Rroxscaffold_5G00350620

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
OG0000124
Physical Location & Seq
Reverse (-)
24904760 .. 24905469
710 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00350620.1

Sequence Viewer

Length: 216 bp
ATGGTGGAAAGGAGTAAGCGTTCGAAGATGGCAAGTGTTGTGTGGATGAGGGCCATTGAGGTCACCGGATATGCCATTGGGAAGGCGGTGAAAGCGTGTCCGCCACTCAAGCAACACGATGCACCACCGGCAAAAGCGACGAGAAAAAATAAGGGTGAAGTTGCACATTCATATAAGACTATCGCATCTCCACATGCACGTGCCCTTTTCACTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

71

Amino Acids

7.78

Weight (kDa)

10.41

Isoelectric Point (pI)

67.72

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000124)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g10992 FvH4_2g25150 FvH4_2g27910 FvH4_2g27931 FvH4_4g09443 FvH4_4g09490 FvH4_4g15990 FvH4_4g15991 FvH4_6g07180 FvH4_6g40320 FvH4_7g10222 FvH4_7g10251
rosa_chinensis RchiOBHm_Chr2g0155611
rosa_laevigata RLG00000009253 RLG00000009254 RLG00000011848 RLG00000017301 RLG00000017302 RLG00000034909
rosa_multiflora Rmu_co8063658.1_g000001 Rmu_co8240443.1_g000001 Rmu_co8264451.1_g000001 Rmu_co8381937.1_g000001 Rmu_co8419903.1_g000001 Rmu_co8513405.1_g000002 Rmu_co8522915.1_g000001 Rmu_co8522915.1_g000004 Rmu_sc0000279.1_g000024 Rmu_sc0000279.1_g000048 Rmu_sc0000642.1_g000017 Rmu_sc0002045.1_g000015 Rmu_sc0002045.1_g000018 Rmu_sc0002045.1_g000023 Rmu_sc0002045.1_g000028 Rmu_sc0003047.1_g000008 Rmu_sc0003179.1_g000019 Rmu_sc0003179.1_g000020 Rmu_sc0003179.1_g000022 Rmu_sc0003179.1_g000023 Rmu_sc0003422.1_g000011 Rmu_sc0004999.1_g000014 Rmu_sc0005712.1_g000018 Rmu_sc0005712.1_g000023 Rmu_sc0006198.1_g000019 Rmu_sc0006373.1_g000005 Rmu_sc0006514.1_g000028 Rmu_sc0006514.1_g000031 Rmu_sc0007367.1_g000010 Rmu_sc0011475.1_g000002 Rmu_sc0025304.1_g000001 Rmu_ssc0000161.1_g000030 Rmu_ssc0000161.1_g000032 Rmu_ssc0000387.1_g000018
rosa_roxburghii Rroxscaffold_1G00031090 Rroxscaffold_1G00032770 Rroxscaffold_1G00068950 Rroxscaffold_1G00069000 Rroxscaffold_1G00069010 Rroxscaffold_2G00129060 Rroxscaffold_2G00129100 Rroxscaffold_4G00309310 Rroxscaffold_4G00309320 Rroxscaffold_5G00350620 Rroxscaffold_5G00350630 Rroxscaffold_7G00162650 Rroxscaffold_7G00162660 Rroxscaffold_7G00162710
