Prupe.2G126500_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp02
Physical Location & Seq
Forward (+)
18397220 .. 18398200
981 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.2G126500.1

Sequence Viewer

Length: 339 bp
ATGATCCTCTCATTTGGTCATTTCCATCCATCCGACAGTTTGCTTGTTCACAACACCTCATCATTGATGGCACTTGTGAGAGCATCCGATCCACAAACCTCCTCTGTTTCCAGTATTTGTCGATATTGTCGTTATCACGTGTTCCTGAGTTTCAGAGGCCAAGACACTCGCAAGACTTTCACTGACCACCTCTACACGGCCCTTGTCAATGCTGGATTTCGCACTTTCCGAGACGACGACGAAGTCGAGAGAGGAGAAGCTATCAAGCCCGAACTGCAGAAAGCAATCAAACACTCACGAACTTCTTGTTGTGCGGAAGCGTCAACCAACTGTGAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

113

Amino Acids

12.65

Weight (kDa)

7.0

Isoelectric Point (pI)

27.92

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000036)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G57630 AT1G72930 AT5G38344
fragaria_vesca FvH4_1g27020 FvH4_2g00931 FvH4_2g17330 FvH4_2g17330 FvH4_2g17340 FvH4_2g17350 FvH4_2g20690 FvH4_5g15301 FvH4_5g34194 FvH4_5g38530 FvH4_5g38740 FvH4_5g38740 FvH4_5g38740 FvH4_6g03800 FvH4_7g09791 FvH4_7g09800 FvH4_7g09800 FvH4_7g10510 FvH4_7g10520 FvH4_7g10520 FvH4_7g10750 FvH4_7g10750 FvH4_7g10750 FvH4_7g10750 FvH4_7g10750 FvH4_7g10750 FvH4_7g10750 FvH4_7g10750 FvH4_7g10750 FvH4_7g10750 FvH4_7g10750
malus_domestica MD02G1217100.v1.1 MD02G1217200.v1.1 MD02G1217400.v1.1 MD02G1217600.v1.1 MD02G1264800.v1.1 MD02G1264900.v1.1 MD02G1302100.v1.1 MD04G1010700.v1.1 MD05G1006800.v1.1 MD05G1140100.v1.1 MD05G1140200.v1.1 MD05G1152200.v1.1 MD07G1073500.v1.1 MD07G1101700.v1.1 MD07G1102200.v1.1 MD07G1103200.v1.1 MD07G1112300.v1.1 MD08G1018200.v1.1 MD08G1018400.v1.1 MD08G1018800.v1.1 MD08G1019000.v1.1 MD08G1019100.v1.1 MD08G1019200.v1.1 MD08G1019300.v1.1 MD08G1019400.v1.1 MD08G1019600.v1.1 MD08G1019900.v1.1 MD08G1020000.v1.1 MD08G1020200.v1.1 MD08G1020500.v1.1 MD08G1020700.v1.1 MD08G1020800.v1.1 MD08G1040700.v1.1 MD11G1112400.v1.1 MD12G1068600.v1.1 MD12G1193200.v1.1 MD13G1050600.v1.1 MD15G1374900.v1.1 MD15G1375100.v1.1 MD15G1416500.v1.1 MD17G1072500.v1.1 MD17G1274200.v1.1 MD17G1274900.v1.1
