Rmu_ssc0000252.1_g000027

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000252.1
OG0000195
Physical Location & Seq
Forward (+)
148374 .. 149452
1079 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000252.1_g000027.1.cds

Sequence Viewer

Length: 993 bp
atggatcgatggagctatggatgggatgactcgaggggatatgagcaagaatgtttctatggtggaggtcatcaagagtggaattctcatgcggtgggttctatgtcttcttgcaatgaaacttgtgctttgtgtaattctccgtggcattcacgttttgagtgctctatgagatttgaatgcccaaattttatgcaagagcatgagtacatgtatcaagagacatttgtacccgacacatatccacaagatgaagcttatgagcctagtaaggaattcgttgaaggactactagctcaattgcaagcctcccgagatctattacatgcctctcaagctagaatttcacaagagaccatggttcccgaagcatatcctcatgagcaagcatatgagtctaggaggccttctcttgaagaattgctagctcaattgcaagcttcccaaacccaattgcaagcctcacaagctcaattgcaagcttctcaagaaatgcttgcacattccaatgagcaacttgaagcaagttttgcacaaaagggccacccttcgccatttatgagcatgaatgattatagtgatgttgatgtacaagaaagtgagcttggttgtgaaagttccaatgcaagtaaggtgggagactacacttcggaggaatgggtgcaatattggaaatctaagcttccaaatggagggaatatatttgaagatgattccgaagaagaggatggcttgtctaatgaggaggatgcggagtttgaagtcctacaccataatcccttattcattgaggaggatgcagagcttcaagtcatatatcataatcctttattcattgaggctgatgttcccaaggaggaagagagtcaagcaatggtttgtgatgatgaagaagttgaagagccaaggacttttcctcctcccacatccaaagagttccatcatgagtttcccaaggtggagggtagaacattgagcactttatgttcttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

330

Amino Acids

37.87

Weight (kDa)

4.27

Isoelectric Point (pI)

73.54

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000195)

