Rmu_sc0023319.1_g000001

Frigida-like protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0023319.1
OG0000126
Physical Location & Seq
Forward (+)
1137 .. 6444
5308 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0023319.1_g000001.1.cds

Sequence Viewer

Length: 3426 bp
atggagactgcggcggcggagttggaacaaaaatcggaggcgaaacagaggagcctaggcgcggcgtttgagtcgttgagttcgcaagcttcgtcgattctgaagtttacggtggagtggaaggagctggaggaccatttcgagtcgacccggagggtgctccggacccggttcgaggaggtaagggatcgcgtgaaggaggtggcggagatggaggcgaaggaggagaggctgaagatggaggtgaaggggagggagaaggagttgggggaaatcgaggaggtggtggagcggaggaggagggaggtggaggaaagtgagagttatttggagtctgtgagggctttgattgtggagaatgatgaggagcttagggttagggaggagaggtatgataaagttgagagattgattagggagaaggagagggaggtggaggagatggagaagcatgtgagagagaggtctaggaagttgagttggctggacaagaggatagaggtgaagaagaaggaggttgagaggaaggagagggagctgagagaggttagggatttggaggagaagaaattgagtggtgttagggggttgattgaggagaagaggaaggaagttgagttgaaggaagatgagatggtgatggtgaaagggagggttgaggattgtgatagggaaatgaaggagaaagaggagaggctgagtttgattgagaaatcgaaagaggaaatgattggtgtggtggatttgaaagggaaagagttctgtttgctgaagaaatcaatggaggagtggtgctgtaagattgaagtgaaggagagggagcttgaaggatgggttgataagttggaatcgaaagagaaggaagttgaattgaaggttgaggagcttgatttgattcgtagcaagttccttgatgaggttcagttcaaagaaaagcatttggattcgcttgaaaaatcgttactagaatgggaggaggatctgcattccctccagaagtcggtacaagaatgttcccggggaagtgagatcattagggatggaagaggattgcagcagttcatggacgagcatctgaagagaatcgattccatgggtactgaactgtcagcgattcttaaagagtcttcagacccggggaagttggttttggatgcaatgcaggggttttatgctgacaacagggagttagattttgaattgagagttagaagaagaagttgttgtcttttgttagaggagttgaggagaatctctccacaaatgaatccgcaagtgaaagaggatgcgatgaaactggctgctaattggaaagccaagatgacagtggcgagtgacaatgagttggaggtcttgggatttttgtggcttgttgctgcttatgacttaacttctatctacgatgtgaaggagcttaaaaggcttctttctaaagtttcgcggggtgaacaagcagctcaaataggcctggcccttggtattccggcacctggaagccgcaacatttgttcccctgtcaaaattgaggaaccagaatcttctacggccaacaatgcagcaactatttcttctcctaatcctcaaacaagtgccaccacagatgcaagggattcacgggggtgtataaatgagactttgaattggaatgtagatacaatacagaatgaaatagtggcttctgttcaatcggcatcggacccagaagaacttgtgttgaagatgatgcaaaattctcttggcaaatactggacaagcacagaagatggtctgaaaaggcatgtcatgtcgtgtaatatttctctattaaagatgctaatgagagtctcaccacaagttggatctcacgtaaaagaagatgccaaaaagctaggactccaatggaaagcaaaaattagagctgatgctgaacatttggaacatcttttggagattgtggggtttttgctatttattgttgcatatggattgcttcctacactaaatggagatgagattgtaaagtttcttgagaagctttctcaatataaagaagctgtagaatcatgtcagatgcatggttttctagataagatccttgctgtttttattcagacactagtggaaaggaagcaactctttcaggctcttggatttgtctttaagttcaagttacgggacaagttcactccagtacgagtcttaaaagactatgtgaaggatgcaatgaagtgttggtcagaaactttgaagagaaagaaatcagttgatgaaaaggttgagtttttagacagcaaaatagctgcttttggaactgtgcttcgatgcatcaaagaatacaacctcgagtctgaatacccgtccagggaaattgcagtacaaataggtgagctggaaaaactaaaggagatttggagaagttcggcaaaacatcttgcctctgtcactagacagcaagagagtcaagggaagaaacgtagtagcagcacttgttcccctgcggttcaacaaggacaacagcagaaaagcaaattccatcggacagctgaagcagcccctagtccctataaatcaccaactttcacccctgtgcttctgcagtcaagaccatcatcatctttggcgtatggaaattatggacagcatgggcaggttggtgatatggctgccaactctagtgaagttgatagatcttcatctttggcatatggaaattacggacagcttgggcagtttggtgatatggctgccaactctagtgaagttgatagatcttcatctttggcatatggaaattacggacagcttgggcagtttggtgatatggctgccaactctagtgaagttgatagatcttcatctttggcatatggaaattacggacagcttgggcagtttggtgatatggctgccaactctagtgaagttgatagatcttcatctttggcatatggaaattacggacagcttgggcagtttggtgatatggctgccaactctagtgaagttgatagatcttcatctttggcatatggaaattacggacagcttgggcagtttggtgatatggctgccaactctagtgaagttgatagatcttcatctttggcatatggaaattacggacagcttgggcagtttggtgatatggctgccaactctagtgaagttgatagatcttcatctttggcatatggaaattacggacagcttgggcagtttggtgatatggctgccaactctagtgaagttgatagatcttcatctttggtgagtgaaattcatggacagcatgggcagtttggttatatggctgccaacttagctgaagttaatcctcgttttggtaccatagatgaagttgatcctcattttggtgtacataatcttcctaacccttattcatccatggatttcaccttcttccctggccgttatggcccttattaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Frigida

Protein Analysis

1141

Amino Acids

129.2

Weight (kDa)

5.34

Isoelectric Point (pI)

50.31

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000126)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G04990
fragaria_vesca FvH4_5g20491 FvH4_5g20491 FvH4_5g20491 FvH4_6g04261 FvH4_6g04261 FvH4_6g04261 FvH4_6g04261 FvH4_6g04310 FvH4_6g04310 FvH4_6g04320 FvH4_6g04320 FvH4_6g04380 FvH4_6g04380 FvH4_6g04410 FvH4_6g04410 FvH4_6g04420 FvH4_6g04420 FvH4_6g04420 FvH4_6g04420 FvH4_6g04420 FvH4_6g04420 FvH4_6g04420 FvH4_6g04421 FvH4_6g04421 FvH4_6g04421 FvH4_6g04431 FvH4_6g04431 FvH4_6g04431 FvH4_6g04431 FvH4_6g04431 FvH4_6g04431 FvH4_6g04550 FvH4_6g04550 FvH4_6g04550 FvH4_6g04550 FvH4_6g04561 FvH4_6g04562 FvH4_7g18700
malus_domestica MD04G1214600.v1.1 MD04G1214700.v1.1 MD12G1013700.v1.1 MD12G1229200.v1.1 MD12G1229900.v1.1 MD12G1230000.v1.1 MD14G1011100.v1.1
