Rh1CG080900

disease resistance

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
Physical Location & Seq
Reverse (-)
16898165 .. 16898518
354 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG080900.1

Sequence Viewer

Length: 354 bp
ATGGAACCTGAATCTGGAACTAGCACGAGTAAGGTACAAGATCTGATCTCTACTCCTCCATCTCATGTTTTTGACTTGGCATTAATATGCCCCAGGGTAGAGGAAGTTCTTAATAGACTAGACTCCATTATGGAGCAGAGAAGAGATGTCTTGGGTATAGAAGCAAGTGCTGGATACAGTGCATCACAAACAATACCGTCAACTTCTTTGGTCGAAGAGTTTGGTGTGTATGGCAGGGATGATGAGAAGGAGACACTAATGAAATTGTTGCTATCAGACGATCAGAGTGGCAATAAGATAAGTGTGATTCCTGTTGTGGGGATGGGTGGGATTGGAAAGACCACCCTTGCCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

117

Amino Acids

12.57

Weight (kDa)

4.49

Isoelectric Point (pI)

41.86

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000036)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G57630 AT1G72930 AT5G38344
fragaria_vesca FvH4_1g27020 FvH4_2g00931 FvH4_2g17330 FvH4_2g17330 FvH4_2g17340 FvH4_2g17350 FvH4_2g20690 FvH4_5g15301 FvH4_5g34194 FvH4_5g38530 FvH4_5g38740 FvH4_5g38740 FvH4_5g38740 FvH4_6g03800 FvH4_7g09791 FvH4_7g09800 FvH4_7g09800 FvH4_7g10510 FvH4_7g10520 FvH4_7g10520 FvH4_7g10750 FvH4_7g10750 FvH4_7g10750 FvH4_7g10750 FvH4_7g10750 FvH4_7g10750 FvH4_7g10750 FvH4_7g10750 FvH4_7g10750 FvH4_7g10750 FvH4_7g10750
malus_domestica MD02G1217100.v1.1 MD02G1217200.v1.1 MD02G1217400.v1.1 MD02G1217600.v1.1 MD02G1264800.v1.1 MD02G1264900.v1.1 MD02G1302100.v1.1 MD04G1010700.v1.1 MD05G1006800.v1.1 MD05G1140100.v1.1 MD05G1140200.v1.1 MD05G1152200.v1.1 MD07G1073500.v1.1 MD07G1101700.v1.1 MD07G1102200.v1.1 MD07G1103200.v1.1 MD07G1112300.v1.1 MD08G1018200.v1.1 MD08G1018400.v1.1 MD08G1018800.v1.1 MD08G1019000.v1.1 MD08G1019100.v1.1 MD08G1019200.v1.1 MD08G1019300.v1.1 MD08G1019400.v1.1 MD08G1019600.v1.1 MD08G1019900.v1.1 MD08G1020000.v1.1 MD08G1020200.v1.1 MD08G1020500.v1.1 MD08G1020700.v1.1 MD08G1020800.v1.1 MD08G1040700.v1.1 MD11G1112400.v1.1 MD12G1068600.v1.1 MD12G1193200.v1.1 MD13G1050600.v1.1 MD15G1374900.v1.1 MD15G1375100.v1.1 MD15G1416500.v1.1 MD17G1072500.v1.1 MD17G1274200.v1.1 MD17G1274900.v1.1
prunus_persica Prupe.2G121000_v2.0.a1 Prupe.2G121000_v2.0.a1 Prupe.2G125800_v2.0.a1 Prupe.2G126000_v2.0.a1 Prupe.2G126100_v2.0.a1 Prupe.2G126200_v2.0.a1 Prupe.2G126300_v2.0.a1 Prupe.2G126400_v2.0.a1 Prupe.2G126500_v2.0.a1 Prupe.2G126600_v2.0.a1 Prupe.2G126700_v2.0.a1 Prupe.2G126700_v2.0.a1 Prupe.2G126800_v2.0.a1 Prupe.2G126900_v2.0.a1 Prupe.2G127000_v2.0.a1 Prupe.2G127000_v2.0.a1 Prupe.2G127000_v2.0.a1 Prupe.2G127000_v2.0.a1 Prupe.2G135500_v2.0.a1 Prupe.2G135600_v2.0.a1 Prupe.2G135700_v2.0.a1 Prupe.2G135700_v2.0.a1 Prupe.3G009800_v2.0.a1 Prupe.3G010200_v2.0.a1 Prupe.3G131000_v2.0.a1 Prupe.4G260800_v2.0.a1 Prupe.4G260900_v2.0.a1 Prupe.6G083100_v2.0.a1 Prupe.6G083200_v2.0.a1 Prupe.6G083400_v2.0.a1 Prupe.6G132100_v2.0.a1 Prupe.8G184900_v2.0.a1 Prupe.8G185200_v2.0.a1 Prupe.8G185300_v2.0.a1