prunus_persica Prupe.2G121000_v2.0.a1 Prupe.2G121000_v2.0.a1 Prupe.2G125800_v2.0.a1 Prupe.2G126000_v2.0.a1 Prupe.2G126100_v2.0.a1 Prupe.2G126200_v2.0.a1 Prupe.2G126300_v2.0.a1 Prupe.2G126400_v2.0.a1 Prupe.2G126500_v2.0.a1 Prupe.2G126600_v2.0.a1 Prupe.2G126700_v2.0.a1 Prupe.2G126700_v2.0.a1 Prupe.2G126800_v2.0.a1 Prupe.2G126900_v2.0.a1 Prupe.2G127000_v2.0.a1 Prupe.2G127000_v2.0.a1 Prupe.2G127000_v2.0.a1 Prupe.2G127000_v2.0.a1 Prupe.2G135500_v2.0.a1 Prupe.2G135600_v2.0.a1 Prupe.2G135700_v2.0.a1 Prupe.2G135700_v2.0.a1 Prupe.3G009800_v2.0.a1 Prupe.3G010200_v2.0.a1 Prupe.3G131000_v2.0.a1 Prupe.4G260800_v2.0.a1 Prupe.4G260900_v2.0.a1 Prupe.6G083100_v2.0.a1 Prupe.6G083200_v2.0.a1 Prupe.6G083400_v2.0.a1 Prupe.6G132100_v2.0.a1 Prupe.8G184900_v2.0.a1 Prupe.8G185200_v2.0.a1 Prupe.8G185300_v2.0.a1
pyrus_communis pycom02g17870 pycom02g17880 pycom02g19520 pycom02g22610 pycom02g22630 pycom02g22680 pycom05g13540 pycom05g14680 pycom07g04880 pycom07g04890 pycom07g05690 pycom07g05710 pycom07g05720 pycom07g05750 pycom07g05780 pycom07g06300 pycom07g08320 pycom07g08330 pycom07g08350 pycom07g08360 pycom07g08370 pycom07g08410 pycom07g08420 pycom07g08430 pycom07g08440 pycom07g08470 pycom07g08480 pycom07g08520 pycom07g08550 pycom07g08560 pycom07g08640 pycom07g08660 pycom07g08670 pycom07g08680 pycom07g08690 pycom07g08720 pycom07g08730 pycom07g08790 pycom07g08800 pycom07g08810 pycom07g08860 pycom07g08890 pycom07g09720 pycom08g01590 pycom08g01600 pycom08g01620 pycom08g01630 pycom08g01640 pycom10g12630 pycom15g16490 pycom17g07200 pycom17g07210 pycom17g07220 pycom17g11730 pycom17g11740 pycom17g27340 pycom17g27380
rosa_chinensis RchiOBHm_Chr1g0342571 RchiOBHm_Chr1g0346231 RchiOBHm_Chr1g0346831 RchiOBHm_Chr1g0346891 RchiOBHm_Chr1g0348311 RchiOBHm_Chr1g0348321 RchiOBHm_Chr1g0348331 RchiOBHm_Chr1g0348361 RchiOBHm_Chr1g0348371 RchiOBHm_Chr1g0348381 RchiOBHm_Chr1g0348401 RchiOBHm_Chr1g0348411 RchiOBHm_Chr1g0348421 RchiOBHm_Chr1g0348431 RchiOBHm_Chr2g0130881 RchiOBHm_Chr3g0487331 RchiOBHm_Chr5g0060371 RchiOBHm_Chr6g0246491 RchiOBHm_Chr6g0246871 RchiOBHm_Chr6g0250311 RchiOBHm_Chr6g0250781 RchiOBHm_Chr6g0251431 RchiOBHm_Chr6g0281871 RchiOBHm_Chr6g0281881 RchiOBHm_Chr6g0281931 RchiOBHm_Chr6g0281941 RchiOBHm_Chr6g0281951 RchiOBHm_Chr6g0281971 RchiOBHm_Chr6g0281981 RchiOBHm_Chr7g0240541 RchiOBHm_Chr7g0240631 RchiOBHm_Chr7g0240671