prunus_persica Prupe.1G243600_v2.0.a1 Prupe.6G334600_v2.0.a1 Prupe.6G334700_v2.0.a1 Prupe.6G334700_v2.0.a1 Prupe.6G334700_v2.0.a1 Prupe.6G334700_v2.0.a1 Prupe.7G018200_v2.0.a1
pyrus_communis pycom03g04860 pycom04g18970 pycom04g18980 pycom11g05330 pycom11g05340 pycom11g05350 pycom12g01100 pycom12g01110 pycom12g21380 pycom14g00990
rosa_chinensis RchiOBHm_Chr2g0124181 RchiOBHm_Chr3g0452971 RchiOBHm_Chr3g0452981 RchiOBHm_Chr3g0452991 RchiOBHm_Chr3g0453041 RchiOBHm_Chr3g0453051 RchiOBHm_Chr3g0453061 RchiOBHm_Chr3g0453081 RchiOBHm_Chr3g0453091 RchiOBHm_Chr4g0411451 RchiOBHm_Chr7g0205851 RchiOBHm_Chr7g0237441
rosa_laevigata RLG00000001002 RLG00000003350 RLG00000008356 RLG00000018794 RLG00000025538 RLG00000025541 RLG00000025542 RLG00000025544 RLG00000025545 RLG00000025552 RLG00000025553 RLG00000025555 RLG00000025557
rosa_multiflora Rmu_co8055994.1_g000001 Rmu_co8332235.1_g000001 Rmu_co8359511.1_g000001 Rmu_sc0000076.1_g000037 Rmu_sc0000832.1_g000001 Rmu_sc0001982.1_g000017 Rmu_sc0002843.1_g000008 Rmu_sc0002923.1_g000015 Rmu_sc0002923.1_g000020 Rmu_sc0005888.1_g000004 Rmu_sc0005888.1_g000007 Rmu_sc0005888.1_g000012 Rmu_sc0005888.1_g000013 Rmu_sc0005888.1_g000014 Rmu_sc0005888.1_g000015 Rmu_sc0007863.1_g000006 Rmu_sc0008518.1_g000002 Rmu_sc0008797.1_g000002 Rmu_sc0008797.1_g000003 Rmu_sc0008797.1_g000007 Rmu_sc0009015.1_g000007 Rmu_sc0009015.1_g000008 Rmu_sc0012369.1_g000002 Rmu_sc0013935.1_g000001 Rmu_sc0019895.1_g000001 Rmu_sc0023319.1_g000001 Rmu_sc0030229.1_g000001 Rmu_sc0033390.1_g000001 Rmu_sc0042937.1_g000001 Rmu_ssc0000052.1_g000010
rosa_roxburghii Rroxscaffold_3G00224200 Rroxscaffold_3G00251930 Rroxscaffold_5G00356050 Rroxscaffold_6G00429980 Rroxscaffold_6G00430030 Rroxscaffold_6G00430040 Rroxscaffold_6G00430070 Rroxscaffold_6G00430080 Rroxscaffold_6G00430090 Rroxscaffold_6G00430130 Rroxscaffold_6G00430140 Rroxscaffold_6G00430160
rosa_rugosa Rorug02G0250200 Rorug02G0643800 Rorug02G0643900 Rorug02G0644000 Rorug02G0644100 Rorug02G0644200 Rorug02G0644500 Rorug02G0644600 Rorug02G0644800 Rorug02G0644900 Rorug02G0645000 Rorug02G0645800 Rorug02G0645900 Rorug02G0646200 Rorug02G0646400.1 Rorug04G0108800 Rorug07G0093400 Rorug07G0303400 Rorug07G0303500 Rorug07G0303600 Rorug07G0303600 Rorug07G0303700 Rorug07G0303700 Rorug07G0303700 Rorug07G0303700 Rorug07G0303700