pyrus_communis pycom02g17870 pycom02g17880 pycom02g19520 pycom02g22610 pycom02g22630 pycom02g22680 pycom05g13540 pycom05g14680 pycom07g04880 pycom07g04890 pycom07g05690 pycom07g05710 pycom07g05720 pycom07g05750 pycom07g05780 pycom07g06300 pycom07g08320 pycom07g08330 pycom07g08350 pycom07g08360 pycom07g08370 pycom07g08410 pycom07g08420 pycom07g08430 pycom07g08440 pycom07g08470 pycom07g08480 pycom07g08520 pycom07g08550 pycom07g08560 pycom07g08640 pycom07g08660 pycom07g08670 pycom07g08680 pycom07g08690 pycom07g08720 pycom07g08730 pycom07g08790 pycom07g08800 pycom07g08810 pycom07g08860 pycom07g08890 pycom07g09720 pycom08g01590 pycom08g01600 pycom08g01620 pycom08g01630 pycom08g01640 pycom10g12630 pycom15g16490 pycom17g07200 pycom17g07210 pycom17g07220 pycom17g11730 pycom17g11740 pycom17g27340 pycom17g27380
rosa_chinensis RchiOBHm_Chr1g0342571 RchiOBHm_Chr1g0346231 RchiOBHm_Chr1g0346831 RchiOBHm_Chr1g0346891 RchiOBHm_Chr1g0348311 RchiOBHm_Chr1g0348321 RchiOBHm_Chr1g0348331 RchiOBHm_Chr1g0348361 RchiOBHm_Chr1g0348371 RchiOBHm_Chr1g0348381 RchiOBHm_Chr1g0348401 RchiOBHm_Chr1g0348411 RchiOBHm_Chr1g0348421 RchiOBHm_Chr1g0348431 RchiOBHm_Chr2g0130881 RchiOBHm_Chr3g0487331 RchiOBHm_Chr5g0060371 RchiOBHm_Chr6g0246491 RchiOBHm_Chr6g0246871 RchiOBHm_Chr6g0250311 RchiOBHm_Chr6g0250781 RchiOBHm_Chr6g0251431 RchiOBHm_Chr6g0281871 RchiOBHm_Chr6g0281881 RchiOBHm_Chr6g0281931 RchiOBHm_Chr6g0281941 RchiOBHm_Chr6g0281951 RchiOBHm_Chr6g0281971 RchiOBHm_Chr6g0281981 RchiOBHm_Chr7g0240541 RchiOBHm_Chr7g0240631 RchiOBHm_Chr7g0240671
rosa_laevigata RLG00000000627 RLG00000000631 RLG00000000641 RLG00000000645 RLG00000000652 RLG00000000662 RLG00000000663 RLG00000000667 RLG00000000670 RLG00000000702 RLG00000001216 RLG00000001219 RLG00000007678 RLG00000012923 RLG00000012996 RLG00000013243 RLG00000017513 RLG00000017514 RLG00000020936 RLG00000022755 RLG00000023013 RLG00000028646 RLG00000028654 RLG00000028662 RLG00000028665 RLG00000028667 RLG00000028711 RLG00000028714 RLG00000028716 RLG00000028770 RLG00000028771 RLG00000028773 RLG00000028778 RLG00000028798 RLG00000028809 RLG00000028813 RLG00000029334 RLG00000030003 RLG00000033910 RLG00000034358 RLG00000035430
rosa_multiflora Rmu_co8031134.1_g000001 Rmu_co8092796.1_g000001 Rmu_co8130156.1_g000001 Rmu_co8325323.1_g000001 Rmu_co8424083.1_g000002 Rmu_sc0000008.1_g000003 Rmu_sc0000008.1_g000011 Rmu_sc0000008.1_g000015 Rmu_sc0000008.1_g000020 Rmu_sc0000091.1_g000015 Rmu_sc0000091.1_g000018 Rmu_sc0000091.1_g000029 Rmu_sc0000091.1_g000031 Rmu_sc0000391.1_g000004 Rmu_sc0001070.1_g000030 Rmu_sc0001293.1_g000016 Rmu_sc0001674.1_g000006 Rmu_sc0001731.1_g000002 Rmu_sc0001731.1_g000003 Rmu_sc0001731.1_g000005 Rmu_sc0001911.1_g000029 Rmu_sc0001913.1_g000038 Rmu_sc0001955.1_g000025 Rmu_sc0001992.1_g000022 Rmu_sc0001992.1_g000028 Rmu_sc0001992.1_g000031 Rmu_sc0002517.1_g000013 Rmu_sc0002517.1_g000017 Rmu_sc0002551.1_g000022 Rmu_sc0002551.1_g000029 Rmu_sc0002551.1_g000038 Rmu_sc0002705.1_g000015 Rmu_sc0002705.1_g000016 Rmu_sc0002882.1_g000055 