Rroxscaffold_3G00230130

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
OG0000182
Physical Location & Seq
Reverse (-)
14729310 .. 14730289
980 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00230130.1

Sequence Viewer

Length: 480 bp
ATGGAAATCAATTTGAAGACACCTCTTAAGCGTGTCTTAGTGGTGCATGAGGAGGATGAAGGTGATCTACTTTTTGATATGGTTAGATTCCAAGGCTACTCAGCGGAGAGCACTAATCAAGCTAAAAAATTTACTAGTATGGTTAGAGACCTTGGCAACAAGGGTAAAGTAGTTCTAGGCAGTAAGCCCCAAGCCATGGTGAAGAAAGGTATCTCTTTCAAAGATCCTGCAACTAAAAAAGGTACTATTATCATTAGTGATGATAACAAGTCCGACAACAATAGCAATGATTCTTTGAGTGAGGAAGAGGTGATAAGCGAGTTTGAGAACTTTAGTGATGCTAAGGATACTAATATGGGTAAAAGTGAGGATCTAAATGAGTATGAGGTCAAAATGGTGCATGGAGAGAGGGCTCTTATCTTTAAGACCGATAGTTCCGACATGAGCATTGGATCTAGGAAGCCTACAAGGACATGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

159

Amino Acids

17.84

Weight (kDa)

5.32

Isoelectric Point (pI)

26.04

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000182)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g21471 FvH4_1g27953 FvH4_1g28801 FvH4_2g14522 FvH4_3g04280 FvH4_3g28251 FvH4_4g07491 FvH4_4g30262
malus_domestica MD10G1046400.v1.1 MD10G1126900.v1.1 MD11G1236100.v1.1
prunus_persica Prupe.1G148300_v2.0.a1 Prupe.2G036800_v2.0.a1 Prupe.8G054600_v2.0.a1 Prupe.8G054700_v2.0.a1
pyrus_communis pycom05g05520 pycom08g11160 pycom13g29480
rosa_chinensis RchiOBHm_Chr7g0182921 RchiOBHm_Chr7g0230111
rosa_laevigata RLG00000000536 RLG00000001385 RLG00000001492 RLG00000002640 RLG00000003082 RLG00000005042 RLG00000007254 RLG00000007773 RLG00000008594 RLG00000009508 RLG00000010355 RLG00000013369 RLG00000014370 RLG00000014371 RLG00000018745 RLG00000020268 RLG00000020832 RLG00000022569 RLG00000028073 RLG00000028388 RLG00000028677 RLG00000035645
rosa_multiflora Rmu_co8277499.1_g000001 Rmu_co8500999.1_g000001 Rmu_sc0000014.1_g000025 Rmu_sc0000103.1_g000003 Rmu_sc0000168.1_g000019 Rmu_sc0000283.1_g000006 Rmu_sc0000693.1_g000080 Rmu_sc0000997.1_g000005 Rmu_sc0001228.1_g000005 Rmu_sc0001231.1_g000023 Rmu_sc0002833.1_g000037 Rmu_sc0002869.1_g000015 Rmu_sc0003545.1_g000003 Rmu_sc0003693.1_g000028 Rmu_sc0004000.1_g000022 Rmu_sc0004454.1_g000007 Rmu_sc0004976.1_g000036 Rmu_sc0005014.1_g000013 Rmu_sc0005046.1_g000013 Rmu_sc0005063.1_g000009 Rmu_sc0005652.1_g000002 Rmu_sc0005697.1_g000008 Rmu_sc0006989.1_g000014 Rmu_sc0008957.1_g000003 Rmu_sc0011659.1_g000001 Rmu_sc0027477.1_g000001 Rmu_ssc0000387.1_g000021
rosa_roxburghii Rroxscaffold_1G00020860 Rroxscaffold_1G00035780 Rroxscaffold_1G00051370 Rroxscaffold_2G00101730 Rroxscaffold_3G00230130 Rroxscaffold_4G00280070 Rroxscaffold_4G00281160 Rroxscaffold_4G00318780 Rroxscaffold_5G00341570 Rroxscaffold_5G00341580 Rroxscaffold_7G00191230 Rroxscaffold_7G00195880 Rroxscaffold_7G00195890 Rroxscaffold_7G00209080 Rroxscaffold_7G00209090
rosa_rugosa Rorug02G0170400 Rorug03G0234500 Rorug04G0045200 Rorug07G0191000
rosa_samantha Rh1AG012200 Rh1AG012300 Rh1AG021700 Rh1AG033800 Rh1AG033900 Rh1AG048100 Rh1AG087000 Rh1AG168600 Rh1CG004600 Rh2BG192700 Rh2BG200800 Rh2BG310200 Rh2BG356900 Rh2BG377900 Rh2BG378000 Rh2CG356300 Rh2DG394800 Rh3AG199000 Rh3AG258700 Rh3AG258800 Rh3AG324400 Rh3BG202300 Rh3BG202400 Rh3BG228800 Rh3BG318800 Rh3BG360400 Rh3BG368300 Rh3BG373700 Rh4AG071400 Rh4AG153700 Rh4AG224300 Rh4AG224400 Rh4CG044000 Rh4CG077200 Rh4CG077300 Rh4CG238700 Rh4CG238800 Rh4CG238900 Rh5BG367100 Rh5BG379500 Rh5BG379600 Rh5BG396700 Rh5BG412900 Rh5DG427200 Rh6AG015200 Rh6AG015300 Rh6AG122800 Rh6AG175600 Rh6AG187700 Rh6AG187800 Rh6AG260800 Rh6AG355000 Rh6BG074900 Rh6BG102300 Rh7AG127400 Rh7AG157500 Rh7AG157600 Rh7AG212200 Rh7AG331400 Rh7AG412000 Rh7CG055400 Rh7CG131400 Rh7CG131500 Rh7CG224300 Rh7CG267100 Rh7CG348800
rosa_wichuraiana Rw0G009820 Rw1G000520 Rw1G008820 Rw4G014110 Rw4G019370 Rw4G022440 Rw6G010550 Rw7G001520 Rw7G018400 Rw7G025210 Rw7G027910