rosa_samantha Rh2AG308300 Rh2BG317200 Rh2DG332300 Rh3AG047000 Rh3AG047100 Rh3AG047200 Rh3AG047300 Rh3AG047400 Rh3AG048600 Rh3AG048700 Rh3AG048900 Rh3AG049000 Rh3BG049400 Rh3BG049500 Rh3BG049600 Rh3BG049700 Rh3BG049900 Rh3BG050200 Rh3CG048100 Rh3CG048200 Rh3CG048400 Rh3CG048500 Rh3CG048700 Rh3CG049800 Rh3CG049900 Rh3CG050200 Rh3CG050300 Rh3DG049000 Rh3DG049100 Rh3DG049300 Rh3DG049400 Rh3DG049500 Rh3DG050600 Rh3DG050700 Rh3DG050900 Rh3DG051000 Rh4AG168200 Rh4BG165100 Rh4CG179700 Rh4DG162700 Rh5BG257600 Rh7AG225000 Rh7AG460700 Rh7BG220200 Rh7BG430500 Rh7CG238600 Rh7CG477900 Rh7DG047500 Rh7DG231700 Rh7DG447300
rosa_wichuraiana Rw2G005470 Rw2G024840 Rw3G003690 Rw3G003700 Rw3G003710 Rw3G003740 Rw3G003750 Rw4G013890 Rw4G013980 Rw7G019410

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 2617
Acc65I GGTACC 1 cut(s) 3323
AccB1I GGYRCC 2 cut(s) 1486, 3323
AccB7I CCANNNNNTGG 1 cut(s) 1835
AccBSI CCGCTC 1 cut(s) 292
AccI GTMKAC 1 cut(s) 146
AccII CGCG 3 cut(s) 62, 192, 1441
AccIII TCCGGA 1 cut(s) 162
AclWI GGATC 5 cut(s) 195, 987, 1846, 2065, 3335
AcoI YGGCCR 2 cut(s) 1545, 3406
AcsI RAATTY 3 cut(s) 1729, 2507, 3255
AcuI CTGAAG 7 cut(s) 122, 254, 791, 1097, 1113, 2544, 3324
AfaI GTAC 6 cut(s) 1005, 1099, 2172, 2355, 3325, 3357
AfiI CCNNNNNNNGG 9 cut(s) 61, 175, 916, 1000, 1490, 1835, 2341, 3320, 3350
AhlI ACTAGT 1 cut(s) 2095
AjnI CCWGG 4 cut(s) 1467, 1489, 2339, 3403
AjuI GAANNNNNNNTTGG 2 cut(s) 1133, 1165
AleI CACNNNNGTG 2 cut(s) 1618, 2564
Alw21I GWGCWC 1 cut(s) 162
Alw26I GTCTC 2 cut(s) 1625, 1828
AlwI GGATC 5 cut(s) 195, 987, 1846, 2065, 3335
Ama87I CYCGRG 3 cut(s) 1017, 1135, 2321
Aor13HI TCCGGA 1 cut(s) 162
AoxI GGCC 5 cut(s) 1465, 1470, 1545, 3406, 3415
ApoI RAATTY 3 cut(s) 1729, 2507, 3255
Asp700I GAANNNNTTC 2 cut(s) 758, 1087
Asp718I GGTACC 1 cut(s) 3323
AspA2I CCTAGG 1 cut(s) 55
AspLEI GCGC 1 cut(s) 62
AspS9I GGNCC 5 cut(s) 133, 165, 1471, 1696, 3416
AsuC2I CCSGG 6 cut(s) 151, 169, 1018, 1019, 1136, 1137
AvaI CYCGRG 3 cut(s) 1017, 1135, 2321
AvaII GGWCC 3 cut(s) 133, 165, 1696
AvrII CCTAGG 1 cut(s) 55
BanI GGYRCC 2 cut(s) 1486, 3323
BarI GAAGNNNNNNTAC 2 cut(s) 3348, 3380
BbsI GAAGAC 1 cut(s) 1119
Bbv12I GWGCWC 1 cut(s) 162
BceAI ACGGC 2 cut(s) 1560, 3393