rosa_rugosa Rorug02G0564700 Rorug02G0564700 Rorug03G0343100 Rorug04G0189700 Rorug05G0102800 Rorug05G0102900 Rorug05G0103000 Rorug05G0106500 Rorug05G0106600 Rorug05G0106700 Rorug05G0252800 Rorug07G0182100 Rorug07G0283500 Rorug07G0283600
rosa_samantha Rh1AG004000 Rh1AG004100 Rh1AG004200 Rh1AG004400 Rh1AG004500 Rh1AG004600 Rh1AG004800 Rh1AG004900 Rh1AG005300 Rh1AG007000 Rh1AG115000 Rh1CG049400 Rh1CG055400 Rh1CG111000 Rh1DG053600 Rh1DG053700 Rh1DG059300 Rh1DG119700 Rh1DG177100 Rh1DG177200 Rh2AG353800 Rh2AG354000 Rh2AG354100 Rh2AG354300 Rh2AG354400 Rh2AG354500 Rh2AG354600 Rh2AG354700 Rh2AG642300 Rh2AG642400 Rh2AG642500 Rh2BG336500 Rh2BG336600 Rh2BG336700 Rh2BG336800 Rh2BG336900 Rh2CG299900 Rh2CG300000 Rh2CG300100 Rh2DG337000 Rh2DG337100 Rh3AG246600 Rh3BG121900 Rh3BG122300 Rh3BG122600 Rh3BG122700 Rh3DG304800 Rh3DG304900 Rh4AG148800 Rh4AG249000 Rh4AG249100 Rh4AG249200 Rh4BG182700 Rh4BG182800 Rh4BG182900 Rh4BG254400 Rh4BG254500 Rh4BG254600 Rh4CG155500 Rh4CG155700 Rh4DG057900 Rh4DG058000 Rh4DG058100 Rh4DG058200 Rh4DG129100 Rh5AG364500 Rh5AG364600 Rh5AG364800 Rh5AG365300 Rh5CG363700 Rh5CG497600 Rh5DG239500 Rh5DG239600 Rh6AG173500 Rh6AG175400 Rh6BG075900 Rh6BG076300 Rh6BG076400 Rh6BG076500 Rh6BG076600 Rh6CG151000 Rh6CG151200 Rh6CG151300 Rh6CG151400 Rh6CG205200 Rh6CG205300 Rh6CG419700 Rh6CG419900 Rh6CG420100 Rh6DG498700 Rh6DG498800 Rh7AG329000 Rh7AG329100 Rh7AG329300 Rh7AG329400 Rh7AG353000 Rh7AG353100 Rh7AG353300 Rh7AG353400 Rh7AG353500 Rh7CG346400 Rh7CG346500 Rh7CG346700 Rh7CG370800 Rh7CG370900 Rh7CG371000 Rh7CG371100 Rh7DG325000 Rh7DG325100 Rh7DG325200 Rh7DG325300 Rh7DG353100 Rh7DG353200 Rh7DG353300 Rh7DG363500 Rh7DG364000
rosa_wichuraiana Rw0G002290 Rw0G012780 Rw1G000260 Rw1G000270 Rw1G010400 Rw1G010410 Rw1G010420 Rw1G010430 Rw1G010440 Rw2G003210 Rw2G003220 Rw4G010970 Rw5G048520 Rw6G013320 Rw6G013470 Rw6G014940 Rw6G016570 Rw6G016590 Rw6G016600 Rw6G016610 Rw6G016620 Rw6G035450 Rw7G027760 Rw7G030460

