Rmu_sc0000008.1_g000003

TMV resistance protein N-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000008.1
Physical Location & Seq
Forward (+)
7462 .. 8319
858 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000008.1_g000003.1.cds

Sequence Viewer

Length: 654 bp
atggaccgacatgctacggcattccaagtgacaaaaaaagatgtgatatggttgagccattggaagtttggggttcaacaattcgaagggggcgatgaagtggctatttcagtgtttacaatacgtgggattgaggtaaaagaatggggaattcagattgtgcatgaggaagaagatagcatgagtagccaacacaacaccagtagagatccttgttatgatccagaacacgataatgaggtgattggtaatattggtggagaattgtcagatttatatgaggtcatgccaggaatatactttctctacggtggaccttttttgttggatcacagatatacttacaataattggaaaacacaaggttattacaatgacttcattgaagactctgataaagaatctgcagaagggaagcagggggacgggatgcttgcatcaacagaagaagctgaagcagaaacaggcatcaataccttctgcgattctagttattcaaatgttgatgtcattggtggagatttgtcagaatatagggtgatgctgagaagaatacttcctctgcattcaatgacatcctttgagactgacaggtccgctattactgataagttagcattagcattgcaagtttctgcagaggggcagctataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

217

Amino Acids

24.5

Weight (kDa)

4.43

Isoelectric Point (pI)