BciT130I CCWGG 4 cut(s) 1469, 1491, 2341, 3405
BcnI CCSGG 6 cut(s) 151, 169, 1018, 1019, 1136, 1137
BcoDI GTCTC 2 cut(s) 1625, 1828
BcuI ACTAGT 1 cut(s) 2095
BfmI CTRYAG 2 cut(s) 2034, 2573
BfuAI ACCTGC 1 cut(s) 2617
BglI GCCNNNNNGGC 1 cut(s) 3414
BglII AGATCT 8 cut(s) 2666, 2747, 2828, 2909, 2990, 3071, 3152, 3233
BlnI CCTAGG 1 cut(s) 55
Bme18I GGWCC 3 cut(s) 133, 165, 1696
BmeT110I CYCGRG 3 cut(s) 1017, 1135, 2321
BmgT120I GGNCC 5 cut(s) 133, 165, 1471, 1696, 3416
BmiI GGNNCC 6 cut(s) 53, 167, 1488, 1530, 1698, 3325
BpiI GAAGAC 1 cut(s) 1119
BplI GAGNNNNNCTC 2 cut(s) 1240, 1272
BpmI CTGGAG 3 cut(s) 149, 977, 2151
Bpu10I CCTNAGC 1 cut(s) 371
BpuEI CTTGAG 1 cut(s) 2027
BpuMI CCSGG 6 cut(s) 151, 169, 1018, 1019, 1136, 1137
Bsa29I ATCGAT 1 cut(s) 1086
BsaAI YACGTR 1 cut(s) 1846
BsaBI GATNNNNATC 8 cut(s) 2671, 2752, 2833, 2914, 2995, 3076, 3157, 3238
BsaWI WCCGGW 1 cut(s) 162
BsaXI ACNNNNNCTCC 6 cut(s) 248, 278, 374, 404, 776, 806
Bsc4I CCNNNNNNNGG 9 cut(s) 61, 175, 916, 1000, 1490, 1835, 2341, 3320, 3350
Bse1I ACTGG 3 cut(s) 1302, 1751, 2168
Bse3DI GCAATG 2 cut(s) 1164, 2208
Bse8I GATNNNNATC 8 cut(s) 2671, 2752, 2833, 2914, 2995, 3076, 3157, 3238
BseAI TCCGGA 1 cut(s) 162
BseBI CCWGG 4 cut(s) 1469, 1491, 2341, 3405
BseCI ATCGAT 1 cut(s) 1086
BseGI GGATG 6 cut(s) 836, 1045, 1159, 1291, 2203, 3380
BseJI GATNNNNATC 8 cut(s) 2671, 2752, 2833, 2914, 2995, 3076, 3157, 3238
BseLI CCNNNNNNNGG 9 cut(s) 61, 175, 916, 1000, 1490, 1835, 2341, 3320, 3350
BseMI GCAATG 2 cut(s) 1164, 2208
BseMII CTCAG 2 cut(s) 530, 689
BseNI ACTGG 3 cut(s) 1302, 1751, 2168
Bsh1236I CGCG 3 cut(s) 62, 192, 1441
BshFI GGCC 5 cut(s) 1467, 1472, 1547, 3408, 3417
BshNI GGYRCC 2 cut(s) 1486, 3323
BshVI ATCGAT 1 cut(s) 1086
BsiHKAI GWGCWC 1 cut(s) 162
BsiHKCI CYCGRG 3 cut(s) 1017, 1135, 2321
BsiSI CCGG 6 cut(s) 151, 163, 169, 1018, 1136, 1484
BslFI GGGAC 2 cut(s) 2168, 2523
BslI CCNNNNNNNGG 9 cut(s) 61, 175, 916, 1000, 1490, 1835, 2341, 3320, 3350
BsmAI GTCTC 2 cut(s) 1625, 1828
BsmFI GGGAC 2 cut(s) 2168, 2523
BsmI GAATGC 1 cut(s) 985
BsnI GGCC 5 cut(s) 1467, 1472, 1547, 3408, 3417
BsoBI CYCGRG 3 cut(s) 1017, 1135, 2321
Bsp1286I GDGCHC 1 cut(s) 162
Bsp13I TCCGGA 1 cut(s) 162
Bsp1407I TGTACA 1 cut(s) 3355
Bsp19I CCATGG 2 cut(s) 1092, 3384
BspANI GGCC 5 cut(s) 1467, 1472, 1547, 3408, 3417
BspCNI CTCAG 2 cut(s) 531, 690
