Rroxscaffold_7G00204420 Rroxscaffold_7G00212090 Rroxscaffold_7G00215450
rosa_rugosa Rorug07G0321500
rosa_samantha Rh3BG349100 Rh4AG240700
rosa_wichuraiana Rw0G011180 Rw1G003000 Rw5G028290 Rw6G011280

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 818
AciI CCGC 2 cut(s) 530, 578
AclWI GGATC 1 cut(s) 709
AcsI RAATTY 2 cut(s) 71, 138
AcuI CTGAAG 1 cut(s) 278
AfaI GTAC 3 cut(s) 27, 450, 703
AfiI CCNNNNNNNGG 1 cut(s) 818
AflII CTTAAG 1 cut(s) 398
AgsI TTSAA 9 cut(s) 80, 212, 372, 425, 481, 539, 587, 651, 677
AjuI GAANNNNNNNTTGG 2 cut(s) 447, 479
Alw21I GWGCWC 1 cut(s) 758
Alw26I GTCTC 1 cut(s) 11
AlwI GGATC 1 cut(s) 709
ApoI RAATTY 2 cut(s) 71, 138
AseI ATTAAT 1 cut(s) 611
AspA2I CCTAGG 1 cut(s) 62
AsuHPI GGTGA 2 cut(s) 316, 853
AsuNHI GCTAGC 1 cut(s) 220
AvrII CCTAGG 1 cut(s) 62
AxyI CCTNAGG 1 cut(s) 732
BaeI ACNNNNGTAYC 2 cut(s) 9, 42
Bbv12I GWGCWC 1 cut(s) 758
BccI CCATC 3 cut(s) 500, 726, 838
BcoDI GTCTC 1 cut(s) 11
BfaI CTAG 7 cut(s) 63, 89, 135, 195, 221, 300, 516
BfmI CTRYAG 1 cut(s) 832
BfrI CTTAAG 1 cut(s) 398
BlnI CCTAGG 1 cut(s) 62
BmiI GGNNCC 1 cut(s) 159
BmsI GCATC 6 cut(s) 22, 189, 403, 517, 565, 930
BmtI GCTAGC 1 cut(s) 224
BpuEI CTTGAG 3 cut(s) 114, 246, 873
BsaBI GATNNNNATC 1 cut(s) 36
BsaJI CCNNGG 3 cut(s) 62, 630, 683
Bsc4I CCNNNNNNNGG 1 cut(s) 818
Bse21I CCTNAGG 1 cut(s) 732
Bse8I GATNNNNATC 1 cut(s) 36
BseDI CCNNGG 3 cut(s) 62, 630, 683
BseGI GGATG 3 cut(s) 204, 532, 580
BseJI GATNNNNATC 1 cut(s) 36
BseLI CCNNNNNNNGG 1 cut(s) 818
BseRI GAGGAG 2 cut(s) 584, 687
BsiHKAI GWGCWC 1 cut(s) 758
BslI CCNNNNNNNGG 1 cut(s) 818
BsmAI GTCTC 1 cut(s) 11
Bsp1286I GDGCHC 1 cut(s) 758
Bsp1407I TGTACA 1 cut(s) 448
Bsp143I GATC 1 cut(s) 714
Bsp19I CCATGG 1 cut(s) 630
BspACI CCGC 2 cut(s) 530, 578
BspHI TCATGA 2 cut(s) 175, 721
BspLI GGNNCC 1 cut(s) 159
BspOI GCTAGC 1 cut(s) 224
BspPI GGATC 1 cut(s) 709
BspQI GCTCTTC 1 cut(s) 672
BspTI CTTAAG 1 cut(s) 398
BsrGI TGTACA 1 cut(s) 448
BssECI CCNNGG 3 cut(s) 62, 630, 683
BssMI GATC 1 cut(s) 714
BssT1I CCWWGG 3 cut(s) 62, 630, 683
Bst4CI ACNGT 1 cut(s) 836
Bst6I CTCTTC 1 cut(s) 672
BstAFI CTTAAG 1 cut(s) 398
