Rh5BG379500

acid phosphatase activity

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
OG0000182
Physical Location & Seq
Forward (+)
60111852 .. 60112151
300 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG379500.1

Sequence Viewer

Length: 300 bp
ATGGTCTCTTATGAAGTTGTGTTTGAAGTTTGCTTTAGGTGTGGCCGCTATAGGGAAAGGTTTCATAAATGCCCTGATCAAATCCTGAAGGAGAACTTCCTTATGGTGGAGCGTCTCGAGGATGAACAAGCTGTCTATCCTCTGGAAATGGCAAAGCATGAGTTCATTAAGCCTCTGTTGTCGAATGATATCTTGATTGTCTTTCCTCAACCTATGTTTAATTATCATGACCAAGGCAATGTGAATTTTGTCAACCGTGCTGCCACCCGTTCTGGTGAGGAGGCTTATGATAACTCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_1 RVT_3

Protein Analysis

99

Amino Acids

11.77

Weight (kDa)

5.12

Isoelectric Point (pI)

28.21

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000182)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g21471 FvH4_1g27953 FvH4_1g28801 FvH4_2g14522 FvH4_3g04280 FvH4_3g28251 FvH4_4g07491 FvH4_4g30262
malus_domestica MD10G1046400.v1.1 MD10G1126900.v1.1 MD11G1236100.v1.1
prunus_persica Prupe.1G148300_v2.0.a1 Prupe.2G036800_v2.0.a1 Prupe.8G054600_v2.0.a1 Prupe.8G054700_v2.0.a1
pyrus_communis pycom05g05520 pycom08g11160 pycom13g29480
rosa_chinensis RchiOBHm_Chr7g0182921 RchiOBHm_Chr7g0230111
rosa_laevigata RLG00000000536 RLG00000001385 RLG00000001492 RLG00000002640 RLG00000003082 RLG00000005042 RLG00000007254 RLG00000007773 RLG00000008594 RLG00000009508 RLG00000010355 RLG00000013369 RLG00000014370 RLG00000014371 RLG00000018745 RLG00000020268 RLG00000020832 RLG00000022569 RLG00000028073 RLG00000028388 RLG00000028677 RLG00000035645
rosa_multiflora Rmu_co8277499.1_g000001 Rmu_co8500999.1_g000001 Rmu_sc0000014.1_g000025 Rmu_sc0000103.1_g000003 Rmu_sc0000168.1_g000019 Rmu_sc0000283.1_g000006 Rmu_sc0000693.1_g000080 Rmu_sc0000997.1_g000005 Rmu_sc0001228.1_g000005 Rmu_sc0001231.1_g000023 Rmu_sc0002833.1_g000037 Rmu_sc0002869.1_g000015 Rmu_sc0003545.1_g000003 Rmu_sc0003693.1_g000028 Rmu_sc0004000.1_g000022 Rmu_sc0004454.1_g000007 Rmu_sc0004976.1_g000036 Rmu_sc0005014.1_g000013 Rmu_sc0005046.1_g000013 Rmu_sc0005063.1_g000009 Rmu_sc0005652.1_g000002 Rmu_sc0005697.1_g000008 Rmu_sc0006989.1_g000014 Rmu_sc0008957.1_g000003 Rmu_sc0011659.1_g000001 Rmu_sc0027477.1_g000001 Rmu_ssc0000387.1_g000021
rosa_roxburghii Rroxscaffold_1G00020860 Rroxscaffold_1G00035780 Rroxscaffold_1G00051370 Rroxscaffold_2G00101730 Rroxscaffold_3G00230130 Rroxscaffold_4G00280070 Rroxscaffold_4G00281160 Rroxscaffold_4G00318780 Rroxscaffold_5G00341570 Rroxscaffold_5G00341580 Rroxscaffold_7G00191230 Rroxscaffold_7G00195880 Rroxscaffold_7G00195890 Rroxscaffold_7G00209080 Rroxscaffold_7G00209090
rosa_rugosa Rorug02G0170400 Rorug03G0234500 Rorug04G0045200 Rorug07G0191000
rosa_samantha Rh1AG012200 Rh1AG012300 Rh1AG021700 Rh1AG033800 Rh1AG033900 Rh1AG048100 Rh1AG087000 Rh1AG168600 Rh1CG004600 Rh2BG192700 Rh2BG200800 Rh2BG310200 Rh2BG356900 Rh2BG377900 Rh2BG378000 Rh2CG356300 Rh2DG394800 Rh3AG199000 Rh3AG258700 Rh3AG258800 Rh3AG324400 Rh3BG202300 Rh3BG202400 Rh3BG228800 Rh3BG318800 Rh3BG360400 Rh3BG368300 Rh3BG373700 Rh4AG071400 Rh4AG153700 Rh4AG224300 Rh4AG224400 Rh4CG044000 Rh4CG077200 Rh4CG077300 Rh4CG238700 Rh4CG238800 Rh4CG238900 Rh5BG367100 Rh5BG379500 Rh5BG379600 Rh5BG396700 Rh5BG412900 Rh5DG427200 Rh6AG015200 Rh6AG015300 Rh6AG122800 Rh6AG175600 Rh6AG187700 Rh6AG187800 Rh6AG260800 Rh6AG355000 Rh6BG074900 Rh6BG102300 Rh7AG127400 Rh7AG157500 Rh7AG157600 Rh7AG212200 Rh7AG331400 Rh7AG412000 Rh7CG055400 Rh7CG131400 Rh7CG131500 Rh7CG224300 Rh7CG267100 Rh7CG348800
rosa_wichuraiana Rw0G009820 Rw1G000520 Rw1G008820 Rw4G014110 Rw4G019370 Rw4G022440 Rw6G010550 Rw7G001520 Rw7G018400 Rw7G025210 Rw7G027910