Species Orthologous Gene IDs
fragaria_vesca FvH4_6g25780 FvH4_6g25920
rosa_chinensis RchiOBHm_Chr1g0366971 RchiOBHm_Chr1g0372841 RchiOBHm_Chr2g0146841 RchiOBHm_Chr2g0154821 RchiOBHm_Chr2g0159611 RchiOBHm_Chr3g0452071 RchiOBHm_Chr3g0453731 RchiOBHm_Chr3g0457891 RchiOBHm_Chr3g0471041 RchiOBHm_Chr3g0473741 RchiOBHm_Chr4g0427761 RchiOBHm_Chr5g0041301 RchiOBHm_Chr5g0076511 RchiOBHm_Chr6g0281431 RchiOBHm_Chr7g0180511
rosa_multiflora Rmu_sc0000082.1_g000052 Rmu_sc0000125.1_g000058 Rmu_sc0000147.1_g000108 Rmu_sc0000210.1_g000011 Rmu_sc0000229.1_g000006 Rmu_sc0000245.1_g000013 Rmu_sc0000897.1_g000016 Rmu_sc0001059.1_g000005 Rmu_sc0001336.1_g000059 Rmu_sc0001464.1_g000025 Rmu_sc0001630.1_g000013 Rmu_sc0001790.1_g000012 Rmu_sc0001939.1_g000003 Rmu_sc0002132.1_g000013 Rmu_sc0002235.1_g000008 Rmu_sc0002235.1_g000022 Rmu_sc0002548.1_g000030 Rmu_sc0002564.1_g000018 Rmu_sc0002652.1_g000001 Rmu_sc0002759.1_g000007 Rmu_sc0002759.1_g000011 Rmu_sc0002799.1_g000012 Rmu_sc0002858.1_g000033 Rmu_sc0002882.1_g000041 Rmu_sc0003032.1_g000030 Rmu_sc0003033.1_g000041 Rmu_sc0003044.1_g000038 Rmu_sc0003072.1_g000004 Rmu_sc0003264.1_g000025 Rmu_sc0003304.1_g000034 Rmu_sc0003416.1_g000002 Rmu_sc0003613.1_g000010 Rmu_sc0003762.1_g000009 Rmu_sc0003776.1_g000028 Rmu_sc0003859.1_g000025 Rmu_sc0004553.1_g000014 Rmu_sc0004866.1_g000002 Rmu_sc0004941.1_g000047 Rmu_sc0005777.1_g000002 Rmu_sc0005958.1_g000001 Rmu_sc0006573.1_g000001 Rmu_sc0006912.1_g000005 Rmu_sc0006968.1_g000002 Rmu_sc0006986.1_g000020 Rmu_sc0007258.1_g000016 Rmu_sc0007803.1_g000001 Rmu_sc0008479.1_g000003 Rmu_sc0008506.1_g000012 Rmu_sc0009199.1_g000005 Rmu_sc0009431.1_g000008 Rmu_sc0009611.1_g000005 Rmu_sc0014287.1_g000001 Rmu_sc0014768.1_g000001 Rmu_sc0020577.1_g000001 Rmu_sc0028131.1_g000001 Rmu_sc0029371.1_g000001 Rmu_sc0034219.1_g000001 Rmu_ssc0000252.1_g000026 Rmu_ssc0000252.1_g000027 Rmu_ssc0000398.1_g000023 Rmu_ssc0000482.1_g000020
rosa_roxburghii Rroxscaffold_158G00443700 Rroxscaffold_1G00001910 Rroxscaffold_1G00001960 Rroxscaffold_1G00002400 Rroxscaffold_1G00015110 Rroxscaffold_1G00015140 Rroxscaffold_1G00028870 Rroxscaffold_1G00028930 Rroxscaffold_1G00031320 Rroxscaffold_1G00031990 Rroxscaffold_1G00060310 Rroxscaffold_1G00063330 Rroxscaffold_1G00071570 Rroxscaffold_2G00084360 Rroxscaffold_2G00084370 Rroxscaffold_2G00088550 Rroxscaffold_2G00088560 Rroxscaffold_2G00089850 Rroxscaffold_2G00095470 Rroxscaffold_2G00103510 Rroxscaffold_2G00114380 Rroxscaffold_2G00119580 Rroxscaffold_2G00122990 Rroxscaffold_2G00125720 Rroxscaffold_3G00223380 Rroxscaffold_3G00230410 Rroxscaffold_3G00233640 Rroxscaffold_3G00234580 Rroxscaffold_3G00241070 Rroxscaffold_4G00282590 Rroxscaffold_4G00309420 Rroxscaffold_4G00309430 Rroxscaffold_4G00314030 Rroxscaffold_4G00314610 Rroxscaffold_4G00316420 Rroxscaffold_4G00319130 Rroxscaffold_4G00319140 Rroxscaffold_4G00319350 Rroxscaffold_4G00324170 Rroxscaffold_4G00324230 Rroxscaffold_5G00346540 Rroxscaffold_5G00346580 Rroxscaffold_5G00346790 Rroxscaffold_5G00349270 Rroxscaffold_5G00350530 Rroxscaffold_5G00373500 Rroxscaffold_5G00378950 Rroxscaffold_5G00378960 Rroxscaffold_5G00381870 Rroxscaffold_6G00388230 Rroxscaffold_6G00389700 Rroxscaffold_6G00389810 Rroxscaffold_6G00391690 Rroxscaffold_6G00391820 Rroxscaffold_6G00391830 Rroxscaffold_6G00393500 Rroxscaffold_6G00396180 Rroxscaffold_6G00396460 Rroxscaffold_6G00418900 Rroxscaffold_6G00423330 Rroxscaffold_7G00173340 Rroxscaffold_7G00176630 Rroxscaffold_7G00181910 Rroxscaffold_7G00191850 Rroxscaffold_7G00199230 Rroxscaffold_7G00199250 Rroxscaffold_7G00203720 Rroxscaffold_7G00204410 Rroxscaffold_7G00204420 Rroxscaffold_7G00212090 Rroxscaffold_7G00215450
rosa_rugosa Rorug07G0321500
rosa_samantha Rh3BG349100 Rh4AG240700
rosa_wichuraiana Rw0G011180 Rw1G003000 Rw5G028290 Rw6G011280