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 86, 101
AcvI CACGTG 1 cut(s) 200
AloI GAACNNNNNNTCC 1 cut(s) 36
AoxI GGCC 1 cut(s) 51
AspS9I GGNCC 1 cut(s) 51
AsuHPI GGTGA 3 cut(s) 55, 100, 167
AsuII TTCGAA 1 cut(s) 23
BaeGI GKGCMC 1 cut(s) 205
BbrPI CACGTG 1 cut(s) 200
BccI CCATC 1 cut(s) 22
BmgT120I GGNCC 1 cut(s) 51
BmsI GCATC 2 cut(s) 109, 194
Bpu14I TTCGAA 1 cut(s) 23
BpuEI CTTGAG 1 cut(s) 92
BsaAI YACGTR 1 cut(s) 200
BsaWI WCCGGW 1 cut(s) 65
BsaXI ACNNNNNCTCC 1 cut(s) 34
Bse118I RCCGGY 1 cut(s) 127
BseGI GGATG 1 cut(s) 51
BseSI GKGCMC 1 cut(s) 205
BshFI GGCC 1 cut(s) 53
BsiSI CCGG 2 cut(s) 66, 128
BsnI GGCC 1 cut(s) 53
Bsp119I TTCGAA 1 cut(s) 23
Bsp1286I GDGCHC 1 cut(s) 205
BspACI CCGC 2 cut(s) 86, 101
BspANI GGCC 1 cut(s) 53
BspT104I TTCGAA 1 cut(s) 23
BsrFI RCCGGY 1 cut(s) 127
BssAI RCCGGY 1 cut(s) 127
BstBAI YACGTR 1 cut(s) 200
BstBI TTCGAA 1 cut(s) 23
BstEII GGTNACC 1 cut(s) 61
BstF5I GGATG 1 cut(s) 51
BstMWI GCNNNNNNNGC 3 cut(s) 92, 109, 128
BstNSI RCATGY 1 cut(s) 197
BstPI GGTNACC 1 cut(s) 61
BstSLI GKGCMC 1 cut(s) 205
BsuRI GGCC 1 cut(s) 53
BtsCI GGATG 1 cut(s) 51
Cfr10I RCCGGY 1 cut(s) 127
Cfr13I GGNCC 1 cut(s) 51
CviAII CATG 1 cut(s) 194
CviJI RGCY 1 cut(s) 53
CviKI_1 RGCY 1 cut(s) 53
EciI GGCGGA 1 cut(s) 90
Eco72I CACGTG 1 cut(s) 200
Eco91I GGTNACC 1 cut(s) 61
EcoO65I GGTNACC 1 cut(s) 61
FaeI CATG 1 cut(s) 197
FaiI YATR 4 cut(s) 72, 172, 174, 195
FatI CATG 1 cut(s) 193
FokI GGATG 1 cut(s) 58
HaeIII GGCC 1 cut(s) 53
HapII CCGG 2 cut(s) 66, 128
Hin1II CATG 1 cut(s) 197
HpaII CCGG 2 cut(s) 66, 128
HphI GGTGA 3 cut(s) 55, 100, 167
Hpy99I CGWCG 1 cut(s) 142
HpyAV CCTTC 1 cut(s) 76
HpyCH4IV ACGT 1 cut(s) 199
HpyCH4V TGCA 3 cut(s) 122, 164, 197
HpyF10VI GCNNNNNNNGC 3 cut(s) 92, 109, 128
HpySE526I ACGT 1 cut(s) 199
Hsp92II CATG 1 cut(s) 197
LpnPI CCDG 2 cut(s) 79, 141
LweI GCATC 2 cut(s) 109, 194
MaeII ACGT 1 cut(s) 199
MaeIII GTNAC 1 cut(s) 61
MboII GAAGA 1 cut(s) 37
MhlI GDGCHC 1 cut(s) 205
MnlI CCTC 2 cut(s) 42, 52
MseI TTAA 1 cut(s) 214
MslI CAYNNNNRTG 1 cut(s) 198
MspI CCGG 2 cut(s) 66, 128
MwoI GCNNNNNNNGC 3 cut(s) 92, 109, 128
NlaIII CATG 1 cut(s) 197
NmuCI GTSAC 1 cut(s) 61
NspI RCATGY 1 cut(s) 197
NspV TTCGAA 1 cut(s) 23
PmaCI CACGTG 1 cut(s) 200
PmlI CACGTG 1 cut(s) 200
Ppu21I YACGTR 1 cut(s) 200
PspCI CACGTG 1 cut(s) 200
PspEI GGTNACC 1 cut(s) 61
PspPI GGNCC 1 cut(s) 51
RseI CAYNNNNRTG 1 cut(s) 198
SaqAI TTAA 1 cut(s) 214
Sau96I GGNCC 1 cut(s) 51
SduI GDGCHC 1 cut(s) 205
SetI ASST 2 cut(s) 63, 202
SfaNI GCATC 2 cut(s) 109, 194
SfuI TTCGAA 1 cut(s) 23
SmiMI CAYNNNNRTG 1 cut(s) 198
SmlI CTYRAG 1 cut(s) 107
SmoI CTYRAG 1 cut(s) 107
SsiI CCGC 2 cut(s) 86, 101
TaiI ACGT 1 cut(s) 202
TaqI TCGA 1 cut(s) 23
Tru1I TTAA 1 cut(s) 214
Tru9I TTAA 1 cut(s) 214
TseFI GTSAC 1 cut(s) 61
Tsp45I GTSAC 1 cut(s) 61
TspDTI ATGAA 1 cut(s) 159
XceI RCATGY 1 cut(s) 197
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.