Rmu_sc0000997.1_g000005

Ribonuclease H protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000997.1
Physical Location & Seq
Forward (+)
12584 .. 12994
411 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000997.1_g000005.1.cds

Sequence Viewer

Length: 411 bp
atgtgcgctaatcttcaaggcacagtcaaaatgatccaaatggcaaatggctggttctcgctggattttgcttacctgcaggacgttgattttgtcctggaaaataggccctggtttgtcaagggtcgaatcttccatattcggaaatggtcctcatctttgaacccgagggaggatactattgagaccctggtgctttgggttcggcttcccaaccttcctctgcattactggagcaaggaggccatcataccaatagttcaggtaattggtagttttattaggcttgatgaacgtactgagaatagtaagaattatgtctttgcaagggtctgcatggaaatagacatgaggactcctctgaaaagggttctggttatacgggaggaagaggagggagacctactgtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

136

Amino Acids

16.1

Weight (kDa)

6.13

Isoelectric Point (pI)

44.07

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000182)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g21471 FvH4_1g27953 FvH4_1g28801 FvH4_2g14522 FvH4_3g04280 FvH4_3g28251 FvH4_4g07491 FvH4_4g30262
malus_domestica MD10G1046400.v1.1 MD10G1126900.v1.1 MD11G1236100.v1.1
prunus_persica Prupe.1G148300_v2.0.a1 Prupe.2G036800_v2.0.a1 Prupe.8G054600_v2.0.a1 Prupe.8G054700_v2.0.a1
pyrus_communis pycom05g05520 pycom08g11160 pycom13g29480
rosa_chinensis RchiOBHm_Chr7g0182921 RchiOBHm_Chr7g0230111
rosa_laevigata RLG00000000536 RLG00000001385 RLG00000001492 RLG00000002640 RLG00000003082 RLG00000005042 RLG00000007254 RLG00000007773 RLG00000008594 RLG00000009508 RLG00000010355 RLG00000013369 RLG00000014370 RLG00000014371 RLG00000018745 RLG00000020268 RLG00000020832 RLG00000022569 RLG00000028073 RLG00000028388 RLG00000028677 RLG00000035645
rosa_multiflora Rmu_co8277499.1_g000001 Rmu_co8500999.1_g000001 Rmu_sc0000014.1_g000025 Rmu_sc0000103.1_g000003 Rmu_sc0000168.1_g000019 Rmu_sc0000283.1_g000006 Rmu_sc0000693.1_g000080 Rmu_sc0000997.1_g000005 Rmu_sc0001228.1_g000005 Rmu_sc0001231.1_g000023 Rmu_sc0002833.1_g000037 Rmu_sc0002869.1_g000015 Rmu_sc0003545.1_g000003 Rmu_sc0003693.1_g000028 Rmu_sc0004000.1_g000022 Rmu_sc0004454.1_g000007 Rmu_sc0004976.1_g000036 Rmu_sc0005014.1_g000013 Rmu_sc0005046.1_g000013 Rmu_sc0005063.1_g000009 Rmu_sc0005652.1_g000002 Rmu_sc0005697.1_g000008 Rmu_sc0006989.1_g000014 Rmu_sc0008957.1_g000003 Rmu_sc0011659.1_g000001 Rmu_sc0027477.1_g000001 Rmu_ssc0000387.1_g000021
rosa_roxburghii Rroxscaffold_1G00020860 Rroxscaffold_1G00035780 Rroxscaffold_1G00051370 Rroxscaffold_2G00101730 Rroxscaffold_3G00230130 Rroxscaffold_4G00280070 Rroxscaffold_4G00281160 Rroxscaffold_4G00318780 Rroxscaffold_5G00341570 Rroxscaffold_5G00341580 Rroxscaffold_7G00191230 Rroxscaffold_7G00195880 Rroxscaffold_7G00195890 Rroxscaffold_7G00209080 Rroxscaffold_7G00209090
rosa_rugosa Rorug02G0170400 Rorug03G0234500 Rorug04G0045200 Rorug07G0191000
rosa_samantha Rh1AG012200 Rh1AG012300 Rh1AG021700 Rh1AG033800 Rh1AG033900 Rh1AG048100 Rh1AG087000 Rh1AG168600 Rh1CG004600 Rh2BG192700 Rh2BG200800 Rh2BG310200 Rh2BG356900 Rh2BG377900 Rh2BG378000 Rh2CG356300 Rh2DG394800 Rh3AG199000 Rh3AG258700 Rh3AG258800 Rh3AG324400 Rh3BG202300 Rh3BG202400 Rh3BG228800 Rh3BG318800 Rh3BG360400 Rh3BG368300 Rh3BG373700 Rh4AG071400 Rh4AG153700 Rh4AG224300 Rh4AG224400 Rh4CG044000 Rh4CG077200 Rh4CG077300 Rh4CG238700 Rh4CG238800 Rh4CG238900 Rh5BG367100 Rh5BG379500 Rh5BG379600 Rh5BG396700 Rh5BG412900 Rh5DG427200 Rh6AG015200 Rh6AG015300 Rh6AG122800 Rh6AG175600 Rh6AG187700 Rh6AG187800 Rh6AG260800 Rh6AG355000 Rh6BG074900 Rh6BG102300 Rh7AG127400 Rh7AG157500 Rh7AG157600 Rh7AG212200 Rh7AG331400 Rh7AG412000 Rh7CG055400 Rh7CG131400 Rh7CG131500 Rh7CG224300 Rh7CG267100 Rh7CG348800
rosa_wichuraiana Rw0G009820 Rw1G000520 Rw1G008820 Rw4G014110 Rw4G019370 Rw4G022440 Rw6G010550 Rw7G001520 Rw7G018400 Rw7G025210 Rw7G027910

