Rmu_sc0000706.1_g000040

TMV resistance protein N-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000706.1
Physical Location & Seq
Reverse (-)
159924 .. 164615
4692 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000706.1_g000040.1.cds

Sequence Viewer

Length: 3480 bp
atggttaggaacagaacagtccatggagcgtcctcttcatcctcatcttcagcattctcctcaaaacattggacctacgacgtgttcttgagcttcagaggtgaggacactcgtaacaactttacgggccacctctacatgacgttgaaagaggctggaatcaacgcctttcttgatgacaatgaacttagaagaggggaaaatataactgtggaactggcgcgggcaatccaaggatcgaggatctctgtaattgtcttctcaaggaggtatgcggattctagttggtgtcttgaggagctggtaaagatcatggagtgtagaagcacactggggcaaatagtcttcccagtgttctttgatgttgatccttcagatgtcaggaaacagagtggtcattttgcagaggcacttgatcagaaacataaagatatagatgaagataaggtgcaaagttggagatctgctcttacagaagctgcagatttgtctggctgggatcttcaaaacacttccgatgggacaattcttgacgagatcactgagtttcttaatcgcccagacttgcatgtagctgaccaccaagttggagtagactctcgcgtggaagatattagttcttatttaggtattggaatattgcatgatgttcgcatggttggaatttggggtatgggtggaattgggaaaacaacaattgcccaggccctttacaacaaatttcgccatagctttgaagcttcaagtttccttgccaacattagggaaactgccaaccaacacaatgggatcagtgtgataaaaaaaagatttggaagcagaagagtgcttgtcattgttgacgatgttgaacatgtggaccaactaaaggcaatatctataaaccgtcgctcatttggtccaggaagtagaattgttattgtaacaagaaataaacatttgctagagcaagttgacgctagcatgagaatatatacggtctgtcaattgaaggaagaagaagctcttgaactatttagttggcatgcctttaaagctccttatcctaatgaagagtacctcgaacactcgagaaatattgttcgttactgtggaggtttgccactagctcttaaagttttaggttgtcatctgttcaaaagaagggtgacattttgggaaagtgcagtgaagaaattggaaataattcctccacatgaaattctggagaagctcaaaataagctttgatgggctaaatgatgacaccgagaaagatacattccttgatatctcatgtttctttattggaatggatatgaactttgtcaaacaaatattggaaggttgtggattttttccagattcaggaattgaggtcctcattcaacgatgtcttctaactgttaatgaggaaagggagttaatgatgcatgatttgcttcgggacatgggtagagaaattgctcgtggaaaatctggtgaaagatcccctcttgaccctggaaaatggagtagagtatggcgctgcgaagatgccacagaagtattgagggaaaattctgggtctgaagaaattcaaggacttgccatgaaaatcctaacagctgataagaaagcaagatttgatacaaaagcatttgcaaagatgaagagattgagattgctccaactcaataatgtacagctcactggaagctacaaatatctttccaagaggttaagatggctctgctggcatcaatgccatctgaaaatcataccaaaagactttattctacaacaactagttgctgtcgacctgcaatatagcaaacttagaatcatttgggaggatcctggggaacttccaaggagtttttataagttaagatctattgaaactcttgttcttgatggctgttcaagatttgagaagttggatgaggacttaggggacatggtatctttgacaactctagatgcaggtaaaacagccataagaagcataccaccttctattgtgaaattgaagaacttgagatgcatttctcttcatgacctcaaacctagtttcaccagtctaatattgcctccttcacttggaggcttaaacttagtaacaaagttatctctgagagggtgcaattcaattggagatgcaattccaaaggatcttggaagtctatattctttaacagatttagacctaggaaacaacagattcaataaacttccaagcttaggtggccttttgaagcttgactgtttgatattggacaattgccatttaactgatgatgcaattccaaatgatcttgggagtttaccaactttgcaaaagctagatctaggttgcaataggttttgtacccttccaagccttagcggcctttccaagcttcaaaatctatttgtgaatgattgcacaaaccttcaggcaatccctgatttaccaacaagtttgacgaacctgaacggagatcactgccaggcactggttagaatgccaaatttttcgaaaatgtcaaatatgaaattcttgcatttaagacattctgccaagctcgttgagattccaggcttggatcagtcactaaactccatgagatatcttcgcatggaaggctgcaccaatatcagtcccactcttaaggagagcatcttacaggcatggacttcggcagggcacggtggcatttttctccctggaaattattttcccgactggttcaaatatgacagcaagggtgcgggtgtctcttttaaactgcctgacaatggcaatttgatagcattgactgtgtgcgttgcttattcttcaaaattggatgattgcatatctactgaaccttctgccatatatgatacaagtcatcgcagtcgaagtacttacatgactcggcccatgcatgcctacggaataactccacatatagattatctctggctggggcatctttcgaacaaaatgttcagtttggactgcggtgacatagttgaggtttttgtaaaacttggacctgattctgatttcaaggtgaagaaaataggggttgattttgtatgggaagatggcgagaatcagctactgcagggaggctcagctttaacctgtaaatgtatcggatatcgtacctttgttgcgcatgctcacaaatttcattggaaggatctacctctgacattagggaaggatgacaatgaggcaggacccagccatgactctactaaggtggaccaacctcccaagagattgaggtatgatcccattgtcatagaactgagtagtgatgctgaggatgatgagtcaggaccttgccttgactcatctaatgaagaccgcccaaccaaaagattgaggtatgatcccattgtcatagaacttagtgatgctgaggatgatgagtcaggaccatgccatgactcatctaatgaagaccgcccaaccaaaagattgaggtgtgatcccattgttatagaactgggtagtgatgatgatgatgacaggactaaaccatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

1159

Amino Acids

130.57

Weight (kDa)

5.94

Isoelectric Point (pI)

46.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000055)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G36930 AT5G36930 AT5G36930 AT5G36930
fragaria_vesca FvH4_3g45361 FvH4_3g45380 FvH4_5g21061 FvH4_5g21062 FvH4_5g21063 FvH4_5g32050 FvH4_5g32970 FvH4_5g32990 FvH4_5g34190 FvH4_5g34210 FvH4_5g34210 FvH4_5g34210 FvH4_5g34210 FvH4_5g34210 FvH4_5g34210 FvH4_5g34211 FvH4_5g34240 FvH4_5g34250
malus_domestica MD00G1011700.v1.1 MD00G1026100.v1.1 MD00G1026500.v1.1 MD00G1027000.v1.1 MD00G1027100.v1.1 MD00G1027700.v1.1 MD00G1027800.v1.1 MD00G1028000.v1.1 MD00G1220000.v1.1 MD02G1024400.v1.1 MD02G1024800.v1.1 MD02G1026000.v1.1 MD02G1026100.v1.1 MD02G1031800.v1.1 MD02G1038500.v1.1 MD02G1038700.v1.1 MD02G1039200.v1.1 MD02G1040600.v1.1 MD02G1040900.v1.1 MD02G1041200.v1.1 MD02G1041300.v1.1 MD02G1041700.v1.1 MD02G1042000.v1.1 MD02G1043800.v1.1 MD02G1043900.v1.1 MD02G1044300.v1.1 MD02G1045200.v1.1 MD02G1045300.v1.1 MD02G1051200.v1.1 MD02G1052200.v1.1 MD02G1052800.v1.1 MD02G1053100.v1.1 MD02G1053600.v1.1 MD02G1055500.v1.1 MD02G1063300.v1.1 MD02G1063400.v1.1 MD02G1063800.v1.1 MD02G1306500.v1.1 MD02G1306600.v1.1 MD02G1306700.v1.1 MD02G1306900.v1.1 MD02G1307200.v1.1 MD04G1011700.v1.1 MD05G1315400.v1.1 MD05G1316000.v1.1 MD05G1316700.v1.1 MD05G1317000.v1.1 MD05G1317300.v1.1 MD05G1317600.v1.1 MD05G1317700.v1.1 MD07G1102800.v1.1 MD07G1238200.v1.1 MD08G1175900.v1.1 MD08G1203600.v1.1 MD09G1024200.v1.1 MD09G1039600.v1.1 MD09G1044800.v1.1 MD09G1045100.v1.1 MD10G1038700.v1.1 MD10G1039000.v1.1 MD10G1039200.v1.1 MD10G1040000.v1.1 MD10G1040200.v1.1 MD10G1040600.v1.1 MD10G1040800.v1.1 MD10G1297300.v1.1 MD12G1247500.v1.1 MD12G1247900.v1.1 MD12G1248300.v1.1 MD12G1248800.v1.1 MD15G1103700.v1.1 MD15G1103800.v1.1 MD15G1104000.v1.1 MD15G1179600.v1.1 MD15G1182500.v1.1 MD16G1068200.v1.1 MD16G1068300.v1.1 MD17G1024600.v1.1 MD17G1024700.v1.1 MD17G1025000.v1.1 MD17G1025900.v1.1