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 196
AciI CCGC 1 cut(s) 104
AclWI GGATC 3 cut(s) 218, 378, 460
AcsI RAATTY 1 cut(s) 128
AfaI GTAC 1 cut(s) 244
AfiI CCNNNNNNNGG 1 cut(s) 196
AflII CTTAAG 1 cut(s) 26
AgsI TTSAA 2 cut(s) 16, 220
AhlI ACTAGT 1 cut(s) 134
AluBI AGCT 1 cut(s) 122
AluI AGCT 1 cut(s) 122
Alw21I GWGCWC 1 cut(s) 113
Alw26I GTCTC 1 cut(s) 141
AlwI GGATC 3 cut(s) 218, 378, 460
ApoI RAATTY 1 cut(s) 128
AsuHPI GGTGA 3 cut(s) 74, 211, 322
BanII GRGCYC 1 cut(s) 415
BarI GAAGNNNNNNTAC 2 cut(s) 51, 83
BbsI GAAGAC 1 cut(s) 23
Bbv12I GWGCWC 1 cut(s) 113
BciVI GTATCC 1 cut(s) 340
BcoDI GTCTC 1 cut(s) 141
BcuI ACTAGT 1 cut(s) 134
BfaI CTAG 3 cut(s) 135, 176, 456
BfrI CTTAAG 1 cut(s) 26
BfuI GTATCC 1 cut(s) 340
BmsI GCATC 1 cut(s) 328
BpiI GAAGAC 1 cut(s) 23
Bpu10I CCTNAGC 1 cut(s) 342
BsaI GGTCTC 1 cut(s) 141
BsaJI CCNNGG 3 cut(s) 91, 151, 195
Bsc4I CCNNNNNNNGG 1 cut(s) 196
Bse3DI GCAATG 1 cut(s) 292
BseDI CCNNGG 3 cut(s) 91, 151, 195
BseGI GGATG 1 cut(s) 61
BseLI CCNNNNNNNGG 1 cut(s) 196
BseMI GCAATG 1 cut(s) 292
BseMII CTCAG 1 cut(s) 114
BseRI GAGGAG 1 cut(s) 65
BsiHKAI GWGCWC 1 cut(s) 113
BslI CCNNNNNNNGG 1 cut(s) 196
BsmAI GTCTC 1 cut(s) 141
Bso31I GGTCTC 1 cut(s) 141
Bsp1286I GDGCHC 2 cut(s) 113, 415
Bsp143I GATC 4 cut(s) 64, 223, 370, 452
Bsp19I CCATGG 1 cut(s) 195
BspACI CCGC 1 cut(s) 104
BspCNI CTCAG 1 cut(s) 113
BspPI GGATC 3 cut(s) 218, 378, 460
BspTI CTTAAG 1 cut(s) 26
BspTNI GGTCTC 1 cut(s) 141
BsrDI GCAATG 1 cut(s) 292
BssECI CCNNGG 3 cut(s) 91, 151, 195
BssMI GATC 4 cut(s) 64, 223, 370, 452
BssT1I CCWWGG 3 cut(s) 91, 151, 195
Bst6I CTCTTC 1 cut(s) 300
BstAFI CTTAAG 1 cut(s) 26
BstDEI CTNAG 3 cut(s) 37, 100, 342
BstDSI CCRYGG 1 cut(s) 195
BstF5I GGATG 1 cut(s) 61
BstKTI GATC 4 cut(s) 67, 226, 373, 455
BstMAI GTCTC 1 cut(s) 141
BstMBI GATC 4 cut(s) 64, 223, 370, 452
BstV2I GAAGAC 1 cut(s) 23
BstX2I RGATCY 3 cut(s) 223, 370, 452
BstYI RGATCY 3 cut(s) 223, 370, 452
BsuI GTATCC 1 cut(s) 340
BtgI CCRYGG 1 cut(s) 195
BtsCI GGATG 1 cut(s) 61
Csp6I GTAC 1 cut(s) 243
CviAII CATG 5 cut(s) 47, 196, 401, 442, 474
CviJI RGCY 6 cut(s) 96, 122, 187, 194, 413, 463
CviKI_1 RGCY 6 cut(s) 96, 122, 187, 194, 413, 463
CviQI GTAC 1 cut(s) 243
DdeI CTNAG 3 cut(s) 37, 100, 342
DpnI GATC 4 cut(s) 66, 225, 372, 454