Rmu_sc0003232.1_g000027 Rmu_sc0003363.1_g000037 Rmu_sc0003600.1_g000054 Rmu_sc0003918.1_g000011 Rmu_sc0004395.1_g000011 Rmu_sc0005071.1_g000004 Rmu_sc0005255.1_g000018 Rmu_sc0005327.1_g000004 Rmu_sc0005597.1_g000007 Rmu_sc0007060.1_g000007 Rmu_sc0007310.1_g000003 Rmu_sc0007383.1_g000014 Rmu_sc0007799.1_g000003 Rmu_sc0008477.1_g000016 Rmu_sc0010151.1_g000009 Rmu_sc0011217.1_g000005 Rmu_sc0016269.1_g000006 Rmu_sc0021495.1_g000001 Rmu_sc0027364.1_g000001 Rmu_sc0029432.1_g000001 Rmu_sc0041386.1_g000001 Rmu_ssc0000126.1_g000023 Rmu_ssc0000126.1_g000027
rosa_roxburghii Rroxscaffold_1G00006130 Rroxscaffold_1G00023320 Rroxscaffold_1G00038770 Rroxscaffold_2G00119800 Rroxscaffold_2G00121860 Rroxscaffold_3G00219780 Rroxscaffold_3G00219890 Rroxscaffold_4G00306740 Rroxscaffold_4G00306820 Rroxscaffold_4G00307000 Rroxscaffold_4G00307010 Rroxscaffold_4G00307020 Rroxscaffold_4G00308030 Rroxscaffold_4G00308070 Rroxscaffold_4G00308450 Rroxscaffold_4G00308460 Rroxscaffold_4G00315320 Rroxscaffold_5G00352470 Rroxscaffold_5G00371420 Rroxscaffold_6G00392300 Rroxscaffold_6G00394870 Rroxscaffold_6G00394890 Rroxscaffold_7G00186700 Rroxscaffold_7G00194980 Rroxscaffold_7G00216840
rosa_rugosa Rorug01G0076100 Rorug01G0128100 Rorug01G0149000.1 Rorug01G0149500.1 Rorug01G0180000 Rorug01G0180100 Rorug01G0182900 Rorug01G0184000 Rorug01G0184100 Rorug01G0184300 Rorug01G0184600 Rorug01G0184700 Rorug01G0184700 Rorug01G0184900 Rorug01G0185000 Rorug01G0185100 Rorug01G0189300 Rorug01G0194100 Rorug01G0194100 Rorug01G0194200 Rorug01G0194400 Rorug01G0194400 Rorug01G0194500 Rorug02G0090400 Rorug02G0090400 Rorug03G0233000 Rorug03G0233100 Rorug05G0178600 Rorug05G0178700 Rorug05G0579200 Rorug06G0144100 Rorug06G0144300 Rorug06G0144300 Rorug06G0179300 Rorug06G0208800 Rorug07G0323500 Rorug07G0337000
rosa_samantha Rh1AG046100 Rh1AG201400 Rh1AG201800 Rh1AG202100 Rh1AG202600 Rh1AG211500 Rh1AG211800 Rh1AG212200 Rh1AG212500 Rh1AG212600 Rh1AG214200 Rh1BG168000 Rh1BG168300 Rh1BG168500 Rh1BG177900 Rh1BG178200 Rh1BG178300 Rh1BG178800 Rh1BG178900 Rh1CG080900 Rh1CG183300 Rh1CG186300 Rh1CG186700 Rh1CG187000 Rh1CG187300 Rh1CG193400 Rh1CG195800 Rh1CG196000 Rh1CG196100 Rh1CG196400 Rh1CG196500 Rh1CG196800 Rh1CG198800 Rh1CG442600 Rh1DG086200 Rh1DG155400 Rh1DG156200 Rh1DG194000 Rh1DG194300 Rh1DG194900 Rh1DG197000 Rh1DG198800 Rh1DG199000 Rh1DG199200 Rh1DG202000 Rh1DG203900 Rh1DG207600 Rh1DG207900 Rh1DG208000 Rh1DG208500 Rh1DG208600 Rh1DG208700 Rh3CG339100 Rh5AG106500 Rh5AG264800 Rh5AG265300 Rh5CG302800 Rh5DG277900 Rh6AG257600 Rh6AG257700 Rh6BG260500 Rh6BG260700 Rh6CG259600 Rh6CG259700 Rh6DG252100 Rh7DG126900
rosa_wichuraiana Rw0G005780 Rw0G007540 Rw0G007550 Rw0G007560 Rw0G009390 Rw1G016900 Rw1G016930 Rw1G016940 Rw1G016970 Rw1G017860 Rw1G017890 Rw1G017900 Rw1G017910 Rw1G017920 Rw1G017960 Rw1G017970 Rw1G017980 Rw1G018150 Rw4G000830 Rw5G009290 Rw5G018950 Rw5G024850 Rw5G024870 Rw5G040460 Rw6G022290 Rw7G041020 Rw7G041200 Rw7G041360 Rw7G041450