BspDI ATCGAT 1 cut(s) 1086
BspEI TCCGGA 1 cut(s) 162
BspFNI CGCG 3 cut(s) 62, 192, 1441
BspLI GGNNCC 6 cut(s) 53, 167, 1488, 1530, 1698, 3325
BspMAI CTGCAG 1 cut(s) 2577
BspMI ACCTGC 1 cut(s) 2617
BspPI GGATC 5 cut(s) 195, 987, 1846, 2065, 3335
BspT107I GGYRCC 2 cut(s) 1486, 3323
BsrBI CCGCTC 1 cut(s) 292
BsrDI GCAATG 2 cut(s) 1164, 2208
BsrGI TGTACA 1 cut(s) 3355
BsrI ACTGG 3 cut(s) 1302, 1751, 2168
BssT1I CCWWGG 4 cut(s) 55, 1092, 1474, 3384
Bst2UI CCWGG 4 cut(s) 1469, 1491, 2341, 3405
Bst4CI ACNGT 4 cut(s) 112, 1107, 1327, 2293
Bst6I CTCTTC 4 cut(s) 596, 1039, 1073, 2222
BstAUI TGTACA 1 cut(s) 3355
BstBAI YACGTR 1 cut(s) 1846
BstC8I GCNNGC 1 cut(s) 87
BstDEI CTNAG 4 cut(s) 371, 539, 698, 3298
BstDSI CCRYGG 2 cut(s) 1092, 3384
BstENI CCTNNNNNAGG 1 cut(s) 914
BstF5I GGATG 6 cut(s) 836, 1045, 1159, 1291, 2203, 3380
BstFNI CGCG 3 cut(s) 62, 192, 1441
BstHHI GCGC 1 cut(s) 62
BstMAI GTCTC 2 cut(s) 1625, 1828
BstMWI GCNNNNNNNGC 5 cut(s) 1420, 1553, 2528, 3299, 3414
BstNI CCWGG 4 cut(s) 1469, 1491, 2341, 3405
BstNSI RCATGY 2 cut(s) 455, 1781
BstSFI CTRYAG 2 cut(s) 2034, 2573
BstUI CGCG 3 cut(s) 62, 192, 1441
BstV2I GAAGAC 1 cut(s) 1119
Bsu15I ATCGAT 1 cut(s) 1086
BsuRI GGCC 5 cut(s) 1467, 1472, 1547, 3408, 3417
BsuTUI ATCGAT 1 cut(s) 1086
BtgI CCRYGG 2 cut(s) 1092, 3384
BtgZI GCGATG 1 cut(s) 1304
BtsCI GGATG 6 cut(s) 836, 1045, 1159, 1291, 2203, 3380
BtsIMutI CAGTG 1 cut(s) 1332
BveI ACCTGC 1 cut(s) 2617
Cac8I GCNNGC 1 cut(s) 87
CfoI GCGC 1 cut(s) 62
Cfr13I GGNCC 5 cut(s) 133, 165, 1471, 1696, 3416
Cfr9I CCCGGG 2 cut(s) 1017, 1135
ClaI ATCGAT 1 cut(s) 1086
Csp6I GTAC 6 cut(s) 1004, 1098, 2171, 2354, 3324, 3356
CviQI GTAC 6 cut(s) 1004, 1098, 2171, 2354, 3324, 3356
DdeI CTNAG 4 cut(s) 371, 539, 698, 3298
EaeI YGGCCR 2 cut(s) 1545, 3406
Eam1104I CTCTTC 4 cut(s) 596, 1039, 1073, 2222
EarI CTCTTC 4 cut(s) 596, 1039, 1073, 2222
EciI GGCGGA 2 cut(s) 32, 221
Eco130I CCWWGG 4 cut(s) 55, 1092, 1474, 3384
Eco147I AGGCCT 1 cut(s) 1467
Eco47I GGWCC 3 cut(s) 133, 165, 1696
Eco57I CTGAAG 7 cut(s) 122, 254, 791, 1097, 1113, 2544, 3324
Eco88I CYCGRG 3 cut(s) 1017, 1135, 2321
EcoNI CCTNNNNNAGG 1 cut(s) 914
EcoRII CCWGG 4 cut(s) 1467, 1489, 2339, 3403
EcoT14I CCWWGG 4 cut(s) 55, 1092, 1474, 3384
EcoT22I ATGCAT 2 cut(s) 2055, 2306
ErhI CCWWGG 4 cut(s) 55, 1092, 1474, 3384
