Rmu_sc0008957.1_g000003

Ribonuclease H protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0008957.1
OG0000182
Physical Location & Seq
Forward (+)
12443 .. 12727
285 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0008957.1_g000003.1.cds

Sequence Viewer

Length: 285 bp
atggttaagatggcaaacggttggttctccctagagtttgcccacctacaagatgtggattttgtgctggctaattgcccttggtttttcaaaggaaggattttccatatcagaaaatgggctccgtcgtttgatcctagggacgtggaaatagaaacccttactctatgggtcaggctccctaacctacccttgcactactggagtgagaaggctatccagcccattgtcagggtcactgggcgttttatccgactcgacaaaatgtcacgccccgaattttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00020 ko00630 ko00720 ko01100 ko01110 ko01120 ko01130 ko01200 ko01210 ko01230 map00020 map00630 map00720 map01100 map01110 map01120 map01130 map01200 map01210 map01230
Pfam Domains
Protein Families
DUF4283 RVT_3

Protein Analysis

94

Amino Acids

11.3

Weight (kDa)

9.42

Isoelectric Point (pI)

53.5

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000182)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g21471 FvH4_1g27953 FvH4_1g28801 FvH4_2g14522 FvH4_3g04280 FvH4_3g28251 FvH4_4g07491 FvH4_4g30262
malus_domestica MD10G1046400.v1.1 MD10G1126900.v1.1 MD11G1236100.v1.1
prunus_persica Prupe.1G148300_v2.0.a1 Prupe.2G036800_v2.0.a1 Prupe.8G054600_v2.0.a1 Prupe.8G054700_v2.0.a1
pyrus_communis pycom05g05520 pycom08g11160 pycom13g29480
rosa_chinensis RchiOBHm_Chr7g0182921 RchiOBHm_Chr7g0230111
rosa_laevigata RLG00000000536 RLG00000001385 RLG00000001492 RLG00000002640 RLG00000003082 RLG00000005042 RLG00000007254 RLG00000007773 RLG00000008594 RLG00000009508 RLG00000010355 RLG00000013369 RLG00000014370 RLG00000014371 RLG00000018745 RLG00000020268 RLG00000020832 RLG00000022569 RLG00000028073 RLG00000028388 RLG00000028677 RLG00000035645
rosa_multiflora Rmu_co8277499.1_g000001 Rmu_co8500999.1_g000001 Rmu_sc0000014.1_g000025 Rmu_sc0000103.1_g000003 Rmu_sc0000168.1_g000019 Rmu_sc0000283.1_g000006 Rmu_sc0000693.1_g000080 Rmu_sc0000997.1_g000005 Rmu_sc0001228.1_g000005 Rmu_sc0001231.1_g000023 Rmu_sc0002833.1_g000037 Rmu_sc0002869.1_g000015 Rmu_sc0003545.1_g000003 Rmu_sc0003693.1_g000028 Rmu_sc0004000.1_g000022 Rmu_sc0004454.1_g000007 Rmu_sc0004976.1_g000036 Rmu_sc0005014.1_g000013 Rmu_sc0005046.1_g000013 Rmu_sc0005063.1_g000009 Rmu_sc0005652.1_g000002 Rmu_sc0005697.1_g000008 Rmu_sc0006989.1_g000014 Rmu_sc0008957.1_g000003 Rmu_sc0011659.1_g000001 Rmu_sc0027477.1_g000001 Rmu_ssc0000387.1_g000021
rosa_roxburghii Rroxscaffold_1G00020860 Rroxscaffold_1G00035780 Rroxscaffold_1G00051370 Rroxscaffold_2G00101730 Rroxscaffold_3G00230130 Rroxscaffold_4G00280070 Rroxscaffold_4G00281160 Rroxscaffold_4G00318780 Rroxscaffold_5G00341570 Rroxscaffold_5G00341580 Rroxscaffold_7G00191230 Rroxscaffold_7G00195880 Rroxscaffold_7G00195890 Rroxscaffold_7G00209080 Rroxscaffold_7G00209090
rosa_rugosa Rorug02G0170400 Rorug03G0234500 Rorug04G0045200 Rorug07G0191000
rosa_samantha Rh1AG012200 Rh1AG012300 Rh1AG021700 Rh1AG033800 Rh1AG033900 Rh1AG048100 Rh1AG087000 Rh1AG168600 Rh1CG004600 Rh2BG192700 Rh2BG200800 Rh2BG310200 Rh2BG356900 Rh2BG377900 Rh2BG378000 Rh2CG356300 Rh2DG394800 Rh3AG199000 Rh3AG258700 Rh3AG258800 Rh3AG324400 Rh3BG202300 Rh3BG202400 Rh3BG228800 Rh3BG318800 Rh3BG360400 Rh3BG368300 Rh3BG373700 Rh4AG071400 Rh4AG153700 Rh4AG224300 Rh4AG224400 Rh4CG044000 Rh4CG077200 Rh4CG077300 Rh4CG238700 Rh4CG238800 Rh4CG238900 Rh5BG367100 Rh5BG379500 Rh5BG379600 Rh5BG396700 Rh5BG412900 Rh5DG427200 Rh6AG015200 Rh6AG015300 Rh6AG122800 Rh6AG175600 Rh6AG187700 Rh6AG187800 Rh6AG260800 Rh6AG355000 Rh6BG074900 Rh6BG102300 Rh7AG127400 Rh7AG157500 Rh7AG157600 Rh7AG212200 Rh7AG331400 Rh7AG412000 Rh7CG055400 Rh7CG131400 Rh7CG131500 Rh7CG224300 Rh7CG267100 Rh7CG348800
rosa_wichuraiana Rw0G009820 Rw1G000520 Rw1G008820 Rw4G014110 Rw4G019370 Rw4G022440 Rw6G010550 Rw7G001520 Rw7G018400 Rw7G025210 Rw7G027910

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 128
AcsI RAATTY 1 cut(s) 278
AfiI CCNNNNNNNGG 1 cut(s) 231
AgsI TTSAA 1 cut(s) 91
AhdI GACNNNNNGTC 1 cut(s) 265
AjiI CACGTC 1 cut(s) 145
AlwI GGATC 1 cut(s) 128
ApoI RAATTY 1 cut(s) 278
AspA2I CCTAGG 1 cut(s) 137
AvrII CCTAGG 1 cut(s) 137
BanII GRGCYC 1 cut(s) 124
BccI CCATC 1 cut(s) 4
BfaI CTAG 2 cut(s) 32, 138
BlnI CCTAGG 1 cut(s) 137
BmeRI GACNNNNNGTC 1 cut(s) 265
BmgBI CACGTC 1 cut(s) 145
BmiI GGNNCC 2 cut(s) 123, 179
BmrI ACTGGG 1 cut(s) 249
BmuI ACTGGG 1 cut(s) 249
BpmI CTGGAG 1 cut(s) 223
BsaJI CCNNGG 2 cut(s) 80, 137
Bsc4I CCNNNNNNNGG 1 cut(s) 231
Bse1I ACTGG 2 cut(s) 206, 244
BseDI CCNNGG 2 cut(s) 80, 137
BseLI CCNNNNNNNGG 1 cut(s) 231
BseNI ACTGG 2 cut(s) 206, 244
BslFI GGGAC 1 cut(s) 155
BslI CCNNNNNNNGG 1 cut(s) 231
BsmFI GGGAC 1 cut(s) 155
Bsp1286I GDGCHC 1 cut(s) 124
Bsp143I GATC 1 cut(s) 133
BspLI GGNNCC 2 cut(s) 123, 179
BspPI GGATC 1 cut(s) 128
BsrI ACTGG 2 cut(s) 206, 244
BssECI CCNNGG 2 cut(s) 80, 137
BssMI GATC 1 cut(s) 133
BssT1I CCWWGG 2 cut(s) 80, 137
Bst4CI ACNGT 1 cut(s) 20
BstC8I GCNNGC 1 cut(s) 69
BstKTI GATC 1 cut(s) 136
BstMBI GATC 1 cut(s) 133
BtrI CACGTC 1 cut(s) 145
BtsIMutI CAGTG 1 cut(s) 237
Cac8I GCNNGC 1 cut(s) 69
CviJI RGCY 5 cut(s) 71, 122, 178, 215, 223
CviKI_1 RGCY 5 cut(s) 71, 122, 178, 215, 223
DpnI GATC 1 cut(s) 135
DpnII GATC 1 cut(s) 133
DriI GACNNNNNGTC 1 cut(s) 265
Eam1105I GACNNNNNGTC 1 cut(s) 265
Eco130I CCWWGG 2 cut(s) 80, 137
Eco24I GRGCYC 1 cut(s) 124
EcoT14I CCWWGG 2 cut(s) 80, 137
EcoT38I GRGCYC 1 cut(s) 124