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 36
AfiI CCNNNNNNNGG 2 cut(s) 14, 317
AjnI CCWGG 1 cut(s) 92
Alw26I GTCTC 1 cut(s) 245
AseI ATTAAT 1 cut(s) 83
BauI CACGAG 1 cut(s) 25
BccI CCATC 2 cut(s) 67, 316
BciT130I CCWGG 1 cut(s) 94
BciVI GTATCC 1 cut(s) 167
BcoDI GTCTC 1 cut(s) 245
BfaI CTAG 3 cut(s) 21, 119, 352
BfuI GTATCC 1 cut(s) 167
BglII AGATCT 1 cut(s) 40
Bme1390I CCNGG 1 cut(s) 94
BmiI GGNNCC 1 cut(s) 6
BmrFI CCNGG 1 cut(s) 94
BmsI GCATC 1 cut(s) 191
BsaJI CCNNGG 2 cut(s) 92, 93
Bsc4I CCNNNNNNNGG 2 cut(s) 14, 317
BseBI CCWGG 1 cut(s) 94
BseDI CCNNGG 2 cut(s) 92, 93
BseGI GGATG 2 cut(s) 244, 327
BseLI CCNNNNNNNGG 2 cut(s) 14, 317
BseRI GAGGAG 1 cut(s) 45
BslI CCNNNNNNNGG 2 cut(s) 14, 317
BsmAI GTCTC 1 cut(s) 245
Bsp143I GATC 3 cut(s) 40, 45, 280
BspLI GGNNCC 1 cut(s) 6
BssECI CCNNGG 2 cut(s) 92, 93
BssMI GATC 3 cut(s) 40, 45, 280
BssSI CACGAG 1 cut(s) 25
Bst2BI CACGAG 1 cut(s) 25
Bst2UI CCWGG 1 cut(s) 94
Bst4CI ACNGT 2 cut(s) 179, 198
Bst6I CTCTTC 2 cut(s) 136, 210
BstF5I GGATG 2 cut(s) 244, 327
BstKTI GATC 3 cut(s) 43, 48, 283
BstMAI GTCTC 1 cut(s) 245
BstMBI GATC 3 cut(s) 40, 45, 280
BstNI CCWGG 1 cut(s) 94
BstSCI CCNGG 1 cut(s) 92
BstX2I RGATCY 1 cut(s) 40
BstYI RGATCY 1 cut(s) 40
BsuI GTATCC 1 cut(s) 167
BtsCI GGATG 2 cut(s) 244, 327
BtsIMutI CAGTG 1 cut(s) 184
Csp6I GTAC 1 cut(s) 35
CviAII CATG 1 cut(s) 65
CviQI GTAC 1 cut(s) 35
DpnI GATC 3 cut(s) 42, 47, 282
DpnII GATC 3 cut(s) 40, 45, 280
Eam1104I CTCTTC 2 cut(s) 136, 210
EarI CTCTTC 2 cut(s) 136, 210
EcoRII CCWGG 1 cut(s) 92
FaeI CATG 1 cut(s) 68
FaiI YATR 5 cut(s) 66, 88, 131, 158, 231
FatI CATG 1 cut(s) 64
FokI GGATG 2 cut(s) 251, 334
FspBI CTAG 3 cut(s) 21, 119, 352
Hin1II CATG 1 cut(s) 68
HincII GTYRAC 1 cut(s) 201
HindII GTYRAC 1 cut(s) 201