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 46
AcoI YGGCCR 1 cut(s) 43
AcsI RAATTY 1 cut(s) 244
AcuI CTGAAG 1 cut(s) 107
AfiI CCNNNNNNNGG 2 cut(s) 52, 106
AgsI TTSAA 1 cut(s) 26
AluBI AGCT 1 cut(s) 131
AluI AGCT 1 cut(s) 131
Alw26I GTCTC 2 cut(s) 10, 119
Ama87I CYCGRG 1 cut(s) 116
AoxI GGCC 1 cut(s) 43
ApeKI GCWGC 1 cut(s) 260
ApoI RAATTY 1 cut(s) 244
Asp700I GAANNNNTTC 1 cut(s) 60
AsuHPI GGTGA 1 cut(s) 287
AvaI CYCGRG 1 cut(s) 116
BbvI GCAGC 1 cut(s) 247
BclI TGATCA 1 cut(s) 76
BcoDI GTCTC 2 cut(s) 10, 119
BfmI CTRYAG 1 cut(s) 49
BisI GCNGC 2 cut(s) 46, 261
BlsI GCNGC 2 cut(s) 47, 262
BmeT110I CYCGRG 1 cut(s) 116
BsaI GGTCTC 1 cut(s) 10
BsaJI CCNNGG 1 cut(s) 232
Bsc4I CCNNNNNNNGG 2 cut(s) 52, 106
Bse3DI GCAATG 1 cut(s) 244
BseDI CCNNGG 1 cut(s) 232
BseGI GGATG 1 cut(s) 127
BseLI CCNNNNNNNGG 2 cut(s) 52, 106
BseMI GCAATG 1 cut(s) 244
BseRI GAGGAG 1 cut(s) 293
BseXI GCAGC 1 cut(s) 247
BshFI GGCC 1 cut(s) 45
BsiHKCI CYCGRG 1 cut(s) 116
BslI CCNNNNNNNGG 2 cut(s) 52, 106
BsmAI GTCTC 2 cut(s) 10, 119
BsmBI CGTCTC 1 cut(s) 119
BsnI GGCC 1 cut(s) 45
Bso31I GGTCTC 1 cut(s) 10
BsoBI CYCGRG 1 cut(s) 116
Bsp143I GATC 1 cut(s) 76
BspACI CCGC 1 cut(s) 46
BspANI GGCC 1 cut(s) 45
BspHI TCATGA 1 cut(s) 226
BspTNI GGTCTC 1 cut(s) 10
BsrDI GCAATG 1 cut(s) 244
BssECI CCNNGG 1 cut(s) 232
BssMI GATC 1 cut(s) 76
BssT1I CCWWGG 1 cut(s) 232
Bst4CI ACNGT 1 cut(s) 257
BstDEI CTNAG 1 cut(s) 297
BstF5I GGATG 1 cut(s) 127
BstKTI GATC 1 cut(s) 79
BstMAI GTCTC 2 cut(s) 10, 119
BstMBI GATC 1 cut(s) 76
BstSFI CTRYAG 1 cut(s) 49
BstV1I GCAGC 1 cut(s) 247
BsuRI GGCC 1 cut(s) 45
BtsCI GGATG 1 cut(s) 127
CciI TCATGA 1 cut(s) 226
CseI GACGC 1 cut(s) 101
CviAII CATG 2 cut(s) 158, 227
CviJI RGCY 4 cut(s) 45, 131, 172, 284
CviKI_1 RGCY 4 cut(s) 45, 131, 172, 284
DdeI CTNAG 1 cut(s) 297
DpnI GATC 1 cut(s) 78
DpnII GATC 1 cut(s) 76
EaeI YGGCCR 1 cut(s) 43
Eco130I CCWWGG 1 cut(s) 232
Eco31I GGTCTC 1 cut(s) 10
Eco32I GATATC 1 cut(s) 190