BstAUI TGTACA 1 cut(s) 448
BstC8I GCNNGC 5 cut(s) 8, 102, 222, 234, 255
BstDEI CTNAG 1 cut(s) 732
BstDSI CCRYGG 1 cut(s) 630
BstF5I GGATG 3 cut(s) 204, 532, 580
BstKTI GATC 1 cut(s) 717
BstMAI GTCTC 1 cut(s) 11
BstMBI GATC 1 cut(s) 714
BstMWI GCNNNNNNNGC 5 cut(s) 110, 131, 242, 305, 400
BstNSI RCATGY 1 cut(s) 10
BstSFI CTRYAG 1 cut(s) 832
BstX2I RGATCY 1 cut(s) 714
BstYI RGATCY 1 cut(s) 714
Bsu36I CCTNAGG 1 cut(s) 732
BtgI CCRYGG 1 cut(s) 630
BtsCI GGATG 3 cut(s) 204, 532, 580
BtsIMutI CAGTG 1 cut(s) 841
Cac8I GCNNGC 5 cut(s) 8, 102, 222, 234, 255
CciI TCATGA 2 cut(s) 175, 721
Csp6I GTAC 3 cut(s) 26, 449, 702
CviAII CATG 5 cut(s) 7, 176, 338, 631, 722
CviQI GTAC 3 cut(s) 26, 449, 702
DdeI CTNAG 1 cut(s) 732
DpnI GATC 1 cut(s) 716
DpnII GATC 1 cut(s) 714
Eam1104I CTCTTC 1 cut(s) 672
EarI CTCTTC 1 cut(s) 672
Eco130I CCWWGG 3 cut(s) 62, 630, 683
Eco57I CTGAAG 1 cut(s) 278
Eco81I CCTNAGG 1 cut(s) 732
EcoT14I CCWWGG 3 cut(s) 62, 630, 683
EcoT22I ATGCAT 1 cut(s) 37
ErhI CCWWGG 3 cut(s) 62, 630, 683
FaeI CATG 5 cut(s) 10, 179, 341, 634, 725
FalI AAGNNNNNCTT 4 cut(s) 255, 287, 846, 878
FatI CATG 5 cut(s) 6, 175, 337, 630, 721
FokI GGATG 3 cut(s) 211, 539, 587
FspBI CTAG 7 cut(s) 63, 89, 135, 195, 221, 300, 516
Hin1II CATG 5 cut(s) 10, 179, 341, 634, 725
HindIII AAGCTT 5 cut(s) 51, 102, 123, 234, 255
HinfI GANTC 4 cut(s) 191, 341, 407, 491
HphI GGTGA 2 cut(s) 316, 853
Hpy188I TCNGA 1 cut(s) 496
Hpy188III TCNNGA 8 cut(s) 14, 161, 176, 209, 263, 372, 722, 890
HpyAV CCTTC 3 cut(s) 61, 74, 657
HpyCH4III ACNGT 1 cut(s) 836
HpyCH4V TGCA 7 cut(s) 35, 100, 232, 253, 308, 418, 485
HpyF10VI GCNNNNNNNGC 5 cut(s) 110, 131, 242, 305, 400
HpyF3I CTNAG 1 cut(s) 732
Hsp92II CATG 5 cut(s) 10, 179, 341, 634, 725
Kzo9I GATC 1 cut(s) 714
LguI GCTCTTC 1 cut(s) 672
LmnI GCTCC 1 cut(s) 580
LpnPI CCDG 1 cut(s) 281
LweI GCATC 6 cut(s) 22, 189, 403, 517, 565, 930
MaeI CTAG 7 cut(s) 63, 89, 135, 195, 221, 300, 516
MaeIII GTNAC 1 cut(s) 881
MalI GATC 1 cut(s) 716
MboI GATC 1 cut(s) 714
MboII GAAGA 7 cut(s) 224, 389, 509, 512, 650, 680, 689
MfeI CAATTG 3 cut(s) 95, 227, 248
MflI RGATCY 1 cut(s) 714