FalI AAGNNNNNCTT 2 cut(s) 2099, 2131
FaqI GGGAC 2 cut(s) 2168, 2523
FauI CCCGC 1 cut(s) 1434
FauNDI CATATG 8 cut(s) 1960, 2683, 2764, 2845, 2926, 3007, 3088, 3169
FblI GTMKAC 1 cut(s) 146
FokI GGATG 6 cut(s) 843, 1052, 1166, 1298, 2210, 3367
GlaI GCGC 1 cut(s) 61
GsuI CTGGAG 3 cut(s) 149, 977, 2151
HaeIII GGCC 5 cut(s) 1467, 1472, 1547, 3408, 3417
HapII CCGG 6 cut(s) 151, 163, 169, 1018, 1136, 1484
HhaI GCGC 1 cut(s) 62
Hin6I GCGC 1 cut(s) 60
HinP1I GCGC 1 cut(s) 60
HincII GTYRAC 1 cut(s) 147
HindII GTYRAC 1 cut(s) 147
HindIII AAGCTT 2 cut(s) 87, 2012
HpaII CCGG 6 cut(s) 151, 163, 169, 1018, 1136, 1484
Hpy166II GTNNAC 5 cut(s) 108, 147, 1448, 2163, 3356
Hpy188III TCNNGA 5 cut(s) 163, 994, 2006, 2063, 2580
Hpy8I GTNNAC 5 cut(s) 108, 147, 1448, 2163, 3356
Hpy99I CGWCG 1 cut(s) 97
HpyCH4III ACNGT 4 cut(s) 112, 1107, 1327, 2293
HpyCH4IV ACGT 2 cut(s) 1845, 2452
HpyF10VI GCNNNNNNNGC 5 cut(s) 1420, 1553, 2528, 3299, 3414
HpyF3I CTNAG 4 cut(s) 371, 539, 698, 3298
HpySE526I ACGT 2 cut(s) 1845, 2452
HspAI GCGC 1 cut(s) 60
Kpn2I TCCGGA 1 cut(s) 162
KpnI GGTACC 1 cut(s) 3327
LmnI GCTCC 9 cut(s) 51, 124, 165, 289, 367, 535, 820, 883, 1411
MaeII ACGT 2 cut(s) 1845, 2452
MaeIII GTNAC 4 cut(s) 960, 1334, 2148, 2419
MbiI CCGCTC 1 cut(s) 292
MhlI GDGCHC 1 cut(s) 162
MlyI GAGTC 9 cut(s) 80, 152, 341, 1133, 1830, 1866, 2184, 2333, 2446
MmeI TCCRAC 3 cut(s) 825, 1326, 1816
Mph1103I ATGCAT 2 cut(s) 2055, 2306
MroI TCCGGA 1 cut(s) 162
MroXI GAANNNNTTC 2 cut(s) 758, 1087
MseI TTAA 8 cut(s) 1119, 1388, 1416, 1805, 2139, 2180, 3309, 3424
MslI CAYNNNNRTG 3 cut(s) 1618, 2564, 3351
MspA1I CMGCKG 1 cut(s) 2522
MspI CCGG 6 cut(s) 151, 163, 169, 1018, 1136, 1484
Mva1269I GAATGC 1 cut(s) 985
MvaI CCWGG 4 cut(s) 1469, 1491, 2341, 3405
MvnI CGCG 3 cut(s) 62, 192, 1441
MwoI GCNNNNNNNGC 5 cut(s) 1420, 1553, 2528, 3299, 3414
NciI CCSGG 6 cut(s) 151, 169, 1018, 1019, 1136, 1137
NcoI CCATGG 2 cut(s) 1092, 3384
NdeI CATATG 8 cut(s) 1960, 2683, 2764, 2845, 2926, 3007, 3088, 3169
NlaIV GGNNCC 6 cut(s) 53, 167, 1488, 1530, 1698, 3325
NmuCI GTSAC 2 cut(s) 1334, 2419
NsiI ATGCAT 2 cut(s) 2055, 2306
NspI RCATGY 2 cut(s) 455, 1781
OliI CACNNNNGTG 2 cut(s) 1618, 2564
PaeR7I CTCGAG 1 cut(s) 2321
PceI AGGCCT 1 cut(s) 1467
PcsI WCGNNNNNNNCGW 1 cut(s) 89
PctI GAATGC 1 cut(s) 985
