Rmu_sc0011659.1_g000001

Ribonuclease H protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0011659.1
Physical Location & Seq
Forward (+)
2141 .. 2735
595 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0011659.1_g000001.1.cds

Sequence Viewer

Length: 486 bp
atgaaccggttggtcaataactactttagctttgagttctctattgaggaggatgtagagttcattctttttaggaggccttggttcatccgtagtcggctattttgcctccaaagatggactctaacttttgatcctaccctagctcgcattgatgacaataccatcaacggtaagaagaccatgttcgctaggattcttgttgagctagatctgcgctatcctcttaagcggactgtcctagtaaataatgggaatgaacctctctctacagtgctagtgtcgtatgaggtgatatttgaagtgtgctttcggtgtggacaacattgtaccagattccattcttgtccgaacagggtggtgaatgacaacttcttcatggtggagcggttcgataaggagcatgttgtttaccctcctgaaatggcagataatgagtacattaaacctctcctagctgatgatatctctattattttcccttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

161

Amino Acids

19.24

Weight (kDa)

5.64

Isoelectric Point (pI)

41.0

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000182)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g21471 FvH4_1g27953 FvH4_1g28801 FvH4_2g14522 FvH4_3g04280 FvH4_3g28251 FvH4_4g07491 FvH4_4g30262
malus_domestica MD10G1046400.v1.1 MD10G1126900.v1.1 MD11G1236100.v1.1
prunus_persica Prupe.1G148300_v2.0.a1 Prupe.2G036800_v2.0.a1 Prupe.8G054600_v2.0.a1 Prupe.8G054700_v2.0.a1
pyrus_communis pycom05g05520 pycom08g11160 pycom13g29480
rosa_chinensis RchiOBHm_Chr7g0182921 RchiOBHm_Chr7g0230111
rosa_laevigata RLG00000000536 RLG00000001385 RLG00000001492 RLG00000002640 RLG00000003082 RLG00000005042 RLG00000007254 RLG00000007773 RLG00000008594 RLG00000009508 RLG00000010355 RLG00000013369 RLG00000014370 RLG00000014371 RLG00000018745 RLG00000020268 RLG00000020832 RLG00000022569 RLG00000028073 RLG00000028388 RLG00000028677 RLG00000035645
rosa_multiflora Rmu_co8277499.1_g000001 Rmu_co8500999.1_g000001 Rmu_sc0000014.1_g000025 Rmu_sc0000103.1_g000003 Rmu_sc0000168.1_g000019 Rmu_sc0000283.1_g000006 Rmu_sc0000693.1_g000080 Rmu_sc0000997.1_g000005 Rmu_sc0001228.1_g000005 Rmu_sc0001231.1_g000023 Rmu_sc0002833.1_g000037 Rmu_sc0002869.1_g000015 Rmu_sc0003545.1_g000003 Rmu_sc0003693.1_g000028 Rmu_sc0004000.1_g000022 Rmu_sc0004454.1_g000007 Rmu_sc0004976.1_g000036 Rmu_sc0005014.1_g000013 Rmu_sc0005046.1_g000013 Rmu_sc0005063.1_g000009 Rmu_sc0005652.1_g000002 Rmu_sc0005697.1_g000008 Rmu_sc0006989.1_g000014 Rmu_sc0008957.1_g000003 Rmu_sc0011659.1_g000001 Rmu_sc0027477.1_g000001 Rmu_ssc0000387.1_g000021
rosa_roxburghii Rroxscaffold_1G00020860 Rroxscaffold_1G00035780 Rroxscaffold_1G00051370 Rroxscaffold_2G00101730 Rroxscaffold_3G00230130 Rroxscaffold_4G00280070 Rroxscaffold_4G00281160 Rroxscaffold_4G00318780 Rroxscaffold_5G00341570 Rroxscaffold_5G00341580 Rroxscaffold_7G00191230 Rroxscaffold_7G00195880 Rroxscaffold_7G00195890 Rroxscaffold_7G00209080 Rroxscaffold_7G00209090
rosa_rugosa Rorug02G0170400 Rorug03G0234500 Rorug04G0045200 Rorug07G0191000
rosa_samantha Rh1AG012200 Rh1AG012300 Rh1AG021700 Rh1AG033800 Rh1AG033900 Rh1AG048100 Rh1AG087000 Rh1AG168600 Rh1CG004600 Rh2BG192700 Rh2BG200800 Rh2BG310200 Rh2BG356900 Rh2BG377900 Rh2BG378000 Rh2CG356300 Rh2DG394800 Rh3AG199000 Rh3AG258700 Rh3AG258800 Rh3AG324400 Rh3BG202300 Rh3BG202400 Rh3BG228800 Rh3BG318800 Rh3BG360400 Rh3BG368300 Rh3BG373700 Rh4AG071400 Rh4AG153700 Rh4AG224300 Rh4AG224400 Rh4CG044000 Rh4CG077200 Rh4CG077300 Rh4CG238700 Rh4CG238800 Rh4CG238900 Rh5BG367100 Rh5BG379500 Rh5BG379600 Rh5BG396700 Rh5BG412900 Rh5DG427200 Rh6AG015200 Rh6AG015300 Rh6AG122800 Rh6AG175600 Rh6AG187700 Rh6AG187800 Rh6AG260800 Rh6AG355000 Rh6BG074900 Rh6BG102300 Rh7AG127400 Rh7AG157500 Rh7AG157600 Rh7AG212200 Rh7AG331400 Rh7AG412000 Rh7CG055400 Rh7CG131400 Rh7CG131500 Rh7CG224300 Rh7CG267100 Rh7CG348800
rosa_wichuraiana Rw0G009820 Rw1G000520 Rw1G008820 Rw4G014110 Rw4G019370 Rw4G022440 Rw6G010550 Rw7G001520 Rw7G018400 Rw7G025210 Rw7G027910