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 92, 752
AclWI GGATC 1 cut(s) 12
AcsI RAATTY 4 cut(s) 82, 187, 275, 342
AfaI GTAC 3 cut(s) 209, 231, 591
AfiI CCNNNNNNNGG 1 cut(s) 692
AflIII ACRYGT 1 cut(s) 210
AgsI TTSAA 8 cut(s) 179, 284, 416, 521, 707, 761, 809, 899
AjuI GAANNNNNNNTTGG 2 cut(s) 588, 620
Alw21I GWGCWC 2 cut(s) 167, 980
Alw26I GTCTC 3 cut(s) 215, 347, 633
AlwI GGATC 1 cut(s) 12
Ama87I CYCGRG 2 cut(s) 31, 312
AoxI GGCC 2 cut(s) 404, 541
ApoI RAATTY 4 cut(s) 82, 187, 275, 342
AspS9I GGNCC 1 cut(s) 541
AsuNHI GCTAGC 1 cut(s) 424
AvaI CYCGRG 2 cut(s) 31, 312
BaeI ACNNNNGTAYC 2 cut(s) 213, 246
BbsI GAAGAC 1 cut(s) 99
Bbv12I GWGCWC 2 cut(s) 167, 980
BccI CCATC 4 cut(s) 3, 15, 722, 948
BcoDI GTCTC 3 cut(s) 215, 347, 633
BfaI CTAG 5 cut(s) 267, 293, 339, 399, 425
BglII AGATCT 1 cut(s) 316
BmeT110I CYCGRG 2 cut(s) 31, 312
BmgT120I GGNCC 1 cut(s) 541
BmiI GGNNCC 1 cut(s) 363
BmsI GCATC 2 cut(s) 739, 787
BmtI GCTAGC 1 cut(s) 428
BpiI GAAGAC 1 cut(s) 99
BplI GAGNNNNNCTC 2 cut(s) 394, 426
BpuEI CTTGAG 2 cut(s) 318, 471
Bsa29I ATCGAT 1 cut(s) 7
BsaI GGTCTC 1 cut(s) 347
BsaJI CCNNGG 5 cut(s) 143, 357, 852, 905, 954
BsaXI ACNNNNNCTCC 2 cut(s) 901, 931
Bsc4I CCNNNNNNNGG 1 cut(s) 692
Bse3DI GCAATG 2 cut(s) 121, 879
BseCI ATCGAT 1 cut(s) 7
BseDI CCNNGG 5 cut(s) 143, 357, 852, 905, 954
BseGI GGATG 6 cut(s) 26, 31, 733, 754, 802, 926
BseLI CCNNNNNNNGG 1 cut(s) 692
BseMI GCAATG 2 cut(s) 121, 879
BseRI GAGGAG 3 cut(s) 758, 806, 909
BshFI GGCC 2 cut(s) 406, 543
BshVI ATCGAT 1 cut(s) 7
BsiHKAI GWGCWC 2 cut(s) 167, 980
BsiHKCI CYCGRG 2 cut(s) 31, 312
BslI CCNNNNNNNGG 1 cut(s) 692
BsmAI GTCTC 3 cut(s) 215, 347, 633
BsmI GAATGC 2 cut(s) 148, 185
BsnI GGCC 2 cut(s) 406, 543
Bso31I GGTCTC 1 cut(s) 347
BsoBI CYCGRG 2 cut(s) 31, 312
Bsp1286I GDGCHC 2 cut(s) 167, 980
Bsp1407I TGTACA 1 cut(s) 589
Bsp143I GATC 2 cut(s) 4, 316
Bsp19I CCATGG 1 cut(s) 357
BspACI CCGC 2 cut(s) 92, 752
BspANI GGCC 2 cut(s) 406, 543
BspDI ATCGAT 1 cut(s) 7
BspHI TCATGA 2 cut(s) 379, 943
BspLI GGNNCC 1 cut(s) 363
BspOI GCTAGC 1 cut(s) 428
BspPI GGATC 1 cut(s) 12
BspQI GCTCTTC 1 cut(s) 894
BspTNI GGTCTC 1 cut(s) 347
BsrDI GCAATG 2 cut(s) 121, 879
BsrGI TGTACA 1 cut(s) 589
BssECI CCNNGG 5 cut(s) 143, 357, 852, 905, 954