rosa_laevigata RLG00000000627 RLG00000000631 RLG00000000641 RLG00000000645 RLG00000000652 RLG00000000662 RLG00000000663 RLG00000000667 RLG00000000670 RLG00000000702 RLG00000001216 RLG00000001219 RLG00000007678 RLG00000012923 RLG00000012996 RLG00000013243 RLG00000017513 RLG00000017514 RLG00000020936 RLG00000022755 RLG00000023013 RLG00000028646 RLG00000028654 RLG00000028662 RLG00000028665 RLG00000028667 RLG00000028711 RLG00000028714 RLG00000028716 RLG00000028770 RLG00000028771 RLG00000028773 RLG00000028778 RLG00000028798 RLG00000028809 RLG00000028813 RLG00000029334 RLG00000030003 RLG00000033910 RLG00000034358 RLG00000035430
rosa_multiflora Rmu_co8031134.1_g000001 Rmu_co8092796.1_g000001 Rmu_co8130156.1_g000001 Rmu_co8325323.1_g000001 Rmu_co8424083.1_g000002 Rmu_sc0000008.1_g000003 Rmu_sc0000008.1_g000011 Rmu_sc0000008.1_g000015 Rmu_sc0000008.1_g000020 Rmu_sc0000091.1_g000015 Rmu_sc0000091.1_g000018 Rmu_sc0000091.1_g000029 Rmu_sc0000091.1_g000031 Rmu_sc0000391.1_g000004 Rmu_sc0001070.1_g000030 Rmu_sc0001293.1_g000016 Rmu_sc0001674.1_g000006 Rmu_sc0001731.1_g000002 Rmu_sc0001731.1_g000003 Rmu_sc0001731.1_g000005 Rmu_sc0001911.1_g000029 Rmu_sc0001913.1_g000038 Rmu_sc0001955.1_g000025 Rmu_sc0001992.1_g000022 Rmu_sc0001992.1_g000028 Rmu_sc0001992.1_g000031 Rmu_sc0002517.1_g000013 Rmu_sc0002517.1_g000017 Rmu_sc0002551.1_g000022 Rmu_sc0002551.1_g000029 Rmu_sc0002551.1_g000038 Rmu_sc0002705.1_g000015 Rmu_sc0002705.1_g000016 Rmu_sc0002882.1_g000055 Rmu_sc0003232.1_g000027 Rmu_sc0003363.1_g000037 Rmu_sc0003600.1_g000054 Rmu_sc0003918.1_g000011 Rmu_sc0004395.1_g000011 Rmu_sc0005071.1_g000004 Rmu_sc0005255.1_g000018 Rmu_sc0005327.1_g000004 Rmu_sc0005597.1_g000007 Rmu_sc0007060.1_g000007 Rmu_sc0007310.1_g000003 Rmu_sc0007383.1_g000014 Rmu_sc0007799.1_g000003 Rmu_sc0008477.1_g000016 Rmu_sc0010151.1_g000009 Rmu_sc0011217.1_g000005 Rmu_sc0016269.1_g000006 Rmu_sc0021495.1_g000001 Rmu_sc0027364.1_g000001 Rmu_sc0029432.1_g000001 Rmu_sc0041386.1_g000001 Rmu_ssc0000126.1_g000023 Rmu_ssc0000126.1_g000027
