Rmu_sc0001336.1_g000059

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001336.1
OG0000195
Physical Location & Seq
Reverse (-)
229989 .. 230606
618 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001336.1_g000059.1.cds

Sequence Viewer

Length: 618 bp
atggatcaatggagctatggatgggatgatcgtaggggatatgagcaacaaagttataatggtgaaggttatcaagaatggaatacatatgccgagagttctatgccttgttacaaccaagcttgtgccttgtgtaattctccgtggcattcaccatttgagtgttctttgagatttgaatacccggattttatgcaagagtatgagtacaagatggggatggataaagagacatgtgtacccgaagcatatccacaaaagcaagcttttgagcctaggaagccatcacttgaagaacaacttgctcaattggaagcctctaatgctcaattgcatgcctcccaagctcaatgtctagcctcccaagctcgattgcatgctaaattggaagccattaatgctcaattgcaagcttctcaagaaatcacttcacattccaatgagcaacttgagcctagtcttgagcaagagccaccattcaccatttgtcatgagcaagattctttctttgatcaagtggagcctaattcaagagaagaagtatattttgagcatcatgagcaagagttgcctcttcatgatcgagagggtgatgttcatgtacaagaaagtgtgtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

205

Amino Acids

23.95

Weight (kDa)

4.45

Isoelectric Point (pI)

64.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000195)