BssMI GATC 2 cut(s) 4, 316
BssT1I CCWWGG 4 cut(s) 357, 852, 905, 954
Bst6I CTCTTC 3 cut(s) 717, 855, 894
BstAPI GCANNNNNTGC 1 cut(s) 530
BstAUI TGTACA 1 cut(s) 589
BstC8I GCNNGC 7 cut(s) 306, 387, 426, 438, 459, 480, 498
BstDEI CTNAG 1 cut(s) 678
BstDSI CCRYGG 2 cut(s) 143, 357
BstF5I GGATG 6 cut(s) 26, 31, 733, 754, 802, 926
BstKTI GATC 2 cut(s) 7, 319
BstMAI GTCTC 3 cut(s) 215, 347, 633
BstMBI GATC 2 cut(s) 4, 316
BstMWI GCNNNNNNNGC 3 cut(s) 335, 467, 530
BstNSI RCATGY 2 cut(s) 214, 329
BstV2I GAAGAC 1 cut(s) 99
BstX2I RGATCY 1 cut(s) 316
BstYI RGATCY 1 cut(s) 316
Bsu15I ATCGAT 1 cut(s) 7
BsuRI GGCC 2 cut(s) 406, 543
BsuTUI ATCGAT 1 cut(s) 7
BtgI CCRYGG 2 cut(s) 143, 357
BtsCI GGATG 6 cut(s) 26, 31, 733, 754, 802, 926
Cac8I GCNNGC 7 cut(s) 306, 387, 426, 438, 459, 480, 498
CciI TCATGA 2 cut(s) 379, 943
Cfr13I GGNCC 1 cut(s) 541
ClaI ATCGAT 1 cut(s) 7
Csp6I GTAC 3 cut(s) 208, 230, 590
CspCI CAANNNNNGTGG 2 cut(s) 615, 650
CviAII CATG 8 cut(s) 89, 203, 211, 326, 358, 380, 565, 944
CviQI GTAC 3 cut(s) 208, 230, 590
DdeI CTNAG 1 cut(s) 678
DpnI GATC 2 cut(s) 6, 318
DpnII GATC 2 cut(s) 4, 316
Eam1104I CTCTTC 3 cut(s) 717, 855, 894
EarI CTCTTC 3 cut(s) 717, 855, 894
Eco130I CCWWGG 4 cut(s) 357, 852, 905, 954
Eco147I AGGCCT 1 cut(s) 406
Eco31I GGTCTC 1 cut(s) 347
Eco88I CYCGRG 2 cut(s) 31, 312
EcoRI GAATTC 2 cut(s) 82, 275
EcoT14I CCWWGG 4 cut(s) 357, 852, 905, 954
ErhI CCWWGG 4 cut(s) 357, 852, 905, 954
FaeI CATG 8 cut(s) 92, 206, 214, 329, 361, 383, 568, 947
FalI AAGNNNNNCTT 2 cut(s) 480, 512
FatI CATG 8 cut(s) 88, 202, 210, 325, 357, 379, 564, 943
FauNDI CATATG 1 cut(s) 391
FokI GGATG 6 cut(s) 33, 38, 740, 761, 809, 913
FspBI CTAG 5 cut(s) 267, 293, 339, 399, 425
HaeIII GGCC 2 cut(s) 406, 543
Hin1II CATG 8 cut(s) 92, 206, 214, 329, 361, 383, 568, 947
HindIII AAGCTT 4 cut(s) 255, 438, 480, 680
HinfI GANTC 4 cut(s) 29, 395, 713, 865
Hpy188I TCNGA 2 cut(s) 652, 718
Hpy188III TCNNGA 8 cut(s) 74, 218, 312, 365, 380, 413, 488, 944
HpyAV CCTTC 3 cut(s) 278, 417, 558
HpyCH4IV ACGT 1 cut(s) 154
HpyF10VI GCNNNNNNNGC 3 cut(s) 335, 467, 530
HpyF3I CTNAG 1 cut(s) 678
HpySE526I ACGT 1 cut(s) 154
Hsp92II CATG 8 cut(s) 92, 206, 214, 329, 361, 383, 568, 947
Kzo9I GATC 2 cut(s) 4, 316