40.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000036)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G57630 AT1G72930 AT5G38344
fragaria_vesca FvH4_1g27020 FvH4_2g00931 FvH4_2g17330 FvH4_2g17330 FvH4_2g17340 FvH4_2g17350 FvH4_2g20690 FvH4_5g15301 FvH4_5g34194 FvH4_5g38530 FvH4_5g38740 FvH4_5g38740 FvH4_5g38740 FvH4_6g03800 FvH4_7g09791 FvH4_7g09800 FvH4_7g09800 FvH4_7g10510 FvH4_7g10520 FvH4_7g10520 FvH4_7g10750 FvH4_7g10750 FvH4_7g10750 FvH4_7g10750 FvH4_7g10750 FvH4_7g10750 FvH4_7g10750 FvH4_7g10750 FvH4_7g10750 FvH4_7g10750 FvH4_7g10750
malus_domestica MD02G1217100.v1.1 MD02G1217200.v1.1 MD02G1217400.v1.1 MD02G1217600.v1.1 MD02G1264800.v1.1 MD02G1264900.v1.1 MD02G1302100.v1.1 MD04G1010700.v1.1 MD05G1006800.v1.1 MD05G1140100.v1.1 MD05G1140200.v1.1 MD05G1152200.v1.1 MD07G1073500.v1.1 MD07G1101700.v1.1 MD07G1102200.v1.1 MD07G1103200.v1.1 MD07G1112300.v1.1 MD08G1018200.v1.1 MD08G1018400.v1.1 MD08G1018800.v1.1 MD08G1019000.v1.1 MD08G1019100.v1.1 MD08G1019200.v1.1 MD08G1019300.v1.1 MD08G1019400.v1.1 MD08G1019600.v1.1 MD08G1019900.v1.1 MD08G1020000.v1.1 MD08G1020200.v1.1 MD08G1020500.v1.1 MD08G1020700.v1.1 MD08G1020800.v1.1 MD08G1040700.v1.1 MD11G1112400.v1.1 MD12G1068600.v1.1 MD12G1193200.v1.1 MD13G1050600.v1.1 MD15G1374900.v1.1 MD15G1375100.v1.1 MD15G1416500.v1.1 MD17G1072500.v1.1 MD17G1274200.v1.1 MD17G1274900.v1.1
prunus_persica Prupe.2G121000_v2.0.a1 Prupe.2G121000_v2.0.a1 Prupe.2G125800_v2.0.a1 Prupe.2G126000_v2.0.a1 Prupe.2G126100_v2.0.a1 Prupe.2G126200_v2.0.a1 Prupe.2G126300_v2.0.a1 Prupe.2G126400_v2.0.a1 Prupe.2G126500_v2.0.a1 Prupe.2G126600_v2.0.a1 Prupe.2G126700_v2.0.a1 Prupe.2G126700_v2.0.a1 Prupe.2G126800_v2.0.a1 Prupe.2G126900_v2.0.a1 Prupe.2G127000_v2.0.a1 Prupe.2G127000_v2.0.a1 Prupe.2G127000_v2.0.a1 Prupe.2G127000_v2.0.a1 Prupe.2G135500_v2.0.a1 Prupe.2G135600_v2.0.a1 Prupe.2G135700_v2.0.a1 Prupe.2G135700_v2.0.a1 Prupe.3G009800_v2.0.a1 Prupe.3G010200_v2.0.a1 Prupe.3G131000_v2.0.a1 Prupe.4G260800_v2.0.a1 Prupe.4G260900_v2.0.a1 Prupe.6G083100_v2.0.a1 Prupe.6G083200_v2.0.a1 Prupe.6G083400_v2.0.a1 Prupe.6G132100_v2.0.a1 Prupe.8G184900_v2.0.a1 Prupe.8G185200_v2.0.a1 Prupe.8G185300_v2.0.a1
pyrus_communis pycom02g17870 pycom02g17880 pycom02g19520 pycom02g22610 pycom02g22630 pycom02g22680 pycom05g13540 pycom05g14680 pycom07g04880 pycom07g04890 pycom07g05690 pycom07g05710 pycom07g05720 pycom07g05750 pycom07g05780 pycom07g06300 pycom07g08320 pycom07g08330 pycom07g08350 pycom07g08360 pycom07g08370 pycom07g08410 pycom07g08420 pycom07g08430 pycom07g08440 pycom07g08470 pycom07g08480 pycom07g08520 pycom07g08550 pycom07g08560 pycom07g08640 pycom07g08660 pycom07g08670 pycom07g08680 pycom07g08690 pycom07g08720 pycom07g08730 pycom07g08790 pycom07g08800 pycom07g08810 pycom07g08860 pycom07g08890 pycom07g09720 pycom08g01590 pycom08g01600 pycom08g01620 pycom08g01630 pycom08g01640 pycom10g12630 pycom15g16490 pycom17g07200 pycom17g07210 pycom17g07220 pycom17g11730 pycom17g11740 pycom17g27340 pycom17g27380