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 84
AclWI GGATC 1 cut(s) 28
AfaI GTAC 1 cut(s) 298
AfiI CCNNNNNNNGG 1 cut(s) 172
AgsI TTSAA 2 cut(s) 17, 163
AjnI CCWGG 3 cut(s) 96, 110, 189
Alw26I GTCTC 2 cut(s) 179, 393
AlwI GGATC 1 cut(s) 28
Ama87I CYCGRG 1 cut(s) 166
AoxI GGCC 2 cut(s) 107, 243
ArsI GACNNNNNNTTYG 2 cut(s) 74, 106
AspLEI GCGC 1 cut(s) 8
AspS9I GGNCC 2 cut(s) 108, 150
AvaI CYCGRG 1 cut(s) 166
AvaII GGWCC 1 cut(s) 150
BccI CCATC 1 cut(s) 254
BciT130I CCWGG 3 cut(s) 98, 112, 191
BciVI GTATCC 1 cut(s) 169
BcoDI GTCTC 2 cut(s) 179, 393
BfmI CTRYAG 1 cut(s) 77
BfuAI ACCTGC 1 cut(s) 84
BfuI GTATCC 1 cut(s) 169
Bme1390I CCNGG 3 cut(s) 98, 112, 191
Bme18I GGWCC 1 cut(s) 150
BmeT110I CYCGRG 1 cut(s) 166
BmgT120I GGNCC 2 cut(s) 108, 150
BmrFI CCNGG 3 cut(s) 98, 112, 191
BplI GAGNNNNNCTC 2 cut(s) 343, 375
BpmI CTGGAG 1 cut(s) 253
BsaI GGTCTC 2 cut(s) 179, 393
BsaJI CCNNGG 3 cut(s) 110, 167, 189
Bsc4I CCNNNNNNNGG 1 cut(s) 172
Bse1I ACTGG 1 cut(s) 236
BseBI CCWGG 3 cut(s) 98, 112, 191
BseDI CCNNGG 3 cut(s) 110, 167, 189
BseLI CCNNNNNNNGG 1 cut(s) 172
BseMII CTCAG 1 cut(s) 291
BseNI ACTGG 1 cut(s) 236
BseRI GAGGAG 2 cut(s) 348, 407
BshFI GGCC 2 cut(s) 109, 245
BsiHKCI CYCGRG 1 cut(s) 166
BslI CCNNNNNNNGG 1 cut(s) 172
BsmAI GTCTC 2 cut(s) 179, 393
BsnI GGCC 2 cut(s) 109, 245
Bso31I GGTCTC 2 cut(s) 179, 393
BsoBI CYCGRG 1 cut(s) 166
Bsp143I GATC 1 cut(s) 33
BspANI GGCC 2 cut(s) 109, 245
BspCNI CTCAG 1 cut(s) 292
BspMAI CTGCAG 1 cut(s) 81
BspMI ACCTGC 1 cut(s) 84
BspPI GGATC 1 cut(s) 28
BspTNI GGTCTC 2 cut(s) 179, 393
BsrI ACTGG 1 cut(s) 236
BssECI CCNNGG 3 cut(s) 110, 167, 189
BssMI GATC 1 cut(s) 33
Bst2UI CCWGG 3 cut(s) 98, 112, 191
Bst4CI ACNGT 2 cut(s) 25, 408
Bst6I CTCTTC 1 cut(s) 384
BstDEI CTNAG 1 cut(s) 300
BstHHI GCGC 1 cut(s) 8
BstKTI GATC 1 cut(s) 36
BstMAI GTCTC 2 cut(s) 179, 393
BstMBI GATC 1 cut(s) 33
BstNI CCWGG 3 cut(s) 98, 112, 191
BstSCI CCNGG 3 cut(s) 96, 110, 189
BstSFI CTRYAG 1 cut(s) 77
BsuI GTATCC 1 cut(s) 169
BsuRI GGCC 2 cut(s) 109, 245
BveI ACCTGC 1 cut(s) 84
CfoI GCGC 1 cut(s) 8
Cfr13I GGNCC 2 cut(s) 108, 150
Csp6I GTAC 1 cut(s) 297
CviAII CATG 2 cut(s) 337, 349
CviJI RGCY 5 cut(s) 51, 109, 208, 245, 286