prunus_persica Prupe.1G539800_v2.0.a1 Prupe.1G550800_v2.0.a1 Prupe.1G550800_v2.0.a1 Prupe.1G550800_v2.0.a1 Prupe.1G550800_v2.0.a1 Prupe.1G550800_v2.0.a1 Prupe.1G550800_v2.0.a1 Prupe.1G557100_v2.0.a1 Prupe.1G557200_v2.0.a1 Prupe.1G557200_v2.0.a1 Prupe.1G557300_v2.0.a1
pyrus_communis pycom02g02080 pycom02g02090 pycom02g02110 pycom02g03220 pycom02g03260 pycom02g03370 pycom02g03390 pycom02g03410 pycom02g03420 pycom02g03450 pycom02g03500 pycom02g03730 pycom02g03770 pycom02g04400 pycom02g04410 pycom02g04430 pycom02g04450 pycom02g04460 pycom02g04490 pycom02g05200 pycom02g25710 pycom02g25750 pycom02g25790 pycom02g25810 pycom02g25830 pycom04g00920 pycom04g00930 pycom04g00940 pycom05g29300 pycom05g29310 pycom05g29380 pycom05g29410 pycom07g06310 pycom07g21420 pycom08g15070 pycom08g17540 pycom08g17560 pycom08g17570 pycom10g02670 pycom10g02680 pycom10g02700 pycom10g02770 pycom10g02790 pycom10g02800 pycom10g02810 pycom10g25020 pycom10g25030 pycom10g25050 pycom10g25080 pycom111g01990 pycom111g02000 pycom111g02030 pycom111g02040 pycom111g02050 pycom111g02060 pycom12g22710 pycom12g22720 pycom12g22730 pycom12g22740 pycom12g22750 pycom12g22770 pycom12g22780 pycom12g22790 pycom12g22800 pycom12g22810 pycom12g22830 pycom12g22840 pycom12g22860 pycom15g09440 pycom15g09480 pycom15g16120 pycom15g32380 pycom16g05970 pycom17g02100
rosa_chinensis RchiOBHm_Chr2g0144661 RchiOBHm_Chr4g0407491 RchiOBHm_Chr4g0407501 RchiOBHm_Chr4g0412381 RchiOBHm_Chr7g0208191 RchiOBHm_Chr7g0208201 RchiOBHm_Chr7g0208211 RchiOBHm_Chr7g0208221 RchiOBHm_Chr7g0228071 RchiOBHm_Chr7g0228121 RchiOBHm_Chr7g0230971 RchiOBHm_Chr7g0230981 RchiOBHm_Chr7g0233901 RchiOBHm_Chr7g0233951 RchiOBHm_Chr7g0233961 RchiOBHm_Chr7g0233991 RchiOBHm_Chr7g0234021 RchiOBHm_Chr7g0234151 RchiOBHm_Chr7g0234161 RchiOBHm_Chr7g0234241 RchiOBHm_Chr7g0234501 RchiOBHm_Chr7g0234641 RchiOBHm_Chr7g0234771 RchiOBHm_Chr7g0234781 RchiOBHm_Chr7g0234991 RchiOBHm_Chr7g0241291 RchiOBHm_Chr7g0241301
rosa_laevigata RLG00000001186 RLG00000001187 RLG00000001212 RLG00000001226 RLG00000001233 RLG00000001590 RLG00000003242 RLG00000003243 RLG00000003249 RLG00000008688 RLG00000008690
rosa_multiflora Rmu_co7966574.1_g000001 Rmu_co8120830.1_g000001 Rmu_co8142226.1_g000001 Rmu_co8293083.1_g000001 Rmu_co8351227.1_g000001 Rmu_co8380159.1_g000001 Rmu_co8456505.1_g000001 Rmu_sc0000676.1_g000025 Rmu_sc0000706.1_g000018 Rmu_sc0000706.1_g000040 Rmu_sc0000740.1_g000029 Rmu_sc0000740.1_g000032 Rmu_sc0000740.1_g000037 Rmu_sc0000740.1_g000040 Rmu_sc0000762.1_g000003 Rmu_sc0000762.1_g000019 Rmu_sc0000762.1_g000034 Rmu_sc0000762.1_g000069 Rmu_sc0000892.1_g000001 Rmu_sc0000945.1_g000040 Rmu_sc0001913.1_g000037 Rmu_sc0001913.1_g000041 Rmu_sc0001913.1_g000049 Rmu_sc0002775.1_g000017 Rmu_sc0002775.1_g000018 Rmu_sc0002775.1_g000020 Rmu_sc0002775.1_g000021 Rmu_sc0002775.1_g000022 Rmu_sc0002775.1_g000025 Rmu_sc0002775.1_g000026 Rmu_sc0002775.1_g000028 