LguI GCTCTTC 1 cut(s) 894
LmnI GCTCC 1 cut(s) 12
LweI GCATC 2 cut(s) 739, 787
MaeI CTAG 5 cut(s) 267, 293, 339, 399, 425
MaeII ACGT 1 cut(s) 154
MalI GATC 2 cut(s) 6, 318
MboI GATC 2 cut(s) 4, 316
MboII GAAGA 8 cut(s) 99, 428, 719, 731, 734, 872, 902, 911
MfeI CAATTG 4 cut(s) 299, 431, 452, 473
MflI RGATCY 1 cut(s) 316
MhlI GDGCHC 2 cut(s) 167, 980
MlyI GAGTC 3 cut(s) 23, 404, 874
MseI TTAA 1 cut(s) 991
MslI CAYNNNNRTG 1 cut(s) 507
MunI CAATTG 4 cut(s) 299, 431, 452, 473
Mva1269I GAATGC 2 cut(s) 148, 185
MwoI GCNNNNNNNGC 3 cut(s) 335, 467, 530
NcoI CCATGG 1 cut(s) 357
NdeI CATATG 1 cut(s) 391
NdeII GATC 2 cut(s) 4, 316
NheI GCTAGC 1 cut(s) 424
NlaIII CATG 8 cut(s) 92, 206, 214, 329, 361, 383, 568, 947
NlaIV GGNNCC 1 cut(s) 363
NspI RCATGY 2 cut(s) 214, 329
PaeR7I CTCGAG 1 cut(s) 31
PagI TCATGA 2 cut(s) 379, 943
PceI AGGCCT 1 cut(s) 406
PciI ACATGT 1 cut(s) 210
PciSI GCTCTTC 1 cut(s) 894
PctI GAATGC 2 cut(s) 148, 185
PfeI GAWTC 1 cut(s) 713
PleI GAGTC 3 cut(s) 23, 403, 873
PpsI GAGTC 3 cut(s) 23, 403, 873
PscI ACATGT 1 cut(s) 210
PspN4I GGNNCC 1 cut(s) 363
PspPI GGNCC 1 cut(s) 541
PspXI VCTCGAGB 1 cut(s) 31
PsuI RGATCY 1 cut(s) 316
RsaI GTAC 3 cut(s) 209, 231, 591
RsaNI GTAC 3 cut(s) 208, 230, 590
RseI CAYNNNNRTG 1 cut(s) 507
SapI GCTCTTC 1 cut(s) 894
SaqAI TTAA 1 cut(s) 991
Sau3AI GATC 2 cut(s) 4, 316
Sau96I GGNCC 1 cut(s) 541
SchI GAGTC 3 cut(s) 23, 404, 874
SduI GDGCHC 2 cut(s) 167, 980
SfaNI GCATC 2 cut(s) 739, 787
Sfr274I CTCGAG 1 cut(s) 31
SlaI CTCGAG 1 cut(s) 31
SmiMI CAYNNNNRTG 1 cut(s) 507
SmlI CTYRAG 3 cut(s) 31, 333, 486
SmoI CTYRAG 3 cut(s) 31, 333, 486
SseBI AGGCCT 1 cut(s) 406
SsiI CCGC 2 cut(s) 92, 752
SspI AATATT 1 cut(s) 668
SspMI CTAG 5 cut(s) 267, 293, 339, 399, 425
StuI AGGCCT 1 cut(s) 406
StyI CCWWGG 4 cut(s) 357, 852, 905, 954
TaiI ACGT 1 cut(s) 157
TaqI TCGA 2 cut(s) 7, 32
TatI WGTACW 2 cut(s) 207, 589
TfiI GAWTC 1 cut(s) 713
Tru1I TTAA 1 cut(s) 991
Tru9I TTAA 1 cut(s) 991
TspDTI ATGAA 6 cut(s) 132, 267, 581, 775, 823, 903
TspGWI ACGGA 1 cut(s) 132
XapI RAATTY 4 cut(s) 82, 187, 275, 342
XceI RCATGY 2 cut(s) 214, 329
XhoI CTCGAG 1 cut(s) 31
XspI CTAG 5 cut(s) 267, 293, 339, 399, 425
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.