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 388
AciI CCGC 2 cut(s) 232, 388
AclWI GGATC 1 cut(s) 128
AfaI GTAC 2 cut(s) 331, 440
AflII CTTAAG 1 cut(s) 227
AgeI ACCGGT 1 cut(s) 6
AgsI TTSAA 1 cut(s) 302
AloI GAACNNNNNNTCC 2 cut(s) 44, 76
AluBI AGCT 4 cut(s) 30, 146, 208, 458
AluI AGCT 4 cut(s) 30, 146, 208, 458
AlwI GGATC 1 cut(s) 128
AoxI GGCC 1 cut(s) 77
AsiGI ACCGGT 1 cut(s) 6
AspLEI GCGC 1 cut(s) 219
AsuHPI GGTGA 2 cut(s) 304, 373
BbsI GAAGAC 1 cut(s) 185
BccI CCATC 2 cut(s) 111, 173
BfaI CTAG 6 cut(s) 143, 192, 209, 242, 278, 455
BfmI CTRYAG 1 cut(s) 270
BfrI CTTAAG 1 cut(s) 227
BglII AGATCT 1 cut(s) 211
BpiI GAAGAC 1 cut(s) 185
BsaJI CCNNGG 1 cut(s) 80
BsaWI WCCGGW 1 cut(s) 6
Bse118I RCCGGY 1 cut(s) 6
BseDI CCNNGG 1 cut(s) 80
BseGI GGATG 2 cut(s) 58, 87
BseRI GAGGAG 1 cut(s) 62
BshFI GGCC 1 cut(s) 79
BshTI ACCGGT 1 cut(s) 6
BsiSI CCGG 1 cut(s) 7
BsnI GGCC 1 cut(s) 79
Bsp143I GATC 2 cut(s) 133, 211
BspACI CCGC 2 cut(s) 232, 388
BspANI GGCC 1 cut(s) 79
BspPI GGATC 1 cut(s) 128
BspTI CTTAAG 1 cut(s) 227
BsrBI CCGCTC 1 cut(s) 388
BsrFI RCCGGY 1 cut(s) 6
BssAI RCCGGY 1 cut(s) 6
BssECI CCNNGG 1 cut(s) 80
BssMI GATC 2 cut(s) 133, 211
BssT1I CCWWGG 1 cut(s) 80
Bst4CI ACNGT 3 cut(s) 173, 238, 274
BstAFI CTTAAG 1 cut(s) 227
BstC8I GCNNGC 1 cut(s) 148
BstDEI CTNAG 1 cut(s) 483
BstF5I GGATG 2 cut(s) 58, 87
BstHHI GCGC 1 cut(s) 219
BstKTI GATC 2 cut(s) 136, 214
BstMBI GATC 2 cut(s) 133, 211
BstMWI GCNNNNNNNGC 1 cut(s) 214
BstNSI RCATGY 1 cut(s) 407
BstSFI CTRYAG 1 cut(s) 270
BstV2I GAAGAC 1 cut(s) 185
BstX2I RGATCY 1 cut(s) 211
BstYI RGATCY 1 cut(s) 211
BsuRI GGCC 1 cut(s) 79
BtsCI GGATG 2 cut(s) 58, 87
BtsIMutI CAGTG 1 cut(s) 279
Cac8I GCNNGC 1 cut(s) 148
CfoI GCGC 1 cut(s) 219
Cfr10I RCCGGY 1 cut(s) 6
Csp6I GTAC 2 cut(s) 330, 439
CspAI ACCGGT 1 cut(s) 6
CviAII CATG 3 cut(s) 184, 379, 404
CviJI RGCY 6 cut(s) 30, 79, 100, 146, 208, 458
CviKI_1 RGCY 6 cut(s) 30, 79, 100, 146, 208, 458
CviQI GTAC 2 cut(s) 330, 439
DdeI CTNAG 1 cut(s) 483
DpnI GATC 2 cut(s) 135, 213
DpnII GATC 2 cut(s) 133, 211
Eco130I CCWWGG 1 cut(s) 80
Eco147I AGGCCT 1 cut(s) 79
Eco32I GATATC 1 cut(s) 466
EcoRV GATATC 1 cut(s) 466
EcoT14I CCWWGG 1 cut(s) 80
ErhI CCWWGG 1 cut(s) 80
FaeI CATG 3 cut(s) 187, 382, 407