Rmu_sc0002775.1_g000030 Rmu_sc0004858.1_g000002 Rmu_sc0004864.1_g000022 Rmu_sc0005038.1_g000023 Rmu_sc0005840.1_g000014 Rmu_sc0006724.1_g000003 Rmu_sc0006824.1_g000005 Rmu_sc0007869.1_g000003 Rmu_sc0007869.1_g000005 Rmu_sc0007869.1_g000008 Rmu_sc0008646.1_g000007 Rmu_sc0009637.1_g000009 Rmu_sc0010500.1_g000002 Rmu_sc0010500.1_g000012 Rmu_sc0012403.1_g000025 Rmu_sc0013768.1_g000025 Rmu_sc0015625.1_g000001 Rmu_sc0019715.1_g000001 Rmu_sc0021133.1_g000002 Rmu_sc0021904.1_g000001 Rmu_sc0021904.1_g000003 Rmu_sc0021904.1_g000004 Rmu_sc0022054.1_g000001 Rmu_sc0026025.1_g000001 Rmu_sc0036828.1_g000002 Rmu_sc0041808.1_g000001 Rmu_ssc0000012.1_g000001
rosa_roxburghii Rroxscaffold_3G00226370 Rroxscaffold_3G00226860 Rroxscaffold_3G00226900 Rroxscaffold_3G00226930 Rroxscaffold_3G00226940 Rroxscaffold_3G00226970 Rroxscaffold_3G00226980 Rroxscaffold_3G00231530 Rroxscaffold_3G00237090 Rroxscaffold_3G00250760 Rroxscaffold_3G00250800
rosa_rugosa Rorug04G0082300 Rorug07G0101800 Rorug07G0102000 Rorug07G0102100 Rorug07G0221200 Rorug07G0245700 Rorug07G0245700 Rorug07G0245700 Rorug07G0263900 Rorug07G0264000 Rorug07G0264000 Rorug07G0264500 Rorug07G0282900 Rorug07G0282900 Rorug07G0283100 Rorug07G0283200.1 Rorug07G0283300 Rorug07G0283900 Rorug07G0284000 Rorug07G0284100 Rorug07G0284300 Rorug07G0284400 Rorug07G0284500 Rorug07G0285000 Rorug07G0285200 Rorug07G0285300 Rorug07G0285500 Rorug07G0286800 Rorug07G0286900 Rorug07G0287100 Rorug07G0287200
rosa_samantha Rh7AG236100 Rh7AG236200 Rh7AG236300 Rh7AG440000 Rh7AG440100 Rh7BG411900 Rh7BG412000 Rh7BG412600 Rh7CG251300 Rh7CG417700 Rh7CG460100 Rh7DG242100 Rh7DG242200 Rh7DG242300 Rh7DG429300
rosa_wichuraiana Rw0G005070 Rw0G010780 Rw0G012530 Rw7G020110 Rw7G020160 Rw7G020170 Rw7G033210 Rw7G033230 Rw7G033250 Rw7G034540 Rw7G035150 Rw7G036190 Rw7G036210 Rw7G036260 Rw7G036270 Rw7G036290 Rw7G036300 Rw7G036310 Rw7G036350 Rw7G036360 Rw7G036440 Rw7G036510 Rw7G036530 Rw7G036570 Rw7G036590 Rw7G036730

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 1842
Acc16I TGCGCA 1 cut(s) 3105
Acc36I ACCTGC 2 cut(s) 1788, 1934
AccB7I CCANNNNNTGG 1 cut(s) 2455
AccI GTMKAC 2 cut(s) 594, 1776
AccII CGCG 2 cut(s) 223, 603
AciI CCGC 7 cut(s) 223, 275, 2346, 2711, 2946, 3301, 3400
AcsI RAATTY 8 cut(s) 663, 719, 1200, 1537, 1554, 2470, 2495, 3116
AcuI CTGAAG 5 cut(s) 33, 79, 357, 1569, 2378
AfaI GTAC 5 cut(s) 1058, 1662, 2329, 2848, 3094
AfiI CCNNNNNNNGG 7 cut(s) 762, 868, 1346, 2060, 2201, 2455, 2738
AflII CTTAAG 1 cut(s) 2609
AflIII ACRYGT 2 cut(s) 81, 853
AhlI ACTAGT 1 cut(s) 1765
AjiI CACGTC 1 cut(s) 82
AjnI CCWGG 7 cut(s) 702, 901, 1480, 1816, 2448, 2536, 2665
Alw26I GTCTC 1 cut(s) 2722
AlwNI CAGNNNCTG 3 cut(s) 479, 2455, 3049
Ama87I CYCGRG 1 cut(s) 1069
AoxI GGCC 5 cut(s) 127, 705, 2206, 2347, 2861
ApeKI GCWGC 3 cut(s) 479, 1506, 2586
ApoI RAATTY 8 cut(s) 663, 719, 1200, 1537, 1554, 2470, 2495, 3116
Asp700I GAANNNNTTC 2 cut(s) 1185, 1554