rosa_chinensis RchiOBHm_Chr1g0342571 RchiOBHm_Chr1g0346231 RchiOBHm_Chr1g0346831 RchiOBHm_Chr1g0346891 RchiOBHm_Chr1g0348311 RchiOBHm_Chr1g0348321 RchiOBHm_Chr1g0348331 RchiOBHm_Chr1g0348361 RchiOBHm_Chr1g0348371 RchiOBHm_Chr1g0348381 RchiOBHm_Chr1g0348401 RchiOBHm_Chr1g0348411 RchiOBHm_Chr1g0348421 RchiOBHm_Chr1g0348431 RchiOBHm_Chr2g0130881 RchiOBHm_Chr3g0487331 RchiOBHm_Chr5g0060371 RchiOBHm_Chr6g0246491 RchiOBHm_Chr6g0246871 RchiOBHm_Chr6g0250311 RchiOBHm_Chr6g0250781 RchiOBHm_Chr6g0251431 RchiOBHm_Chr6g0281871 RchiOBHm_Chr6g0281881 RchiOBHm_Chr6g0281931 RchiOBHm_Chr6g0281941 RchiOBHm_Chr6g0281951 RchiOBHm_Chr6g0281971 RchiOBHm_Chr6g0281981 RchiOBHm_Chr7g0240541 RchiOBHm_Chr7g0240631 RchiOBHm_Chr7g0240671
rosa_laevigata RLG00000000627 RLG00000000631 RLG00000000641 RLG00000000645 RLG00000000652 RLG00000000662 RLG00000000663 RLG00000000667 RLG00000000670 RLG00000000702 RLG00000001216 RLG00000001219 RLG00000007678 RLG00000012923 RLG00000012996 RLG00000013243 RLG00000017513 RLG00000017514 RLG00000020936 RLG00000022755 RLG00000023013 RLG00000028646 RLG00000028654 RLG00000028662 RLG00000028665 RLG00000028667 RLG00000028711 RLG00000028714 RLG00000028716 RLG00000028770 RLG00000028771 RLG00000028773 RLG00000028778 RLG00000028798 RLG00000028809 RLG00000028813 RLG00000029334 RLG00000030003 RLG00000033910 RLG00000034358 RLG00000035430
rosa_multiflora Rmu_co8031134.1_g000001 Rmu_co8092796.1_g000001 Rmu_co8130156.1_g000001 Rmu_co8325323.1_g000001 Rmu_co8424083.1_g000002 Rmu_sc0000008.1_g000003 Rmu_sc0000008.1_g000011 Rmu_sc0000008.1_g000015 Rmu_sc0000008.1_g000020 Rmu_sc0000091.1_g000015 Rmu_sc0000091.1_g000018 Rmu_sc0000091.1_g000029 Rmu_sc0000091.1_g000031 Rmu_sc0000391.1_g000004 Rmu_sc0001070.1_g000030 Rmu_sc0001293.1_g000016 Rmu_sc0001674.1_g000006 Rmu_sc0001731.1_g000002 Rmu_sc0001731.1_g000003 Rmu_sc0001731.1_g000005 Rmu_sc0001911.1_g000029 Rmu_sc0001913.1_g000038 Rmu_sc0001955.1_g000025 Rmu_sc0001992.1_g000022 Rmu_sc0001992.1_g000028 Rmu_sc0001992.1_g000031 Rmu_sc0002517.1_g000013 Rmu_sc0002517.1_g000017 Rmu_sc0002551.1_g000022 Rmu_sc0002551.1_g000029 Rmu_sc0002551.1_g000038 Rmu_sc0002705.1_g000015 Rmu_sc0002705.1_g000016 Rmu_sc0002882.1_g000055 Rmu_sc0003232.1_g000027 Rmu_sc0003363.1_g000037 Rmu_sc0003600.1_g000054 Rmu_sc0003918.1_g000011 Rmu_sc0004395.1_g000011 Rmu_sc0005071.1_g000004 Rmu_sc0005255.1_g000018 Rmu_sc0005327.1_g000004 Rmu_sc0005597.1_g000007 Rmu_sc0007060.1_g000007 Rmu_sc0007310.1_g000003 Rmu_sc0007383.1_g000014 Rmu_sc0007799.1_g000003 Rmu_sc0008477.1_g000016 Rmu_sc0010151.1_g000009 Rmu_sc0011217.1_g000005 Rmu_sc0016269.1_g000006 Rmu_sc0021495.1_g000001 Rmu_sc0027364.1_g000001 Rmu_sc0029432.1_g000001 Rmu_sc0041386.1_g000001 Rmu_ssc0000126.1_g000023 Rmu_ssc0000126.1_g000027