CviKI_1 RGCY 5 cut(s) 51, 109, 208, 245, 286
CviQI GTAC 1 cut(s) 297
DdeI CTNAG 1 cut(s) 300
DpnI GATC 1 cut(s) 35
DpnII GATC 1 cut(s) 33
Eam1104I CTCTTC 1 cut(s) 384
EarI CTCTTC 1 cut(s) 384
Eco31I GGTCTC 2 cut(s) 179, 393
Eco47I GGWCC 1 cut(s) 150
Eco88I CYCGRG 1 cut(s) 166
EcoO109I RGGNCCY 1 cut(s) 108
EcoRII CCWGG 3 cut(s) 96, 110, 189
FaeI CATG 2 cut(s) 340, 352
FaiI YATR 6 cut(s) 138, 251, 318, 338, 350, 380
FatI CATG 2 cut(s) 336, 348
GlaI GCGC 1 cut(s) 7
GsuI CTGGAG 1 cut(s) 253
HaeIII GGCC 2 cut(s) 109, 245
HhaI GCGC 1 cut(s) 8
Hin1II CATG 2 cut(s) 340, 352
Hin6I GCGC 1 cut(s) 6
HinP1I GCGC 1 cut(s) 6
HinfI GANTC 2 cut(s) 129, 355
Hpy188I TCNGA 2 cut(s) 144, 363
HpyAV CCTTC 1 cut(s) 227
HpyCH4III ACNGT 2 cut(s) 25, 408
HpyCH4IV ACGT 2 cut(s) 84, 295
HpyCH4V TGCA 4 cut(s) 79, 226, 326, 336
HpyF3I CTNAG 1 cut(s) 300
HpySE526I ACGT 2 cut(s) 84, 295
Hsp92II CATG 2 cut(s) 340, 352
HspAI GCGC 1 cut(s) 6
Kzo9I GATC 1 cut(s) 33
LmnI GCTCC 1 cut(s) 234
MaeII ACGT 2 cut(s) 84, 295
MalI GATC 1 cut(s) 35
MboI GATC 1 cut(s) 33
MboII GAAGA 3 cut(s) 5, 124, 401
MluCI AATT 2 cut(s) 267, 313
MlyI GAGTC 1 cut(s) 349
MspR9I CCNGG 3 cut(s) 98, 112, 191
MvaI CCWGG 3 cut(s) 98, 112, 191
NdeII GATC 1 cut(s) 33
NlaIII CATG 2 cut(s) 340, 352
PfeI GAWTC 1 cut(s) 129
PfoI TCCNGGA 1 cut(s) 96
PleI GAGTC 1 cut(s) 349
PpsI GAGTC 1 cut(s) 349
Psp6I CCWGG 3 cut(s) 96, 110, 189
PspGI CCWGG 3 cut(s) 96, 110, 189
PspPI GGNCC 2 cut(s) 108, 150
PstI CTGCAG 1 cut(s) 81
RsaI GTAC 1 cut(s) 298
RsaNI GTAC 1 cut(s) 297
Sau3AI GATC 1 cut(s) 33
Sau96I GGNCC 2 cut(s) 108, 150
SbfI CCTGCAGG 1 cut(s) 81
SchI GAGTC 1 cut(s) 349
ScrFI CCNGG 3 cut(s) 98, 112, 191
SdaI CCTGCAGG 1 cut(s) 81
SetI ASST 6 cut(s) 78, 87, 219, 267, 298, 405
SfcI CTRYAG 1 cut(s) 77
SinI GGWCC 1 cut(s) 150
Sse8387I CCTGCAGG 1 cut(s) 81
Sse9I AATT 2 cut(s) 267, 313
StyD4I CCNGG 3 cut(s) 96, 110, 189
TaaI ACNGT 2 cut(s) 25, 408
TaiI ACGT 2 cut(s) 87, 298
TaqI TCGA 1 cut(s) 127
TasI AATT 2 cut(s) 267, 313
TfiI GAWTC 1 cut(s) 129
TspDTI ATGAA 1 cut(s) 306
VpaK11BI GGWCC 1 cut(s) 150
XcmI CCANNNNNNNNNTGG 1 cut(s) 44
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.