Species Orthologous Gene IDs
fragaria_vesca FvH4_6g25780 FvH4_6g25920
rosa_chinensis RchiOBHm_Chr1g0366971 RchiOBHm_Chr1g0372841 RchiOBHm_Chr2g0146841 RchiOBHm_Chr2g0154821 RchiOBHm_Chr2g0159611 RchiOBHm_Chr3g0452071 RchiOBHm_Chr3g0453731 RchiOBHm_Chr3g0457891 RchiOBHm_Chr3g0471041 RchiOBHm_Chr3g0473741 RchiOBHm_Chr4g0427761 RchiOBHm_Chr5g0041301 RchiOBHm_Chr5g0076511 RchiOBHm_Chr6g0281431 RchiOBHm_Chr7g0180511
rosa_multiflora Rmu_sc0000082.1_g000052 Rmu_sc0000125.1_g000058 Rmu_sc0000147.1_g000108 Rmu_sc0000210.1_g000011 Rmu_sc0000229.1_g000006 Rmu_sc0000245.1_g000013 Rmu_sc0000897.1_g000016 Rmu_sc0001059.1_g000005 Rmu_sc0001336.1_g000059 Rmu_sc0001464.1_g000025 Rmu_sc0001630.1_g000013 Rmu_sc0001790.1_g000012 Rmu_sc0001939.1_g000003 Rmu_sc0002132.1_g000013 Rmu_sc0002235.1_g000008 Rmu_sc0002235.1_g000022 Rmu_sc0002548.1_g000030 Rmu_sc0002564.1_g000018 Rmu_sc0002652.1_g000001 Rmu_sc0002759.1_g000007 Rmu_sc0002759.1_g000011 Rmu_sc0002799.1_g000012 Rmu_sc0002858.1_g000033 Rmu_sc0002882.1_g000041 Rmu_sc0003032.1_g000030 Rmu_sc0003033.1_g000041 Rmu_sc0003044.1_g000038 Rmu_sc0003072.1_g000004 Rmu_sc0003264.1_g000025 Rmu_sc0003304.1_g000034 Rmu_sc0003416.1_g000002 Rmu_sc0003613.1_g000010 Rmu_sc0003762.1_g000009 Rmu_sc0003776.1_g000028 Rmu_sc0003859.1_g000025 Rmu_sc0004553.1_g000014 Rmu_sc0004866.1_g000002 Rmu_sc0004941.1_g000047 Rmu_sc0005777.1_g000002 Rmu_sc0005958.1_g000001 Rmu_sc0006573.1_g000001 Rmu_sc0006912.1_g000005 Rmu_sc0006968.1_g000002 Rmu_sc0006986.1_g000020 Rmu_sc0007258.1_g000016 Rmu_sc0007803.1_g000001 Rmu_sc0008479.1_g000003 Rmu_sc0008506.1_g000012 Rmu_sc0009199.1_g000005 Rmu_sc0009431.1_g000008 Rmu_sc0009611.1_g000005 Rmu_sc0014287.1_g000001 Rmu_sc0014768.1_g000001 Rmu_sc0020577.1_g000001 Rmu_sc0028131.1_g000001 Rmu_sc0029371.1_g000001 Rmu_sc0034219.1_g000001 Rmu_ssc0000252.1_g000026 Rmu_ssc0000252.1_g000027 Rmu_ssc0000398.1_g000023 Rmu_ssc0000482.1_g000020
rosa_roxburghii Rroxscaffold_158G00443700 Rroxscaffold_1G00001910 Rroxscaffold_1G00001960 Rroxscaffold_1G00002400 Rroxscaffold_1G00015110 Rroxscaffold_1G00015140 Rroxscaffold_1G00028870 Rroxscaffold_1G00028930 Rroxscaffold_1G00031320 Rroxscaffold_1G00031990 Rroxscaffold_1G00060310 Rroxscaffold_1G00063330 Rroxscaffold_1G00071570 Rroxscaffold_2G00084360 Rroxscaffold_2G00084370 Rroxscaffold_2G00088550 Rroxscaffold_2G00088560 Rroxscaffold_2G00089850 Rroxscaffold_2G00095470 Rroxscaffold_2G00103510 Rroxscaffold_2G00114380 Rroxscaffold_2G00119580 Rroxscaffold_2G00122990 Rroxscaffold_2G00125720 Rroxscaffold_3G00223380 Rroxscaffold_3G00230410 Rroxscaffold_3G00233640 Rroxscaffold_3G00234580 Rroxscaffold_3G00241070 Rroxscaffold_4G00282590 Rroxscaffold_4G00309420 Rroxscaffold_4G00309430 Rroxscaffold_4G00314030 Rroxscaffold_4G00314610 Rroxscaffold_4G00316420 Rroxscaffold_4G00319130 Rroxscaffold_4G00319140 Rroxscaffold_4G00319350 Rroxscaffold_4G00324170 Rroxscaffold_4G00324230 Rroxscaffold_5G00346540 Rroxscaffold_5G00346580 Rroxscaffold_5G00346790 Rroxscaffold_5G00349270 Rroxscaffold_5G00350530 Rroxscaffold_5G00373500 Rroxscaffold_5G00378950 Rroxscaffold_5G00378960 Rroxscaffold_5G00381870 Rroxscaffold_6G00388230 Rroxscaffold_6G00389700 Rroxscaffold_6G00389810 Rroxscaffold_6G00391690 Rroxscaffold_6G00391820 Rroxscaffold_6G00391830 Rroxscaffold_6G00393500 Rroxscaffold_6G00396180 Rroxscaffold_6G00396460 Rroxscaffold_6G00418900 Rroxscaffold_6G00423330 Rroxscaffold_7G00173340 Rroxscaffold_7G00176630 Rroxscaffold_7G00181910 Rroxscaffold_7G00191850 Rroxscaffold_7G00199230 Rroxscaffold_7G00199250 Rroxscaffold_7G00203720 Rroxscaffold_7G00204410 Rroxscaffold_7G00204420 Rroxscaffold_7G00212090 Rroxscaffold_7G00215450
rosa_rugosa Rorug07G0321500
rosa_samantha Rh3BG349100 Rh4AG240700
rosa_wichuraiana Rw0G011180 Rw1G003000 Rw5G028290 Rw6G011280