rosa_roxburghii Rroxscaffold_1G00006130 Rroxscaffold_1G00023320 Rroxscaffold_1G00038770 Rroxscaffold_2G00119800 Rroxscaffold_2G00121860 Rroxscaffold_3G00219780 Rroxscaffold_3G00219890 Rroxscaffold_4G00306740 Rroxscaffold_4G00306820 Rroxscaffold_4G00307000 Rroxscaffold_4G00307010 Rroxscaffold_4G00307020 Rroxscaffold_4G00308030 Rroxscaffold_4G00308070 Rroxscaffold_4G00308450 Rroxscaffold_4G00308460 Rroxscaffold_4G00315320 Rroxscaffold_5G00352470 Rroxscaffold_5G00371420 Rroxscaffold_6G00392300 Rroxscaffold_6G00394870 Rroxscaffold_6G00394890 Rroxscaffold_7G00186700 Rroxscaffold_7G00194980 Rroxscaffold_7G00216840
rosa_rugosa Rorug01G0076100 Rorug01G0128100 Rorug01G0149000.1 Rorug01G0149500.1 Rorug01G0180000 Rorug01G0180100 Rorug01G0182900 Rorug01G0184000 Rorug01G0184100 Rorug01G0184300 Rorug01G0184600 Rorug01G0184700 Rorug01G0184700 Rorug01G0184900 Rorug01G0185000 Rorug01G0185100 Rorug01G0189300 Rorug01G0194100 Rorug01G0194100 Rorug01G0194200 Rorug01G0194400 Rorug01G0194400 Rorug01G0194500 Rorug02G0090400 Rorug02G0090400 Rorug03G0233000 Rorug03G0233100 Rorug05G0178600 Rorug05G0178700 Rorug05G0579200 Rorug06G0144100 Rorug06G0144300 Rorug06G0144300 Rorug06G0179300 Rorug06G0208800 Rorug07G0323500 Rorug07G0337000
rosa_samantha Rh1AG046100 Rh1AG201400 Rh1AG201800 Rh1AG202100 Rh1AG202600 Rh1AG211500 Rh1AG211800 Rh1AG212200 Rh1AG212500 Rh1AG212600 Rh1AG214200 Rh1BG168000 Rh1BG168300 Rh1BG168500 Rh1BG177900 Rh1BG178200 Rh1BG178300 Rh1BG178800 Rh1BG178900 Rh1CG080900 Rh1CG183300 Rh1CG186300 Rh1CG186700 Rh1CG187000 Rh1CG187300 Rh1CG193400 Rh1CG195800 Rh1CG196000 Rh1CG196100 Rh1CG196400 Rh1CG196500 Rh1CG196800 Rh1CG198800 Rh1CG442600 Rh1DG086200 Rh1DG155400 Rh1DG156200 Rh1DG194000 Rh1DG194300 Rh1DG194900 Rh1DG197000 Rh1DG198800 Rh1DG199000 Rh1DG199200 Rh1DG202000 Rh1DG203900 Rh1DG207600 Rh1DG207900 Rh1DG208000 Rh1DG208500 Rh1DG208600 Rh1DG208700 Rh3CG339100 Rh5AG106500 Rh5AG264800 Rh5AG265300 Rh5CG302800 Rh5DG277900 Rh6AG257600 Rh6AG257700 Rh6BG260500 Rh6BG260700 Rh6CG259600 Rh6CG259700 Rh6DG252100 Rh7DG126900
rosa_wichuraiana Rw0G005780 Rw0G007540 Rw0G007550 Rw0G007560 Rw0G009390 Rw1G016900 Rw1G016930 Rw1G016940 Rw1G016970 Rw1G017860 Rw1G017890 Rw1G017900 Rw1G017910 Rw1G017920 Rw1G017960 Rw1G017970 Rw1G017980 Rw1G018150 Rw4G000830 Rw5G009290 Rw5G018950 Rw5G024850 Rw5G024870 Rw5G040460 Rw6G022290 Rw7G041020 Rw7G041200 Rw7G041360 Rw7G041450