MhlI GDGCHC 1 cut(s) 758
MluCI AATT 9 cut(s) 71, 95, 138, 215, 227, 248, 456, 612, 672
MlyI GAGTC 2 cut(s) 200, 416
Mph1103I ATGCAT 1 cut(s) 37
MseI TTAA 6 cut(s) 399, 611, 768, 786, 815, 927
MspCI CTTAAG 1 cut(s) 398
MunI CAATTG 3 cut(s) 95, 227, 248
MwoI GCNNNNNNNGC 5 cut(s) 110, 131, 242, 305, 400
NcoI CCATGG 1 cut(s) 630
NdeII GATC 1 cut(s) 714
NheI GCTAGC 1 cut(s) 220
NlaIII CATG 5 cut(s) 10, 179, 341, 634, 725
NlaIV GGNNCC 1 cut(s) 159
NmuCI GTSAC 1 cut(s) 881
NsiI ATGCAT 1 cut(s) 37
NspI RCATGY 1 cut(s) 10
PaeI GCATGC 1 cut(s) 10
PagI TCATGA 2 cut(s) 175, 721
PciSI GCTCTTC 1 cut(s) 672
PfeI GAWTC 2 cut(s) 341, 491
PflMI CCANNNNNTGG 1 cut(s) 818
PleI GAGTC 2 cut(s) 199, 415
PpsI GAGTC 2 cut(s) 199, 415
PshBI ATTAAT 1 cut(s) 611
PspN4I GGNNCC 1 cut(s) 159
PsuI RGATCY 1 cut(s) 714
RsaI GTAC 3 cut(s) 27, 450, 703
RsaNI GTAC 3 cut(s) 26, 449, 702
SapI GCTCTTC 1 cut(s) 672
SaqAI TTAA 6 cut(s) 399, 611, 768, 786, 815, 927
Sau3AI GATC 1 cut(s) 714
SchI GAGTC 2 cut(s) 200, 416
SduI GDGCHC 1 cut(s) 758
SfaNI GCATC 6 cut(s) 22, 189, 403, 517, 565, 930
SfcI CTRYAG 1 cut(s) 832
SmlI CTYRAG 5 cut(s) 12, 129, 261, 398, 888
SmoI CTYRAG 5 cut(s) 12, 129, 261, 398, 888
SphI GCATGC 1 cut(s) 10
Sse9I AATT 9 cut(s) 71, 95, 138, 215, 227, 248, 456, 612, 672
SsiI CCGC 2 cut(s) 530, 578
SspI AATATT 1 cut(s) 625
SspMI CTAG 7 cut(s) 63, 89, 135, 195, 221, 300, 516
StyI CCWWGG 3 cut(s) 62, 630, 683
TaaI ACNGT 1 cut(s) 836
TaqI TCGA 1 cut(s) 390
TasI AATT 9 cut(s) 71, 95, 138, 215, 227, 248, 456, 612, 672
TatI WGTACW 1 cut(s) 448
TfiI GAWTC 2 cut(s) 341, 491
Tru1I TTAA 6 cut(s) 399, 611, 768, 786, 815, 927
Tru9I TTAA 6 cut(s) 399, 611, 768, 786, 815, 927
TscAI CASTG 1 cut(s) 841
TseFI GTSAC 1 cut(s) 881
Tsp45I GTSAC 1 cut(s) 881
TspDTI ATGAA 5 cut(s) 63, 354, 486, 553, 681
TspRI CASTG 1 cut(s) 841
Van91I CCANNNNNTGG 1 cut(s) 818
Vha464I CTTAAG 1 cut(s) 398
VspI ATTAAT 1 cut(s) 611
XapI RAATTY 2 cut(s) 71, 138
XceI RCATGY 1 cut(s) 10
XmaJI CCTAGG 1 cut(s) 62
XspI CTAG 7 cut(s) 63, 89, 135, 195, 221, 300, 516
Zsp2I ATGCAT 1 cut(s) 37
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.