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 57
AclWI GGATC 1 cut(s) 12
AfaI GTAC 3 cut(s) 209, 240, 603
AflIII ACRYGT 1 cut(s) 233
AgsI TTSAA 3 cut(s) 179, 293, 531
AluBI AGCT 6 cut(s) 15, 122, 266, 347, 368, 413
AluI AGCT 6 cut(s) 15, 122, 266, 347, 368, 413
Alw26I GTCTC 1 cut(s) 224
AlwI GGATC 1 cut(s) 12
AseI ATTAAT 1 cut(s) 396
AspA2I CCTAGG 1 cut(s) 275
AsuC2I CCSGG 1 cut(s) 185
AsuHPI GGTGA 4 cut(s) 74, 144, 472, 602
AvrII CCTAGG 1 cut(s) 275
BaeI ACNNNNGTAYC 2 cut(s) 222, 255
BccI CCATC 4 cut(s) 15, 208, 214, 292
BclI TGATCA 1 cut(s) 511
BcnI CCSGG 1 cut(s) 185
BcoDI GTCTC 1 cut(s) 224
BfaI CTAG 3 cut(s) 276, 356, 456
BlnI CCTAGG 1 cut(s) 275
Bme1390I CCNGG 1 cut(s) 185
BmiI GGNNCC 1 cut(s) 522
BmrFI CCNGG 1 cut(s) 185
BmsI GCATC 1 cut(s) 562
BpuEI CTTGAG 3 cut(s) 402, 470, 482
BpuMI CCSGG 1 cut(s) 185
BsaJI CCNNGG 2 cut(s) 143, 275
BseDI CCNNGG 2 cut(s) 143, 275
BseGI GGATG 3 cut(s) 26, 31, 225
BsiSI CCGG 1 cut(s) 185
BsmAI GTCTC 1 cut(s) 224
BsmI GAATGC 1 cut(s) 148
Bsp1407I TGTACA 1 cut(s) 601
Bsp143I GATC 4 cut(s) 4, 28, 511, 580
BspHI TCATGA 3 cut(s) 490, 556, 577
BspLI GGNNCC 1 cut(s) 522
BspPI GGATC 1 cut(s) 12
BsrGI TGTACA 1 cut(s) 601
BssECI CCNNGG 2 cut(s) 143, 275
BssMI GATC 4 cut(s) 4, 28, 511, 580
BssT1I CCWWGG 1 cut(s) 275
Bst6I CTCTTC 1 cut(s) 579
BstAPI GCANNNNNTGC 1 cut(s) 568
BstAUI TGTACA 1 cut(s) 601
BstC8I GCNNGC 4 cut(s) 264, 336, 378, 411
BstDSI CCRYGG 1 cut(s) 143
BstF5I GGATG 3 cut(s) 26, 31, 225
BstKTI GATC 4 cut(s) 7, 31, 514, 583
BstMAI GTCTC 1 cut(s) 224
BstMBI GATC 4 cut(s) 4, 28, 511, 580
BstMWI GCNNNNNNNGC 8 cut(s) 280, 323, 344, 365, 398, 451, 559, 568
BstNSI RCATGY 3 cut(s) 237, 338, 380
BstSCI CCNGG 1 cut(s) 183
BtgI CCRYGG 1 cut(s) 143
BtsCI GGATG 3 cut(s) 26, 31, 225
Cac8I GCNNGC 4 cut(s) 264, 336, 378, 411
CciI TCATGA 3 cut(s) 490, 556, 577
Csp6I GTAC 3 cut(s) 208, 239, 602
CviAII CATG 7 cut(s) 234, 335, 377, 491, 557, 578, 599
CviQI GTAC 3 cut(s) 208, 239, 602
DpnI GATC 4 cut(s) 6, 30, 513, 582
DpnII GATC 4 cut(s) 4, 28, 511, 580
Eam1104I CTCTTC 1 cut(s) 579
EarI CTCTTC 1 cut(s) 579
Eco130I CCWWGG 1 cut(s) 275
EcoT14I CCWWGG 1 cut(s) 275
ErhI CCWWGG 1 cut(s) 275
FaeI CATG 7 cut(s) 237, 338, 380, 494, 560, 581, 602
FalI AAGNNNNNCTT 2 cut(s) 285, 317
FatI CATG 7 cut(s) 233, 334, 376, 490, 556, 577, 598
FauNDI CATATG 1 cut(s) 88
FbaI TGATCA 1 cut(s) 511
FokI GGATG 3 cut(s) 33, 38, 232
FspBI CTAG 3 cut(s) 276, 356, 456
HapII CCGG 1 cut(s) 185
Hin1II CATG 7 cut(s) 237, 338, 380, 494, 560, 581, 602