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 592
AciI CCGC 1 cut(s) 597
AclWI GGATC 3 cut(s) 203, 215, 336
AcsI RAATTY 1 cut(s) 150
AcuI CTGAAG 1 cut(s) 474
AgsI TTSAA 4 cut(s) 77, 386, 498, 570
AjnI CCWGG 1 cut(s) 289
AluBI AGCT 2 cut(s) 452, 649
AluI AGCT 2 cut(s) 452, 649
Alw26I GTCTC 1 cut(s) 578
AlwI GGATC 3 cut(s) 203, 215, 336
ApeKI GCWGC 1 cut(s) 646
ApoI RAATTY 1 cut(s) 150
AspS9I GGNCC 3 cut(s) 4, 314, 594
AsuHPI GGTGA 2 cut(s) 253, 550
AsuII TTCGAA 1 cut(s) 84
AvaII GGWCC 3 cut(s) 4, 314, 594
BbsI GAAGAC 1 cut(s) 393
BceAI ACGGC 1 cut(s) 33
BciT130I CCWGG 1 cut(s) 291
BcoDI GTCTC 1 cut(s) 578
BfaI CTAG 1 cut(s) 489
BfmI CTRYAG 2 cut(s) 405, 636
BisI GCNGC 1 cut(s) 647
BlsI GCNGC 1 cut(s) 648
Bme1390I CCNGG 1 cut(s) 291
Bme18I GGWCC 3 cut(s) 4, 314, 594
BmgT120I GGNCC 3 cut(s) 4, 314, 594
BmrFI CCNGG 1 cut(s) 291
BmsI GCATC 4 cut(s) 420, 446, 477, 531
BpiI GAAGAC 1 cut(s) 393
Bpu14I TTCGAA 1 cut(s) 84
BsaAI YACGTR 1 cut(s) 125
Bse1I ACTGG 1 cut(s) 201
Bse3DI GCAATG 1 cut(s) 623
BseBI CCWGG 1 cut(s) 291
BseGI GGATG 2 cut(s) 435, 575
BseMI GCAATG 1 cut(s) 623
BseMII CTCAG 1 cut(s) 536
BseNI ACTGG 1 cut(s) 201
BslFI GGGAC 1 cut(s) 437
BsmAI GTCTC 1 cut(s) 578
BsmFI GGGAC 1 cut(s) 437
BsmI GAATGC 2 cut(s) 20, 565
Bsp119I TTCGAA 1 cut(s) 84
Bsp143I GATC 3 cut(s) 208, 220, 328
BspACI CCGC 1 cut(s) 597
BspCNI CTCAG 1 cut(s) 537
BspMAI CTGCAG 2 cut(s) 409, 640
BspPI GGATC 3 cut(s) 203, 215, 336
BspT104I TTCGAA 1 cut(s) 84
BsrDI GCAATG 1 cut(s) 623
BsrI ACTGG 1 cut(s) 201
BssMI GATC 3 cut(s) 208, 220, 328
Bst2UI CCWGG 1 cut(s) 291
Bst4CI ACNGT 1 cut(s) 311
BstBAI YACGTR 1 cut(s) 125
BstBI TTCGAA 1 cut(s) 84
BstC8I GCNNGC 1 cut(s) 435
BstDEI CTNAG 1 cut(s) 545
BstF5I GGATG 2 cut(s) 435, 575
BstKTI GATC 3 cut(s) 211, 223, 331
BstMAI GTCTC 1 cut(s) 578
BstMBI GATC 3 cut(s) 208, 220, 328
BstMWI GCNNNNNNNGC 1 cut(s) 186
BstNI CCWGG 1 cut(s) 291
BstNSI RCATGY 1 cut(s) 14
BstSCI CCNGG 1 cut(s) 289
BstSFI CTRYAG 2 cut(s) 405, 636
BstV2I GAAGAC 1 cut(s) 393
BstX2I RGATCY 1 cut(s) 208
BstYI RGATCY 1 cut(s) 208
BtgZI GCGATG 1 cut(s) 108
BtsCI GGATG 2 cut(s) 435, 575
BtsIMutI CAGTG 1 cut(s) 117
Cac8I GCNNGC 1 cut(s) 435
Cfr13I GGNCC 3 cut(s) 4, 314, 594
CviAII CATG 4 cut(s) 11, 164, 181, 286
CviJI RGCY 5 cut(s) 57, 104, 189, 452, 649
CviKI_1 RGCY 5 cut(s) 57, 104, 189, 452, 649
DdeI CTNAG 1 cut(s) 545
DpnI GATC 3 cut(s) 210, 222, 330
DpnII GATC 3 cut(s) 208, 220, 328
DrdI GACNNNNNNGTC 1 cut(s) 592
DseDI GACNNNNNNGTC 1 cut(s) 592
Eco47I GGWCC 3 cut(s) 4, 314, 594
Eco57I CTGAAG 1 cut(s) 474
EcoRI GAATTC 1 cut(s) 150
EcoRII CCWGG 1 cut(s) 289
FaeI CATG 4 cut(s) 14, 167, 184, 289
FaqI GGGAC 1 cut(s) 437
FatI CATG 4 cut(s) 10, 163, 180, 285