DpnII GATC 4 cut(s) 64, 223, 370, 452
Eam1104I CTCTTC 1 cut(s) 300
EarI CTCTTC 1 cut(s) 300
Eco130I CCWWGG 3 cut(s) 91, 151, 195
Eco24I GRGCYC 1 cut(s) 415
Eco31I GGTCTC 1 cut(s) 141
EcoT14I CCWWGG 3 cut(s) 91, 151, 195
EcoT38I GRGCYC 1 cut(s) 415
ErhI CCWWGG 3 cut(s) 91, 151, 195
FaeI CATG 5 cut(s) 50, 199, 404, 445, 477
FaiI YATR 9 cut(s) 48, 80, 140, 197, 356, 384, 402, 443, 475
FalI AAGNNNNNCTT 2 cut(s) 20, 52
FatI CATG 5 cut(s) 46, 195, 400, 441, 473
FokI GGATG 1 cut(s) 68
FriOI GRGCYC 1 cut(s) 415
FspBI CTAG 3 cut(s) 135, 176, 456
Hin1II CATG 5 cut(s) 50, 199, 404, 445, 477
HinfI GANTC 2 cut(s) 87, 290
HphI GGTGA 3 cut(s) 74, 211, 322
Hpy188I TCNGA 2 cut(s) 274, 439
HpyAV CCTTC 1 cut(s) 53
HpyCH4V TGCA 3 cut(s) 46, 230, 400
HpyF3I CTNAG 3 cut(s) 37, 100, 342
Hsp92II CATG 5 cut(s) 50, 199, 404, 445, 477
Kzo9I GATC 4 cut(s) 64, 223, 370, 452
LpnPI CCDG 1 cut(s) 240
LweI GCATC 1 cut(s) 328
MaeI CTAG 3 cut(s) 135, 176, 456
MalI GATC 4 cut(s) 66, 225, 372, 454
MboI GATC 4 cut(s) 64, 223, 370, 452
MboII GAAGA 3 cut(s) 28, 214, 317
MflI RGATCY 3 cut(s) 223, 370, 452
MhlI GDGCHC 2 cut(s) 113, 415
MluCI AATT 2 cut(s) 10, 128
MmeI TCCRAC 2 cut(s) 297, 462
MnlI CCTC 8 cut(s) 33, 43, 46, 295, 301, 361, 379, 402
MseI TTAA 2 cut(s) 27, 423
MspA1I CMGCKG 1 cut(s) 104
MspCI CTTAAG 1 cut(s) 26
NcoI CCATGG 1 cut(s) 195
NdeII GATC 4 cut(s) 64, 223, 370, 452
NlaIII CATG 5 cut(s) 50, 199, 404, 445, 477
PfeI GAWTC 2 cut(s) 87, 290
PflMI CCANNNNNTGG 1 cut(s) 196
PsuI RGATCY 3 cut(s) 223, 370, 452
RsaI GTAC 1 cut(s) 244
RsaNI GTAC 1 cut(s) 243
SaqAI TTAA 2 cut(s) 27, 423
Sau3AI GATC 4 cut(s) 64, 223, 370, 452
SduI GDGCHC 2 cut(s) 113, 415
SetI ASST 8 cut(s) 25, 64, 124, 153, 211, 244, 312, 390
SfaNI GCATC 1 cut(s) 328
SmlI CTYRAG 1 cut(s) 26
SmoI CTYRAG 1 cut(s) 26
SpeI ACTAGT 1 cut(s) 134
Sse9I AATT 2 cut(s) 10, 128
SsiI CCGC 1 cut(s) 104
SspMI CTAG 3 cut(s) 135, 176, 456
StyI CCWWGG 3 cut(s) 91, 151, 195
TaqII GACCGA 1 cut(s) 443
TasI AATT 2 cut(s) 10, 128
TfiI GAWTC 2 cut(s) 87, 290
Tru1I TTAA 2 cut(s) 27, 423
Tru9I TTAA 2 cut(s) 27, 423
TspDTI ATGAA 1 cut(s) 72
Van91I CCANNNNNTGG 1 cut(s) 196
Vha464I CTTAAG 1 cut(s) 26
XapI RAATTY 1 cut(s) 128
XspI CTAG 3 cut(s) 135, 176, 456
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.