rosa_roxburghii Rroxscaffold_1G00006130 Rroxscaffold_1G00023320 Rroxscaffold_1G00038770 Rroxscaffold_2G00119800 Rroxscaffold_2G00121860 Rroxscaffold_3G00219780 Rroxscaffold_3G00219890 Rroxscaffold_4G00306740 Rroxscaffold_4G00306820 Rroxscaffold_4G00307000 Rroxscaffold_4G00307010 Rroxscaffold_4G00307020 Rroxscaffold_4G00308030 Rroxscaffold_4G00308070 Rroxscaffold_4G00308450 Rroxscaffold_4G00308460 Rroxscaffold_4G00315320 Rroxscaffold_5G00352470 Rroxscaffold_5G00371420 Rroxscaffold_6G00392300 Rroxscaffold_6G00394870 Rroxscaffold_6G00394890 Rroxscaffold_7G00186700 Rroxscaffold_7G00194980 Rroxscaffold_7G00216840
rosa_rugosa Rorug01G0076100 Rorug01G0128100 Rorug01G0149000.1 Rorug01G0149500.1 Rorug01G0180000 Rorug01G0180100 Rorug01G0182900 Rorug01G0184000 Rorug01G0184100 Rorug01G0184300 Rorug01G0184600 Rorug01G0184700 Rorug01G0184700 Rorug01G0184900 Rorug01G0185000 Rorug01G0185100 Rorug01G0189300 Rorug01G0194100 Rorug01G0194100 Rorug01G0194200 Rorug01G0194400 Rorug01G0194400 Rorug01G0194500 Rorug02G0090400 Rorug02G0090400 Rorug03G0233000 Rorug03G0233100 Rorug05G0178600 Rorug05G0178700 Rorug05G0579200 Rorug06G0144100 Rorug06G0144300 Rorug06G0144300 Rorug06G0179300 Rorug06G0208800 Rorug07G0323500 Rorug07G0337000
rosa_samantha Rh1AG046100 Rh1AG201400 Rh1AG201800 Rh1AG202100 Rh1AG202600 Rh1AG211500 Rh1AG211800 Rh1AG212200 Rh1AG212500 Rh1AG212600 Rh1AG214200 Rh1BG168000 Rh1BG168300 Rh1BG168500 Rh1BG177900 Rh1BG178200 Rh1BG178300 Rh1BG178800 Rh1BG178900 Rh1CG080900 Rh1CG183300 Rh1CG186300 Rh1CG186700 Rh1CG187000 Rh1CG187300 Rh1CG193400 Rh1CG195800 Rh1CG196000 Rh1CG196100 Rh1CG196400 Rh1CG196500 Rh1CG196800 Rh1CG198800 Rh1CG442600 Rh1DG086200 Rh1DG155400 Rh1DG156200 Rh1DG194000 Rh1DG194300 Rh1DG194900 Rh1DG197000 Rh1DG198800 Rh1DG199000 Rh1DG199200 Rh1DG202000 Rh1DG203900 Rh1DG207600 Rh1DG207900 Rh1DG208000 Rh1DG208500 Rh1DG208600 Rh1DG208700 Rh3CG339100 Rh5AG106500 Rh5AG264800 Rh5AG265300 Rh5CG302800 Rh5DG277900 Rh6AG257600 Rh6AG257700 Rh6BG260500 Rh6BG260700 Rh6CG259600 Rh6CG259700 Rh6DG252100 Rh7DG126900
rosa_wichuraiana Rw0G005780 Rw0G007540 Rw0G007550 Rw0G007560 Rw0G009390 Rw1G016900 Rw1G016930 Rw1G016940 Rw1G016970 Rw1G017860 Rw1G017890 Rw1G017900 Rw1G017910 Rw1G017920 Rw1G017960 Rw1G017970 Rw1G017980 Rw1G018150 Rw4G000830 Rw5G009290 Rw5G018950 Rw5G024850 Rw5G024870 Rw5G040460 Rw6G022290 Rw7G041020 Rw7G041200 Rw7G041360 Rw7G041450