Fnu4HI GCNGC 1 cut(s) 647
FokI GGATG 2 cut(s) 442, 562
Fsp4HI GCNGC 1 cut(s) 647
FspBI CTAG 1 cut(s) 489
GluI GCNGC 1 cut(s) 647
Hin1II CATG 4 cut(s) 14, 167, 184, 289
HinfI GANTC 3 cut(s) 389, 401, 485
HphI GGTGA 2 cut(s) 253, 550
Hpy166II GTNNAC 2 cut(s) 117, 314
Hpy188I TCNGA 4 cut(s) 156, 271, 394, 529
Hpy188III TCNNGA 1 cut(s) 224
Hpy8I GTNNAC 2 cut(s) 117, 314
HpyAV CCTTC 3 cut(s) 80, 404, 487
HpyCH4III ACNGT 1 cut(s) 311
HpyCH4IV ACGT 1 cut(s) 124
HpyCH4V TGCA 6 cut(s) 163, 407, 437, 565, 628, 638
HpyF10VI GCNNNNNNNGC 1 cut(s) 186
HpyF3I CTNAG 1 cut(s) 545
HpySE526I ACGT 1 cut(s) 124
Hsp92II CATG 4 cut(s) 14, 167, 184, 289
Kzo9I GATC 3 cut(s) 208, 220, 328
LpnPI CCDG 7 cut(s) 214, 237, 276, 303, 404, 450, 577
LweI GCATC 4 cut(s) 420, 446, 477, 531
MaeI CTAG 1 cut(s) 489
MaeII ACGT 1 cut(s) 124
MaeIII GTNAC 1 cut(s) 28
MalI GATC 3 cut(s) 210, 222, 330
MboI GATC 3 cut(s) 208, 220, 328
MboII GAAGA 5 cut(s) 182, 185, 398, 458, 561
MflI RGATCY 1 cut(s) 208
MluCI AATT 4 cut(s) 80, 150, 263, 349
MlyI GAGTC 1 cut(s) 383
MmeI TCCRAC 1 cut(s) 306
MnlI CCTC 6 cut(s) 127, 160, 232, 274, 570, 634
MslI CAYNNNNRTG 1 cut(s) 234
MspR9I CCNGG 1 cut(s) 291
Mva1269I GAATGC 2 cut(s) 20, 565
MvaI CCWGG 1 cut(s) 291
MwoI GCNNNNNNNGC 1 cut(s) 186
NdeII GATC 3 cut(s) 208, 220, 328
NlaIII CATG 4 cut(s) 14, 167, 184, 289
NmuCI GTSAC 1 cut(s) 28
NspI RCATGY 1 cut(s) 14
NspV TTCGAA 1 cut(s) 84
PcsI WCGNNNNNNNCGW 1 cut(s) 90
PctI GAATGC 2 cut(s) 20, 565
PfeI GAWTC 2 cut(s) 401, 485
PkrI GCNGC 1 cut(s) 648
PleI GAGTC 1 cut(s) 383
PpsI GAGTC 1 cut(s) 383
Ppu21I YACGTR 1 cut(s) 125
Psp6I CCWGG 1 cut(s) 289
PspGI CCWGG 1 cut(s) 289
PspPI GGNCC 3 cut(s) 4, 314, 594
PstI CTGCAG 2 cut(s) 409, 640
PsuI RGATCY 1 cut(s) 208
RseI CAYNNNNRTG 1 cut(s) 234
SatI GCNGC 1 cut(s) 647
Sau3AI GATC 3 cut(s) 208, 220, 328
Sau96I GGNCC 3 cut(s) 4, 314, 594
SchI GAGTC 1 cut(s) 383
ScrFI CCNGG 1 cut(s) 291
SfaNI GCATC 4 cut(s) 420, 446, 477, 531
SfcI CTRYAG 2 cut(s) 405, 636
SfuI TTCGAA 1 cut(s) 84
SinI GGWCC 3 cut(s) 4, 314, 594
SmiMI CAYNNNNRTG 1 cut(s) 234
Sse9I AATT 4 cut(s) 80, 150, 263, 349
SsiI CCGC 1 cut(s) 597
SspI AATATT 1 cut(s) 253
SspMI CTAG 1 cut(s) 489
StyD4I CCNGG 1 cut(s) 289
TaaI ACNGT 1 cut(s) 311
TaiI ACGT 1 cut(s) 127
TaqI TCGA 1 cut(s) 84
TaqII GACCGA 1 cut(s) 21
TasI AATT 4 cut(s) 80, 150, 263, 349
TfiI GAWTC 2 cut(s) 401, 485
TscAI CASTG 1 cut(s) 117
TseFI GTSAC 1 cut(s) 28
TseI GCWGC 1 cut(s) 646
Tsp45I GTSAC 1 cut(s) 28
TspDTI ATGAA 2 cut(s) 111, 370
TspRI CASTG 1 cut(s) 117
VpaK11BI GGWCC 3 cut(s) 4, 314, 594
XapI RAATTY 1 cut(s) 150
XceI RCATGY 1 cut(s) 14
XcmI CCANNNNNNNNNTGG 1 cut(s) 65
XspI CTAG 1 cut(s) 489
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.