HinfI GANTC 3 cut(s) 11, 122, 307
Hpy166II GTNNAC 1 cut(s) 201
Hpy188I TCNGA 3 cut(s) 45, 277, 285
Hpy188III TCNNGA 1 cut(s) 15
Hpy8I GTNNAC 1 cut(s) 201
HpyAV CCTTC 1 cut(s) 241
HpyCH4III ACNGT 2 cut(s) 179, 198
HpyCH4V TGCA 1 cut(s) 182
Hsp92II CATG 1 cut(s) 68
Kzo9I GATC 3 cut(s) 40, 45, 280
LmnI GCTCC 1 cut(s) 133
LpnPI CCDG 6 cut(s) 21, 79, 106, 156, 220, 324
LweI GCATC 1 cut(s) 191
MaeI CTAG 3 cut(s) 21, 119, 352
MalI GATC 3 cut(s) 42, 47, 282
MboI GATC 3 cut(s) 40, 45, 280
MboII GAAGA 2 cut(s) 153, 227
MflI RGATCY 1 cut(s) 40
MluCI AATT 1 cut(s) 263
MlyI GAGTC 1 cut(s) 116
MnlI CCTC 2 cut(s) 66, 94
MseI TTAA 2 cut(s) 83, 111
MslI CAYNNNNRTG 1 cut(s) 85
MspR9I CCNGG 1 cut(s) 94
MvaI CCWGG 1 cut(s) 94
NdeII GATC 3 cut(s) 40, 45, 280
NlaIII CATG 1 cut(s) 68
NlaIV GGNNCC 1 cut(s) 6
PasI CCCWGGG 1 cut(s) 93
PfeI GAWTC 2 cut(s) 11, 307
PleI GAGTC 1 cut(s) 116
PpsI GAGTC 1 cut(s) 116
PshBI ATTAAT 1 cut(s) 83
Psp6I CCWGG 1 cut(s) 92
PspGI CCWGG 1 cut(s) 92
PspN4I GGNNCC 1 cut(s) 6
PsrI GAACNNNNNNTAC 2 cut(s) 90, 122
PsuI RGATCY 1 cut(s) 40
RsaI GTAC 1 cut(s) 36
RsaNI GTAC 1 cut(s) 35
RseI CAYNNNNRTG 1 cut(s) 85
SaqAI TTAA 2 cut(s) 83, 111
Sau3AI GATC 3 cut(s) 40, 45, 280
SchI GAGTC 1 cut(s) 116
ScrFI CCNGG 1 cut(s) 94
SetI ASST 2 cut(s) 10, 36
SfaNI GCATC 1 cut(s) 191
SmiMI CAYNNNNRTG 1 cut(s) 85
Sse9I AATT 1 cut(s) 263
SspMI CTAG 3 cut(s) 21, 119, 352
StyD4I CCNGG 1 cut(s) 92
TaaI ACNGT 2 cut(s) 179, 198
TaqI TCGA 1 cut(s) 213
TasI AATT 1 cut(s) 263
TfiI GAWTC 2 cut(s) 11, 307
Tru1I TTAA 2 cut(s) 83, 111
Tru9I TTAA 2 cut(s) 83, 111
TscAI CASTG 1 cut(s) 184
TspDTI ATGAA 1 cut(s) 275
TspRI CASTG 1 cut(s) 184
VspI ATTAAT 1 cut(s) 83
XspI CTAG 3 cut(s) 21, 119, 352
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.