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 242
AciI CCGC 1 cut(s) 314
AclWI GGATC 1 cut(s) 83
AcvI CACGTG 1 cut(s) 139
AfiI CCNNNNNNNGG 1 cut(s) 196
AflIII ACRYGT 1 cut(s) 138
AluBI AGCT 1 cut(s) 260
AluI AGCT 1 cut(s) 260
Alw26I GTCTC 1 cut(s) 225
AlwI GGATC 1 cut(s) 83
AoxI GGCC 2 cut(s) 157, 198
AspS9I GGNCC 1 cut(s) 199
BbrPI CACGTG 1 cut(s) 139
BccI CCATC 3 cut(s) 33, 37, 61
BceAI ACGGC 1 cut(s) 213
BcoDI GTCTC 1 cut(s) 225
BfmI CTRYAG 1 cut(s) 275
BmgT120I GGNCC 1 cut(s) 199
BmsI GCATC 1 cut(s) 92
BsaAI YACGTR 1 cut(s) 139
Bsc4I CCNNNNNNNGG 1 cut(s) 196
Bse1I ACTGG 1 cut(s) 111
BseGI GGATG 3 cut(s) 25, 29, 83
BseLI CCNNNNNNNGG 1 cut(s) 196
BseMII CTCAG 1 cut(s) 137
BseNI ACTGG 1 cut(s) 111
BseRI GAGGAG 2 cut(s) 91, 267
BshFI GGCC 2 cut(s) 159, 200
BslI CCNNNNNNNGG 1 cut(s) 196
BsmAI GTCTC 1 cut(s) 225
BsmBI CGTCTC 1 cut(s) 225
BsnI GGCC 2 cut(s) 159, 200
Bsp143I GATC 2 cut(s) 3, 88
BspACI CCGC 1 cut(s) 314
BspANI GGCC 2 cut(s) 159, 200
BspCNI CTCAG 1 cut(s) 138
BspMAI CTGCAG 1 cut(s) 279
BspPI GGATC 1 cut(s) 83
BsrI ACTGG 1 cut(s) 111
BssMI GATC 2 cut(s) 3, 88
Bst4CI ACNGT 2 cut(s) 38, 332
BstBAI YACGTR 1 cut(s) 139
BstDEI CTNAG 1 cut(s) 146
BstF5I GGATG 3 cut(s) 25, 29, 83
BstKTI GATC 2 cut(s) 6, 91
BstMAI GTCTC 1 cut(s) 225
BstMBI GATC 2 cut(s) 3, 88
BstMWI GCNNNNNNNGC 1 cut(s) 274
BstSFI CTRYAG 1 cut(s) 275
BsuRI GGCC 2 cut(s) 159, 200
BtsCI GGATG 3 cut(s) 25, 29, 83
BtsIMutI CAGTG 1 cut(s) 180
Cfr13I GGNCC 1 cut(s) 199
CseI GACGC 1 cut(s) 309
CviJI RGCY 4 cut(s) 159, 200, 260, 268
CviKI_1 RGCY 4 cut(s) 159, 200, 260, 268
DdeI CTNAG 1 cut(s) 146
DpnI GATC 2 cut(s) 5, 90
DpnII GATC 2 cut(s) 3, 88
DrdI GACNNNNNNGTC 1 cut(s) 242
DseDI GACNNNNNNGTC 1 cut(s) 242
Eco72I CACGTG 1 cut(s) 139
Esp3I CGTCTC 1 cut(s) 225
FokI GGATG 3 cut(s) 12, 16, 70
HaeIII GGCC 2 cut(s) 159, 200
HgaI GACGC 1 cut(s) 309
HincII GTYRAC 1 cut(s) 324
HindII GTYRAC 1 cut(s) 324
Hpy166II GTNNAC 2 cut(s) 49, 324
Hpy188I TCNGA 4 cut(s) 34, 88, 155, 230
Hpy188III TCNNGA 3 cut(s) 145, 247, 297
Hpy8I GTNNAC 2 cut(s) 49, 324
Hpy99I CGWCG 2 cut(s) 239, 242
HpyCH4III ACNGT 2 cut(s) 38, 332
HpyCH4IV ACGT 1 cut(s) 138
HpyCH4V TGCA 1 cut(s) 277
HpyF10VI GCNNNNNNNGC 1 cut(s) 274
HpyF3I CTNAG 1 cut(s) 146
HpySE526I ACGT 1 cut(s) 138
Kzo9I GATC 2 cut(s) 3, 88
LpnPI CCDG 3 cut(s) 124, 158, 198
LweI GCATC 1 cut(s) 92
MaeII ACGT 1 cut(s) 138
MalI GATC 2 cut(s) 5, 90
MboI GATC 2 cut(s) 3, 88
MmeI TCCRAC 1 cut(s) 57
MnlI CCTC 7 cut(s) 17, 67, 109, 112, 149, 200, 245
MwoI GCNNNNNNNGC 1 cut(s) 274
NdeII GATC 2 cut(s) 3, 88
PcsI WCGNNNNNNNCGW 3 cut(s) 127, 226, 243
PflFI GACNNNGTC 1 cut(s) 242
PmaCI CACGTG 1 cut(s) 139
PmlI CACGTG 1 cut(s) 139
Ppu21I YACGTR 1 cut(s) 139
PspCI CACGTG 1 cut(s) 139
PspPI GGNCC 1 cut(s) 199
PstI CTGCAG 1 cut(s) 279
PsyI GACNNNGTC 1 cut(s) 242
Sau3AI GATC 2 cut(s) 3, 88
Sau96I GGNCC 1 cut(s) 199
SetI ASST 5 cut(s) 59, 101, 141, 192, 262
SfaNI GCATC 1 cut(s) 92
SfcI CTRYAG 1 cut(s) 275
SsiI CCGC 1 cut(s) 314
TaaI ACNGT 2 cut(s) 38, 332
TaiI ACGT 1 cut(s) 141
TaqI TCGA 2 cut(s) 121, 246
TscAI CASTG 1 cut(s) 187
TspRI CASTG 1 cut(s) 187
Tth111I GACNNNGTC 1 cut(s) 242
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.