AspA2I CCTAGG 1 cut(s) 2167
AspLEI GCGC 3 cut(s) 223, 1506, 3106
AsuHPI GGTGA 6 cut(s) 113, 1159, 1472, 2026, 2960, 3010
AsuII TTCGAA 2 cut(s) 2477, 2921
AsuNHI GCTAGC 1 cut(s) 959
AvaI CYCGRG 1 cut(s) 1069
AvaII GGWCC 9 cut(s) 72, 859, 899, 1357, 2978, 3170, 3196, 3272, 3371
AvrII CCTAGG 1 cut(s) 2167
BaeGI GKGCMC 1 cut(s) 2649
BamHI GGATCC 1 cut(s) 1813
BauI CACGAG 1 cut(s) 1446
BbsI GAAGAC 5 cut(s) 250, 337, 1367, 3303, 3402
BbvCI CCTCAGC 2 cut(s) 3255, 3354
BbvI GCAGC 3 cut(s) 466, 1493, 2573
BccI CCATC 6 cut(s) 512, 1223, 1698, 1734, 1868, 3026
BcgI CGANNNNNNTGC 4 cut(s) 632, 666, 2619, 2653
BciT130I CCWGG 7 cut(s) 704, 903, 1482, 1818, 2450, 2538, 2667
BclI TGATCA 1 cut(s) 415
BcoDI GTCTC 1 cut(s) 2722
BcuI ACTAGT 1 cut(s) 1765
BfmI CTRYAG 2 cut(s) 480, 3050
BfoI RGCGCY 1 cut(s) 1507
BfrI CTTAAG 1 cut(s) 2609
BfuAI ACCTGC 2 cut(s) 1788, 1934
BglI GCCNNNNNGGC 1 cut(s) 2346
BglII AGATCT 3 cut(s) 461, 1850, 2305
BisI GCNGC 4 cut(s) 480, 1507, 2347, 2587
BlnI CCTAGG 1 cut(s) 2167
BlpI GCTNAGC 1 cut(s) 3061
BlsI GCNGC 4 cut(s) 481, 1508, 2348, 2588
BmcAI AGTACT 1 cut(s) 2848
Bme1390I CCNGG 7 cut(s) 704, 903, 1482, 1818, 2450, 2538, 2667
Bme18I GGWCC 9 cut(s) 72, 859, 899, 1357, 2978, 3170, 3196, 3272, 3371
BmeT110I CYCGRG 1 cut(s) 1069
BmgBI CACGTC 1 cut(s) 82
BmiI GGNNCC 2 cut(s) 1815, 3172
BmrFI CCNGG 7 cut(s) 704, 903, 1482, 1818, 2450, 2538, 2667
BmrI ACTGGG 3 cut(s) 341, 344, 3452
BmtI GCTAGC 1 cut(s) 963
BmuI ACTGGG 3 cut(s) 341, 344, 3452
BpiI GAAGAC 5 cut(s) 250, 337, 1367, 3303, 3402
BplI GAGNNNNNCTC 2 cut(s) 451, 483
BpmI CTGGAG 1 cut(s) 1226
Bpu10I CCTNAGC 4 cut(s) 2200, 2342, 3255, 3354
Bpu1102I GCTNAGC 1 cut(s) 3061
Bpu14I TTCGAA 2 cut(s) 2477, 2921
BpuEI CTTGAG 4 cut(s) 109, 247, 314, 2017
BsaBI GATNNNNATC 1 cut(s) 366
BsaJI CCNNGG 8 cut(s) 22, 232, 702, 1480, 1817, 1829, 2167, 2665
Bsc4I CCNNNNNNNGG 7 cut(s) 762, 868, 1346, 2060, 2201, 2455, 2738
Bse1I ACTGG 8 cut(s) 222, 336, 350, 1675, 2037, 2460, 2690, 3447
Bse8I GATNNNNATC 1 cut(s) 366
BseBI CCWGG 7 cut(s) 704, 903, 1482, 1818, 2450, 2538, 2667
BseDI CCNNGG 8 cut(s) 22, 232, 702, 1480, 1817, 1829, 2167, 2665
BseGI GGATG 6 cut(s) 38, 1906, 2794, 3160, 3265, 3364
BseJI GATNNNNATC 1 cut(s) 366
BseLI CCNNNNNNNGG 7 cut(s) 762, 868, 1346, 2060, 2201, 2455, 2738
BseMII CTCAG 6 cut(s) 534, 2084, 3075, 3233, 3246, 3345
BseNI ACTGG 8 cut(s) 222, 336, 350, 1675, 2037, 2460, 2690, 3447
BseRI GAGGAG 2 cut(s) 49, 311
BseSI GKGCMC 1 cut(s) 2649
BseXI GCAGC 3 cut(s) 466, 1493, 2573
BseYI CCCAGC 3 cut(s) 495, 2908, 3173
BsgI GTGCAG 2 cut(s) 1185, 2572
Bsh1236I CGCG 2 cut(s) 223, 603
BshFI GGCC 5 cut(s) 129, 707, 2208, 2349, 2863
BsiHKCI CYCGRG 1 cut(s) 1069
BslFI GGGAC 4 cut(s) 535, 1439, 1928, 2586
BslI CCNNNNNNNGG 7 cut(s) 762, 868, 1346, 2060, 2201, 2455, 2738
BsmAI GTCTC 1 cut(s) 2722
BsmFI GGGAC 4 cut(s) 535, 1439, 1928, 2586
BsmI GAATGC 2 cut(s) 53, 2469