Eco57I CTGAAG 1 cut(s) 107
Eco88I CYCGRG 1 cut(s) 116
EcoRV GATATC 1 cut(s) 190
EcoT14I CCWWGG 1 cut(s) 232
ErhI CCWWGG 1 cut(s) 232
Esp3I CGTCTC 1 cut(s) 119
FaeI CATG 2 cut(s) 161, 230
FaiI YATR 8 cut(s) 12, 51, 66, 104, 159, 215, 228, 288
FalI AAGNNNNNCTT 2 cut(s) 80, 112
FatI CATG 2 cut(s) 157, 226
FbaI TGATCA 1 cut(s) 76
Fnu4HI GCNGC 2 cut(s) 46, 261
FokI GGATG 1 cut(s) 134
Fsp4HI GCNGC 2 cut(s) 46, 261
GluI GCNGC 2 cut(s) 46, 261
HaeIII GGCC 1 cut(s) 45
HgaI GACGC 1 cut(s) 101
Hin1II CATG 2 cut(s) 161, 230
HincII GTYRAC 1 cut(s) 253
HindII GTYRAC 1 cut(s) 253
HphI GGTGA 1 cut(s) 287
Hpy166II GTNNAC 1 cut(s) 253
Hpy188III TCNNGA 5 cut(s) 85, 116, 143, 193, 227
Hpy8I GTNNAC 1 cut(s) 253
HpyAV CCTTC 1 cut(s) 82
HpyCH4III ACNGT 1 cut(s) 257
HpyF3I CTNAG 1 cut(s) 297
Hsp92II CATG 2 cut(s) 161, 230
Ksp22I TGATCA 1 cut(s) 76
Kzo9I GATC 1 cut(s) 76
LmnI GCTCC 1 cut(s) 109
LpnPI CCDG 4 cut(s) 87, 98, 128, 258
Lsp1109I GCAGC 1 cut(s) 247
MalI GATC 1 cut(s) 78
MboI GATC 1 cut(s) 76
MluCI AATT 2 cut(s) 220, 244
MnlI CCTC 6 cut(s) 112, 150, 183, 216, 271, 274
MroXI GAANNNNTTC 1 cut(s) 60
MseI TTAA 2 cut(s) 168, 219
NdeII GATC 1 cut(s) 76
NlaIII CATG 2 cut(s) 161, 230
PaeR7I CTCGAG 1 cut(s) 116
PagI TCATGA 1 cut(s) 226
PdmI GAANNNNTTC 1 cut(s) 60
PkrI GCNGC 2 cut(s) 47, 262
SaqAI TTAA 2 cut(s) 168, 219
SatI GCNGC 2 cut(s) 46, 261
Sau3AI GATC 1 cut(s) 76
SetI ASST 4 cut(s) 41, 62, 133, 214
SfcI CTRYAG 1 cut(s) 49
Sfr274I CTCGAG 1 cut(s) 116
SlaI CTCGAG 1 cut(s) 116
SmlI CTYRAG 1 cut(s) 116
SmoI CTYRAG 1 cut(s) 116
Sse9I AATT 2 cut(s) 220, 244
SsiI CCGC 1 cut(s) 46
StyI CCWWGG 1 cut(s) 232
TaaI ACNGT 1 cut(s) 257
TaqI TCGA 2 cut(s) 117, 182
TasI AATT 2 cut(s) 220, 244
TauI GCSGC 1 cut(s) 48
Tru1I TTAA 2 cut(s) 168, 219
Tru9I TTAA 2 cut(s) 168, 219
TseI GCWGC 1 cut(s) 260
TspDTI ATGAA 4 cut(s) 27, 53, 138, 154
XapI RAATTY 1 cut(s) 244
XhoI CTCGAG 1 cut(s) 116
XmnI GAANNNNTTC 1 cut(s) 60
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.