PdmI GAANNNNTTC 2 cut(s) 758, 1087
PflMI CCANNNNNTGG 1 cut(s) 1835
PleI GAGTC 9 cut(s) 79, 151, 340, 1132, 1829, 1866, 2183, 2332, 2445
PpsI GAGTC 9 cut(s) 79, 151, 340, 1132, 1829, 1866, 2183, 2332, 2445
Ppu21I YACGTR 1 cut(s) 1846
Psp6I CCWGG 4 cut(s) 1467, 1489, 2339, 3403
PspGI CCWGG 4 cut(s) 1467, 1489, 2339, 3403
PspN4I GGNNCC 6 cut(s) 53, 167, 1488, 1530, 1698, 3325
PspPI GGNCC 5 cut(s) 133, 165, 1471, 1696, 3416
PspXI VCTCGAGB 1 cut(s) 2321
PstI CTGCAG 1 cut(s) 2577
PvuII CAGCTG 1 cut(s) 2522
RsaI GTAC 6 cut(s) 1005, 1099, 2172, 2355, 3325, 3357
RsaNI GTAC 6 cut(s) 1004, 1098, 2171, 2354, 3324, 3356
RseI CAYNNNNRTG 3 cut(s) 1618, 2564, 3351
SalI GTCGAC 1 cut(s) 145
SaqAI TTAA 8 cut(s) 1119, 1388, 1416, 1805, 2139, 2180, 3309, 3424
Sau96I GGNCC 5 cut(s) 133, 165, 1471, 1696, 3416
SchI GAGTC 9 cut(s) 80, 152, 341, 1133, 1830, 1866, 2184, 2333, 2446
SduI GDGCHC 1 cut(s) 162
SfcI CTRYAG 2 cut(s) 2034, 2573
SfiI GGCCNNNNNGGCC 1 cut(s) 3414
Sfr274I CTCGAG 1 cut(s) 2321
SinI GGWCC 3 cut(s) 133, 165, 1696
SlaI CTCGAG 1 cut(s) 2321
SmaI CCCGGG 2 cut(s) 1019, 1137
SmiMI CAYNNNNRTG 3 cut(s) 1618, 2564, 3351
SmlI CTYRAG 2 cut(s) 2006, 2321
SmoI CTYRAG 2 cut(s) 2006, 2321
SpeI ACTAGT 1 cut(s) 2095
SseBI AGGCCT 1 cut(s) 1467
SspI AATATT 1 cut(s) 1795
StuI AGGCCT 1 cut(s) 1467
StyI CCWWGG 4 cut(s) 55, 1092, 1474, 3384
TaaI ACNGT 4 cut(s) 112, 1107, 1327, 2293
TaiI ACGT 2 cut(s) 1848, 2455
TatI WGTACW 2 cut(s) 2353, 3355
TauI GCSGC 4 cut(s) 14, 17, 65, 1500
Tru1I TTAA 8 cut(s) 1119, 1388, 1416, 1805, 2139, 2180, 3309, 3424
Tru9I TTAA 8 cut(s) 1119, 1388, 1416, 1805, 2139, 2180, 3309, 3424
TscAI CASTG 1 cut(s) 1332
TseFI GTSAC 2 cut(s) 1334, 2419
Tsp45I GTSAC 2 cut(s) 1334, 2419
TspGWI ACGGA 7 cut(s) 2709, 2790, 2871, 2952, 3033, 3114, 3195
TspMI CCCGGG 2 cut(s) 1017, 1135
TspRI CASTG 1 cut(s) 1332
Van91I CCANNNNNTGG 1 cut(s) 1835
VpaK11BI GGWCC 3 cut(s) 133, 165, 1696
XagI CCTNNNNNAGG 1 cut(s) 914
XapI RAATTY 3 cut(s) 1729, 2507, 3255
XbaI TCTAGA 1 cut(s) 2062
XceI RCATGY 2 cut(s) 455, 1781
XcmI CCANNNNNNNNNTGG 1 cut(s) 1324
XhoI CTCGAG 1 cut(s) 2321
XmaI CCCGGG 2 cut(s) 1017, 1135
XmaJI CCTAGG 1 cut(s) 55
XmiI GTMKAC 1 cut(s) 146
XmnI GAANNNNTTC 2 cut(s) 758, 1087
Zsp2I ATGCAT 2 cut(s) 2055, 2306
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.