BsnI GGCC 5 cut(s) 129, 707, 2208, 2349, 2863
BsoBI CYCGRG 1 cut(s) 1069
Bsp119I TTCGAA 2 cut(s) 2477, 2921
Bsp1286I GDGCHC 1 cut(s) 2649
Bsp1407I TGTACA 1 cut(s) 1660
Bsp1720I GCTNAGC 1 cut(s) 3061
Bsp19I CCATGG 1 cut(s) 22
BspACI CCGC 7 cut(s) 223, 275, 2346, 2711, 2946, 3301, 3400
BspANI GGCC 5 cut(s) 129, 707, 2208, 2349, 2863
BspCNI CTCAG 6 cut(s) 535, 2085, 3074, 3234, 3247, 3346
BspFNI CGCG 2 cut(s) 223, 603
BspHI TCATGA 1 cut(s) 2014
BspLI GGNNCC 2 cut(s) 1815, 3172
BspMAI CTGCAG 2 cut(s) 484, 3054
BspMI ACCTGC 2 cut(s) 1788, 1934
BspOI GCTAGC 1 cut(s) 963
BspT104I TTCGAA 2 cut(s) 2477, 2921
BspTI CTTAAG 1 cut(s) 2609
BsrGI TGTACA 1 cut(s) 1660
BsrI ACTGG 8 cut(s) 222, 336, 350, 1675, 2037, 2460, 2690, 3447
BssECI CCNNGG 8 cut(s) 22, 232, 702, 1480, 1817, 1829, 2167, 2665
BssSI CACGAG 1 cut(s) 1446
BssT1I CCWWGG 4 cut(s) 22, 232, 1829, 2167
Bst2BI CACGAG 1 cut(s) 1446
Bst2UI CCWGG 7 cut(s) 704, 903, 1482, 1818, 2450, 2538, 2667
Bst4CI ACNGT 9 cut(s) 19, 211, 887, 979, 1091, 1384, 2225, 2651, 2761
Bst6I CTCTTC 6 cut(s) 40, 187, 817, 1047, 1625, 2016
BstAFI CTTAAG 1 cut(s) 2609
BstAPI GCANNNNNTGC 1 cut(s) 1417
BstAUI TGTACA 1 cut(s) 1660
BstBI TTCGAA 2 cut(s) 2477, 2921
BstC8I GCNNGC 6 cut(s) 225, 961, 1026, 1715, 2871, 3108
BstDSI CCRYGG 1 cut(s) 22
BstF5I GGATG 6 cut(s) 38, 1906, 2794, 3160, 3265, 3364
BstFNI CGCG 2 cut(s) 223, 603
BstH2I RGCGCY 1 cut(s) 1507
BstHHI GCGC 3 cut(s) 223, 1506, 3106
BstMAI GTCTC 1 cut(s) 2722
BstMWI GCNNNNNNNGC 6 cut(s) 1034, 1417, 1714, 2205, 2346, 2583
BstNI CCWGG 7 cut(s) 704, 903, 1482, 1818, 2450, 2538, 2667
BstNSI RCATGY 5 cut(s) 572, 857, 1028, 2873, 3110
BstSCI CCNGG 7 cut(s) 702, 901, 1480, 1816, 2448, 2536, 2665
BstSFI CTRYAG 2 cut(s) 480, 3050
BstSLI GKGCMC 1 cut(s) 2649
BstUI CGCG 2 cut(s) 223, 603
BstV1I GCAGC 3 cut(s) 466, 1493, 2573
BstV2I GAAGAC 5 cut(s) 250, 337, 1367, 3303, 3402
BstX2I RGATCY 9 cut(s) 243, 461, 499, 1466, 1813, 1850, 2131, 2305, 3130
BstXI CCANNNNNNTGG 2 cut(s) 587, 785
BstYI RGATCY 9 cut(s) 243, 461, 499, 1466, 1813, 1850, 2131, 2305, 3130
BsuRI GGCC 5 cut(s) 129, 707, 2208, 2349, 2863
BtgI CCRYGG 1 cut(s) 22
BtgZI GCGATG 1 cut(s) 2819
BtrI CACGTC 1 cut(s) 82
BtsCI GGATG 6 cut(s) 38, 1906, 2794, 3160, 3265, 3364
BtsI GCAGTG 2 cut(s) 1173, 2443
BtsIMutI CAGTG 8 cut(s) 329, 357, 540, 799, 1173, 1668, 2443, 2453
BveI ACCTGC 2 cut(s) 1788, 1934
Cac8I GCNNGC 6 cut(s) 225, 961, 1026, 1715, 2871, 3108
CaiI CAGNNNCTG 3 cut(s) 479, 2455, 3049
CciI TCATGA 1 cut(s) 2014
CfoI GCGC 3 cut(s) 223, 1506, 3106
CseI GACGC 2 cut(s) 18, 965
Csp6I GTAC 5 cut(s) 1057, 1661, 2328, 2847, 3093
CviQI GTAC 5 cut(s) 1057, 1661, 2328, 2847, 3093
DraI TTTAAA 2 cut(s) 1033, 2725
Eam1104I CTCTTC 6 cut(s) 40, 187, 817, 1047, 1625, 2016
EarI CTCTTC 6 cut(s) 40, 187, 817, 1047, 1625, 2016
Eco130I CCWWGG 4 cut(s) 22, 232, 1829, 2167
Eco32I GATATC 3 cut(s) 1270, 2570, 3089