ErhI CCWWGG 2 cut(s) 80, 137
FaiI YATR 2 cut(s) 108, 169
FaqI GGGAC 1 cut(s) 155
FriOI GRGCYC 1 cut(s) 124
FspBI CTAG 2 cut(s) 32, 138
GsuI CTGGAG 1 cut(s) 223
HinfI GANTC 1 cut(s) 255
Hpy188I TCNGA 2 cut(s) 113, 254
Hpy99I CGWCG 1 cut(s) 130
HpyAV CCTTC 2 cut(s) 90, 205
HpyCH4III ACNGT 1 cut(s) 20
HpyCH4IV ACGT 1 cut(s) 144
HpyCH4V TGCA 1 cut(s) 196
HpySE526I ACGT 1 cut(s) 144
Kzo9I GATC 1 cut(s) 133
LmnI GCTCC 2 cut(s) 127, 183
LpnPI CCDG 6 cut(s) 53, 160, 187, 217, 225, 233
MaeI CTAG 2 cut(s) 32, 138
MaeII ACGT 1 cut(s) 144
MaeIII GTNAC 2 cut(s) 235, 267
MalI GATC 1 cut(s) 135
MboI GATC 1 cut(s) 133
MhlI GDGCHC 1 cut(s) 124
MluCI AATT 2 cut(s) 73, 278
MlyI GAGTC 1 cut(s) 249
MmeI TCCRAC 1 cut(s) 277
MseI TTAA 1 cut(s) 6
NdeII GATC 1 cut(s) 133
NlaIV GGNNCC 2 cut(s) 123, 179
NmuCI GTSAC 2 cut(s) 235, 267
PleI GAGTC 1 cut(s) 249
PpsI GAGTC 1 cut(s) 249
PspN4I GGNNCC 2 cut(s) 123, 179
SaqAI TTAA 1 cut(s) 6
Sau3AI GATC 1 cut(s) 133
SchI GAGTC 1 cut(s) 249
SduI GDGCHC 1 cut(s) 124
SetI ASST 3 cut(s) 48, 147, 189
Sse9I AATT 2 cut(s) 73, 278
SspMI CTAG 2 cut(s) 32, 138
StyI CCWWGG 2 cut(s) 80, 137
TaaI ACNGT 1 cut(s) 20
TaiI ACGT 1 cut(s) 147
TaqI TCGA 1 cut(s) 258
TasI AATT 2 cut(s) 73, 278
Tru1I TTAA 1 cut(s) 6
Tru9I TTAA 1 cut(s) 6
TscAI CASTG 1 cut(s) 244
TseFI GTSAC 2 cut(s) 235, 267
Tsp45I GTSAC 2 cut(s) 235, 267
TspGWI ACGGA 1 cut(s) 114
TspRI CASTG 1 cut(s) 244
XapI RAATTY 1 cut(s) 278
XmaJI CCTAGG 1 cut(s) 137
XspI CTAG 2 cut(s) 32, 138
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.