HindIII AAGCTT 3 cut(s) 120, 264, 411
HinfI GANTC 1 cut(s) 500
HpaII CCGG 1 cut(s) 185
HphI GGTGA 4 cut(s) 74, 144, 472, 602
Hpy166II GTNNAC 1 cut(s) 239
Hpy188III TCNNGA 8 cut(s) 74, 419, 461, 491, 531, 557, 578, 584
Hpy8I GTNNAC 1 cut(s) 239
HpyAV CCTTC 1 cut(s) 59
HpyCH4V TGCA 4 cut(s) 196, 334, 376, 409
HpyF10VI GCNNNNNNNGC 8 cut(s) 280, 323, 344, 365, 398, 451, 559, 568
Hsp92II CATG 7 cut(s) 237, 338, 380, 494, 560, 581, 602
Ksp22I TGATCA 1 cut(s) 511
Kzo9I GATC 4 cut(s) 4, 28, 511, 580
LmnI GCTCC 2 cut(s) 12, 520
LpnPI CCDG 1 cut(s) 198
LweI GCATC 1 cut(s) 562
MaeI CTAG 3 cut(s) 276, 356, 456
MaeIII GTNAC 1 cut(s) 110
MalI GATC 4 cut(s) 6, 30, 513, 582
MboI GATC 4 cut(s) 4, 28, 511, 580
MboII GAAGA 3 cut(s) 305, 548, 566
MfeI CAATTG 3 cut(s) 308, 329, 404
MluCI AATT 6 cut(s) 136, 308, 329, 383, 404, 526
MnlI CCTC 5 cut(s) 328, 349, 370, 580, 582
MseI TTAA 1 cut(s) 396
MslI CAYNNNNRTG 2 cut(s) 160, 438
MspI CCGG 1 cut(s) 185
MspR9I CCNGG 1 cut(s) 185
MunI CAATTG 3 cut(s) 308, 329, 404
Mva1269I GAATGC 1 cut(s) 148
MwoI GCNNNNNNNGC 8 cut(s) 280, 323, 344, 365, 398, 451, 559, 568
NciI CCSGG 1 cut(s) 185
NdeI CATATG 1 cut(s) 88
NdeII GATC 4 cut(s) 4, 28, 511, 580
NlaIII CATG 7 cut(s) 237, 338, 380, 494, 560, 581, 602
NlaIV GGNNCC 1 cut(s) 522
NmeAIII GCCGAG 1 cut(s) 118
NspI RCATGY 3 cut(s) 237, 338, 380
PaeI GCATGC 2 cut(s) 338, 380
PagI TCATGA 3 cut(s) 490, 556, 577
PciI ACATGT 1 cut(s) 233
PctI GAATGC 1 cut(s) 148
PfeI GAWTC 1 cut(s) 500
PscI ACATGT 1 cut(s) 233
PshBI ATTAAT 1 cut(s) 396
PsiI TTATAA 1 cut(s) 57
PspN4I GGNNCC 1 cut(s) 522
RsaI GTAC 3 cut(s) 209, 240, 603
RsaNI GTAC 3 cut(s) 208, 239, 602
RseI CAYNNNNRTG 2 cut(s) 160, 438
SaqAI TTAA 1 cut(s) 396
Sau3AI GATC 4 cut(s) 4, 28, 511, 580
ScrFI CCNGG 1 cut(s) 185
SetI ASST 7 cut(s) 17, 70, 124, 268, 349, 370, 415
SfaNI GCATC 1 cut(s) 562
SmiMI CAYNNNNRTG 2 cut(s) 160, 438
SmlI CTYRAG 3 cut(s) 417, 449, 461
SmoI CTYRAG 3 cut(s) 417, 449, 461
SphI GCATGC 2 cut(s) 338, 380
Sse9I AATT 6 cut(s) 136, 308, 329, 383, 404, 526
SspMI CTAG 3 cut(s) 276, 356, 456
StyD4I CCNGG 1 cut(s) 183
StyI CCWWGG 1 cut(s) 275
TaqI TCGA 2 cut(s) 370, 583
TasI AATT 6 cut(s) 136, 308, 329, 383, 404, 526
TatI WGTACW 2 cut(s) 207, 601
TfiI GAWTC 1 cut(s) 500
Tru1I TTAA 1 cut(s) 396
Tru9I TTAA 1 cut(s) 396
TspDTI ATGAA 2 cut(s) 566, 587
TspGWI ACGGA 1 cut(s) 132
VspI ATTAAT 1 cut(s) 396
XceI RCATGY 3 cut(s) 237, 338, 380
XmaJI CCTAGG 1 cut(s) 275
XspI CTAG 3 cut(s) 276, 356, 456
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.