Eco47I GGWCC 9 cut(s) 72, 859, 899, 1357, 2978, 3170, 3196, 3272, 3371
Eco57I CTGAAG 5 cut(s) 33, 79, 357, 1569, 2378
Eco88I CYCGRG 1 cut(s) 1069
EcoO109I RGGNCCY 4 cut(s) 706, 1357, 3170, 3272
EcoRII CCWGG 7 cut(s) 702, 901, 1480, 1816, 2448, 2536, 2665
EcoRV GATATC 3 cut(s) 1270, 2570, 3089
EcoT14I CCWWGG 4 cut(s) 22, 232, 1829, 2167
EcoT22I ATGCAT 3 cut(s) 1413, 2006, 2871
ErhI CCWWGG 4 cut(s) 22, 232, 1829, 2167
FalI AAGNNNNNCTT 2 cut(s) 990, 1022
FaqI GGGAC 4 cut(s) 535, 1439, 1928, 2586
FauI CCCGC 2 cut(s) 216, 2704
FbaI TGATCA 1 cut(s) 415
FblI GTMKAC 2 cut(s) 594, 1776
Fnu4HI GCNGC 4 cut(s) 480, 1507, 2347, 2587
FokI GGATG 6 cut(s) 25, 1913, 2801, 3167, 3272, 3371
Fsp4HI GCNGC 4 cut(s) 480, 1507, 2347, 2587
FspI TGCGCA 1 cut(s) 3105
GlaI GCGC 3 cut(s) 222, 1505, 3105
GluI GCNGC 4 cut(s) 480, 1507, 2347, 2587
GsaI CCCAGC 3 cut(s) 499, 2912, 3177
GsuI CTGGAG 1 cut(s) 1226
HaeII RGCGCY 1 cut(s) 1507
HaeIII GGCC 5 cut(s) 129, 707, 2208, 2349, 2863
HgaI GACGC 2 cut(s) 18, 965
HhaI GCGC 3 cut(s) 223, 1506, 3106
Hin6I GCGC 3 cut(s) 221, 1504, 3104
HinP1I GCGC 3 cut(s) 221, 1504, 3104
HincII GTYRAC 3 cut(s) 841, 955, 1777
HindII GTYRAC 3 cut(s) 841, 955, 1777
HindIII AAGCTT 5 cut(s) 738, 1222, 2197, 2216, 2357
HphI GGTGA 6 cut(s) 113, 1159, 1472, 2026, 2960, 3010
Hpy166II GTNNAC 7 cut(s) 595, 841, 859, 955, 1777, 2285, 3196
Hpy8I GTNNAC 7 cut(s) 595, 841, 859, 955, 1777, 2285, 3196
Hpy99I CGWCG 2 cut(s) 83, 891
HpyCH4III ACNGT 9 cut(s) 19, 211, 887, 979, 1091, 1384, 2225, 2651, 2761
HpyCH4IV ACGT 2 cut(s) 81, 143
HpyF10VI GCNNNNNNNGC 6 cut(s) 1034, 1417, 1714, 2205, 2346, 2583
HpySE526I ACGT 2 cut(s) 81, 143
HspAI GCGC 3 cut(s) 221, 1504, 3104
Ksp22I TGATCA 1 cut(s) 415
LmnI GCTCC 4 cut(s) 26, 298, 1042, 1650
Lsp1109I GCAGC 3 cut(s) 466, 1493, 2573
MaeII ACGT 2 cut(s) 81, 143
MaeIII GTNAC 7 cut(s) 113, 922, 1085, 1147, 2077, 2550, 2948
MfeI CAATTG 4 cut(s) 696, 986, 2109, 2239
MflI RGATCY 9 cut(s) 243, 461, 499, 1466, 1813, 1850, 2131, 2305, 3130
MhlI GDGCHC 1 cut(s) 2649
MlyI GAGTC 7 cut(s) 590, 2851, 3176, 3275, 3278, 3374, 3377
MmeI TCCRAC 5 cut(s) 437, 568, 640, 1672, 1878
Mph1103I ATGCAT 3 cut(s) 1413, 2006, 2871
MroXI GAANNNNTTC 2 cut(s) 1185, 1554
MspA1I CMGCKG 1 cut(s) 1586
MspCI CTTAAG 1 cut(s) 2609
MspR9I CCNGG 7 cut(s) 704, 903, 1482, 1818, 2450, 2538, 2667
MunI CAATTG 4 cut(s) 696, 986, 2109, 2239
Mva1269I GAATGC 2 cut(s) 53, 2469
MvaI CCWGG 7 cut(s) 704, 903, 1482, 1818, 2450, 2538, 2667
MvnI CGCG 2 cut(s) 223, 603
MwoI GCNNNNNNNGC 6 cut(s) 1034, 1417, 1714, 2205, 2346, 2583
NcoI CCATGG 1 cut(s) 22
NheI GCTAGC 1 cut(s) 959
NlaIV GGNNCC 2 cut(s) 1815, 3172
NmeAIII GCCGAG 1 cut(s) 2839
NmuCI GTSAC 3 cut(s) 1147, 2550, 2948
NsbI TGCGCA 1 cut(s) 3105
NsiI ATGCAT 3 cut(s) 1413, 2006, 2871
NspI RCATGY 5 cut(s) 572, 857, 1028, 2873, 3110
NspV TTCGAA 2 cut(s) 2477, 2921
PaeI GCATGC 3 cut(s) 1028, 2873, 3110
PaeR7I CTCGAG 1 cut(s) 1069
PagI TCATGA 1 cut(s) 2014