FaiI YATR 4 cut(s) 185, 288, 380, 405
FatI CATG 3 cut(s) 183, 378, 403
FokI GGATG 2 cut(s) 65, 74
FspBI CTAG 6 cut(s) 143, 192, 209, 242, 278, 455
GlaI GCGC 1 cut(s) 218
HaeIII GGCC 1 cut(s) 79
HapII CCGG 1 cut(s) 7
HhaI GCGC 1 cut(s) 219
Hin1II CATG 3 cut(s) 187, 382, 407
Hin6I GCGC 1 cut(s) 217
HinP1I GCGC 1 cut(s) 217
HinfI GANTC 3 cut(s) 121, 196, 336
HpaII CCGG 1 cut(s) 7
HphI GGTGA 2 cut(s) 304, 373
Hpy166II GTNNAC 2 cut(s) 320, 412
Hpy188I TCNGA 1 cut(s) 351
Hpy188III TCNNGA 1 cut(s) 419
Hpy8I GTNNAC 2 cut(s) 320, 412
HpyCH4III ACNGT 3 cut(s) 173, 238, 274
HpyF10VI GCNNNNNNNGC 1 cut(s) 214
HpyF3I CTNAG 1 cut(s) 483
Hsp92II CATG 3 cut(s) 187, 382, 407
HspAI GCGC 1 cut(s) 217
Kzo9I GATC 2 cut(s) 133, 211
LmnI GCTCC 2 cut(s) 385, 400
LpnPI CCDG 4 cut(s) 20, 340, 346, 432
MaeI CTAG 6 cut(s) 143, 192, 209, 242, 278, 455
MalI GATC 2 cut(s) 135, 213
MbiI CCGCTC 1 cut(s) 388
MboI GATC 2 cut(s) 133, 211
MboII GAAGA 2 cut(s) 190, 367
MflI RGATCY 1 cut(s) 211
MlyI GAGTC 1 cut(s) 115
MnlI CCTC 9 cut(s) 40, 43, 69, 119, 234, 273, 283, 426, 459
MseI TTAA 2 cut(s) 228, 444
MspCI CTTAAG 1 cut(s) 227
MspI CCGG 1 cut(s) 7
MwoI GCNNNNNNNGC 1 cut(s) 214
NdeII GATC 2 cut(s) 133, 211
NlaIII CATG 3 cut(s) 187, 382, 407
NspI RCATGY 1 cut(s) 407
PceI AGGCCT 1 cut(s) 79
PfeI GAWTC 2 cut(s) 196, 336
PinAI ACCGGT 1 cut(s) 6
PleI GAGTC 1 cut(s) 115
PpsI GAGTC 1 cut(s) 115
PsuI RGATCY 1 cut(s) 211
RsaI GTAC 2 cut(s) 331, 440
RsaNI GTAC 2 cut(s) 330, 439
SaqAI TTAA 2 cut(s) 228, 444
Sau3AI GATC 2 cut(s) 133, 211
SchI GAGTC 1 cut(s) 115
SetI ASST 7 cut(s) 32, 148, 210, 265, 294, 451, 460
SfcI CTRYAG 1 cut(s) 270
SmlI CTYRAG 1 cut(s) 227
SmoI CTYRAG 1 cut(s) 227
SseBI AGGCCT 1 cut(s) 79
SsiI CCGC 2 cut(s) 232, 388
SspMI CTAG 6 cut(s) 143, 192, 209, 242, 278, 455
StuI AGGCCT 1 cut(s) 79
StyI CCWWGG 1 cut(s) 80
TaaI ACNGT 3 cut(s) 173, 238, 274
TaqI TCGA 1 cut(s) 393
TatI WGTACW 1 cut(s) 438
TfiI GAWTC 2 cut(s) 196, 336
Tru1I TTAA 2 cut(s) 228, 444
Tru9I TTAA 2 cut(s) 228, 444
TscAI CASTG 1 cut(s) 279
TspDTI ATGAA 5 cut(s) 17, 52, 76, 273, 367
TspGWI ACGGA 1 cut(s) 80
TspRI CASTG 1 cut(s) 279
Vha464I CTTAAG 1 cut(s) 227
XceI RCATGY 1 cut(s) 407
XspI CTAG 6 cut(s) 143, 192, 209, 242, 278, 455
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.