PciI ACATGT 1 cut(s) 853
PctI GAATGC 2 cut(s) 53, 2469
PdmI GAANNNNTTC 2 cut(s) 1185, 1554
PfeI GAWTC 8 cut(s) 159, 278, 1343, 1800, 2181, 2533, 2984, 3040
PflMI CCANNNNNTGG 1 cut(s) 2455
PfoI TCCNGGA 1 cut(s) 901
PkrI GCNGC 4 cut(s) 481, 1508, 2348, 2588
PleI GAGTC 7 cut(s) 590, 2851, 3176, 3274, 3278, 3373, 3377
PpsI GAGTC 7 cut(s) 590, 2851, 3176, 3274, 3278, 3373, 3377
PpuMI RGGWCCY 3 cut(s) 1357, 3170, 3272
PscI ACATGT 1 cut(s) 853
PsiI TTATAA 1 cut(s) 1842
Psp5II RGGWCCY 3 cut(s) 1357, 3170, 3272
Psp6I CCWGG 7 cut(s) 702, 901, 1480, 1816, 2448, 2536, 2665
PspFI CCCAGC 3 cut(s) 495, 2908, 3173
PspGI CCWGG 7 cut(s) 702, 901, 1480, 1816, 2448, 2536, 2665
PspN4I GGNNCC 2 cut(s) 1815, 3172
PspPPI RGGWCCY 3 cut(s) 1357, 3170, 3272
PstI CTGCAG 2 cut(s) 484, 3054
PstNI CAGNNNCTG 3 cut(s) 479, 2455, 3049
PsuI RGATCY 9 cut(s) 243, 461, 499, 1466, 1813, 1850, 2131, 2305, 3130
PvuII CAGCTG 1 cut(s) 1586
RsaI GTAC 5 cut(s) 1058, 1662, 2329, 2848, 3094
RsaNI GTAC 5 cut(s) 1057, 1661, 2328, 2847, 3093
SalI GTCGAC 1 cut(s) 1775
SatI GCNGC 4 cut(s) 480, 1507, 2347, 2587
ScaI AGTACT 1 cut(s) 2848
SchI GAGTC 7 cut(s) 590, 2851, 3176, 3275, 3278, 3374, 3377
ScrFI CCNGG 7 cut(s) 704, 903, 1482, 1818, 2450, 2538, 2667
SduI GDGCHC 1 cut(s) 2649
SfcI CTRYAG 2 cut(s) 480, 3050
Sfr274I CTCGAG 1 cut(s) 1069
SfuI TTCGAA 2 cut(s) 2477, 2921
SinI GGWCC 9 cut(s) 72, 859, 899, 1357, 2978, 3170, 3196, 3272, 3371
SlaI CTCGAG 1 cut(s) 1069
SmlI CTYRAG 6 cut(s) 88, 262, 293, 1069, 1996, 2609
SmoI CTYRAG 6 cut(s) 88, 262, 293, 1069, 1996, 2609
SpeI ACTAGT 1 cut(s) 1765
SphI GCATGC 3 cut(s) 1028, 2873, 3110
SsiI CCGC 7 cut(s) 223, 275, 2346, 2711, 2946, 3301, 3400
SspI AATATT 4 cut(s) 639, 1078, 1317, 2046
StyD4I CCNGG 7 cut(s) 702, 901, 1480, 1816, 2448, 2536, 2665
StyI CCWWGG 4 cut(s) 22, 232, 1829, 2167
TaaI ACNGT 9 cut(s) 19, 211, 887, 979, 1091, 1384, 2225, 2651, 2761
TaiI ACGT 2 cut(s) 84, 146
TaqI TCGA 7 cut(s) 239, 1062, 1070, 1776, 2477, 2842, 2921
TatI WGTACW 2 cut(s) 1660, 2846
TauI GCSGC 1 cut(s) 2349
TfiI GAWTC 8 cut(s) 159, 278, 1343, 1800, 2181, 2533, 2984, 3040
TscAI CASTG 8 cut(s) 336, 357, 547, 799, 1173, 1675, 2450, 2460
TseFI GTSAC 3 cut(s) 1147, 2550, 2948
TseI GCWGC 3 cut(s) 479, 1506, 2586
Tsp45I GTSAC 3 cut(s) 1147, 2550, 2948
TspGWI ACGGA 2 cut(s) 2451, 2892
TspRI CASTG 8 cut(s) 336, 357, 547, 799, 1173, 1675, 2450, 2460
Van91I CCANNNNNTGG 1 cut(s) 2455
Vha464I CTTAAG 1 cut(s) 2609
VpaK11BI GGWCC 9 cut(s) 72, 859, 899, 1357, 2978, 3170, 3196, 3272, 3371
XapI RAATTY 8 cut(s) 663, 719, 1200, 1537, 1554, 2470, 2495, 3116
XbaI TCTAGA 1 cut(s) 1936
XceI RCATGY 5 cut(s) 572, 857, 1028, 2873, 3110
XhoI CTCGAG 1 cut(s) 1069
XmaJI CCTAGG 1 cut(s) 2167
XmiI GTMKAC 2 cut(s) 594, 1776
XmnI GAANNNNTTC 2 cut(s) 1185, 1554
ZrmI AGTACT 1 cut(s) 2848
Zsp2I ATGCAT 3 cut(s) 1413, 2006, 2871
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.