Rmu_sc0002775.1_g000020

TMV resistance protein N-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002775.1
Physical Location & Seq
Reverse (-)
90402 .. 101332
10931 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002775.1_g000020.1.cds

Sequence Viewer

Length: 4929 bp
atgggggtggctcgaggtctggcaagggagtcctggctgatcggtttgtgcaggttttggtgggtcgtcggagcttccacgacttctggcggcgggatttcgtcggagctctcctggacatgtgatggtggcgtggctatggcggtttttctgggtgatggtggggcagcgcaactttggtggtctgggaggatcgctgcaggggcgaggccatggtcaatctggaccgatcggtgtggcggcatggctaggccattctgtgcgatctcgtgggggcgcggccactacaggtctggaggtgatcgtcggcgctggcggaggacggtttggtggctggctcgggtcaatcttttggtgggccttgggctggactcatctccttgggctgctctcttgggccttattttgggctggttttgtcctagtttttatatttcctttttagttactctaattttccttgctttgggaatcctaggtttaccactggctcttgaagttttggggtcttttctctttaaagggagcaaaagagcttgggagagcacattggagaaattgaaaaaaaatcctgatgacaaaattcaggataagctcagaataagctttgatgcaattgatgagaaccagaaggacatattcctccatatatcttgtttcttaattggaatggataggaactatgccacacaaattctgcacagctgtggttattttccagaaactggaatccgtgtcctccttcaacgttgccttgtaaccgtcagtgaaaaaaacaagctcaggatgcatgatttgcttcgagaaatgggcagagaagttgttcgagcagaatgccccaaacgccctgaaaaacgtagtagattgtggtgccaggaagatgtaatagatgtattgacggaagaatctggcactgaagagattgaaggactcgctttaaatttacaaagaactgacaaaaagagtttcagtacaaaagtatttaccaacatgaggagattgaaattgctccaactcaactatgtacagctcactagaaactacggcaatctttcaaaaaagttaagatggctctgctttcgtggattctcttcaaagttcataggaaaggagtttcttgaccagcgaaacctggtttctatcgacctgcggtacagaaatctcataaaattttgggagcattccaggctgcttgagaagttaaagattcttaatatgagtcattcacatgacctaacacaatcaccagacttttcaaaactcccaaatcttgagtatttgattctaaaagactgtgagagtttgtcagagattcaccagtctattggacatcttaaaagacttgctttgctaaatctaaagaactgcaaaaagctgaatggccttccaaggagtttttataagttgaaatctatcgaaactcttgttctttttggctgttcaagatttgagaatttgggtgaggacattgggaagatgatatcattgacaacgcttcttgtgaatggcacagccatgagtcaagtaccatcctctgtaggaagattgcaaaacctgaactatacatccctgcaaggcctgattcgcgtgaagctaagtttcccggaagtgcctaaaaattattttcctgctctaccacaaggatttaactctttaatttttttgaatttggcgggaagcagtagtggaattagccttccaaaactcagtggcctttccaatcttgaatctctacatttcagtaatatggcaaaccttcctgcaagcagagatttgccaactagtttgaaagagttggaagtggaccactgcaccgcactggatataattccaaatgtttccatcatgtcgaggcacatcctacagcaagtcgtcatttttgcagttctcactcactctgaaacactagaaatggcttcatcctcctcctcttccacaaagacaagttggatgtacgacgtgttcttgagtttccgaggccaagacacacgcaacaacttcacggaccacctctacatggcgttgactcgtgccggagccatgacctttagggattccgaggaactaagaaaaggggaggatatatcaccggcattgatcggggcaatccaagggtctaggatctctctcgtcgtcttctctgagaactatgcgggttcgagttggtgtcttgacgagctgctgcacatcatggagtgtaaaagaacacgggagcaaatggtacacccaatattctatcatgttacaccttcagatgtcaggcatcagaagggtagtttttgcaacgcatttgagaaacatgaagctctaaatagacgaacacaagatgagatatccgggtggagatctgctcttcgacaagctgcaaatttatctggctgggaggtcaagaccgatcagcctgaagcagagtttatcaaacgcattgctcatgagatcagtacactgctgaacaacacctacttacatgtagctatataccccgttggaatagattctcgcattgaagatatcagtaactctttatgtgaaggagtagatgatgatgttcgcatgattggaatttggggtatgggtggaagtgggaaaacttcagttgcgaaagctatctataacaaattttatagtagatttgaaagtaaaagtttcattggaagtgttagggaaactgcaaaggagtcaaacggtaagattactttacaagaaagacttctttatgatatcttaaaaccaaccaaggtggaggtaggtgatgctgatagagggatcattgtgatacaagaaagacttggaagcaaaaaggtacttgtcattgttgatgatgtagatgatctggaccaattaactgcattagctataaggcgtgattcatttggtccaggaagcataattattataacaacaagagatcgacatttgctagagctacttgaagtggatacaatacatccgactagagaaatgaatgaagcagaagctgttgagctctttagttggcatgcctttcacaatccatgtcttgattcaggatttttgaaactcacaaggagagtggttacttactgtggaggtttaccactggctcttgaagttttagggtcttttctctttaaagggagcataagccattgggaaagcacattgaagaagttggaaaagtttcctgatgacaaaattcataaaatcctcaaaataagctttgatgcacttgatgagaaccagaaggacatattcctccacatatcttgtttcttcattagaatggacaagtgccatgtcatacaaatacttgatggctgcgatctttttgcagataacggaatcagtgtcctcattcaacgttgcctagtaactgttagtgaaaaaaacaagctcatgatgcatgacttgcttcgagacatgggcagagaagttgtccgggcagaatcccttaaagaccctgaagaacgtagtagactgtggtgtcaggaagatgtaataaatgtattgacagaaaaatctggaactaaaaagattgaaggactcgccctaaatttgcaaagatctgacaaaaagaggttcaaaacaatagcatttagaaagatgaagagactgaaattgctccaacttaactatgtacagcttgatggagactacaaatatatttccaaacagttaacatggctctgctggcgtggattccctgaagtcatcatacagaaagaatttcttaataatcgaaacctggtgtctatcgacctgcgatacagcaatcttgtaaaactttgggagcatcccaggttgcttgagaagttgaagattcttaatctgagtcattcgcattatctgacgcaatcaccagacttttcaactctcccaaatcttgagtatttgatcgtcaaagactgtgttagtttgccagagatcgacaaatctattggaagtcttgaaaaacttgtcttggtaaatcttaaagactgcataatgcttcaggatcttccagagagtttttatgagttgaaatctatcgaaactcttattctttctggctgttcaggatttaagaatttgggtgagcacattggggagatgatatcactgacaactcttgttgtaagtggcacagccctaagtgcaatacctgaaagtatctctcagctcccaaagcttgagaaactcaacgtcagcaattgtagacagcttcaattgttgcctaaaaggctgccattaagtcttcgatccctgtttgcactaggttgtagtctatcaattgagttgacatttaattgtgtcaagagaacagatgagcgtacagagtgggaacaagttgatcgaataataggttatgcagatggagggctgctctttgaagatgctgcaaatttgtctggctggaatgtctggacagctcagagtgaagcacagcatatcaaacacattgttgatgacatcagtagaaggctgaagaacacctacttacaagtagccgtctacccagttggaatagtttctcgtgttgaagatatcagtaattctttatgtgttggagtagatggaatttggggtatgggtggaagtgggaaaacatcagttgcaaaagctgtctataacaaattttatcatacctttgaaagtaaaagtttccttggaactgttagggaaactgcaaaggagtcaaatgatgatgaagaccaactaactgcattagctataaggcatgattcatttggttggggaagtaggattattagaacgacaagagatctacatttgctagagctacttaaagtggatacagtacatctgactcgagaaatgaaggaagaagaagctcttcagctctttagttggcatgcgtttcgaaatccttgtcctcatttaggatttttggaactcacaaggagagtggttacttactgtggaggtttaccactggctcttgaagtttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

1642

Amino Acids

186.22

Weight (kDa)

8.47

Isoelectric Point (pI)

45.68

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000055)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G36930 AT5G36930 AT5G36930 AT5G36930
fragaria_vesca FvH4_3g45361 FvH4_3g45380 FvH4_5g21061 FvH4_5g21062 FvH4_5g21063 FvH4_5g32050 FvH4_5g32970 FvH4_5g32990 FvH4_5g34190 FvH4_5g34210 FvH4_5g34210 FvH4_5g34210 FvH4_5g34210 FvH4_5g34210 FvH4_5g34210 FvH4_5g34211 FvH4_5g34240 FvH4_5g34250
malus_domestica MD00G1011700.v1.1 MD00G1026100.v1.1 MD00G1026500.v1.1 MD00G1027000.v1.1 MD00G1027100.v1.1 MD00G1027700.v1.1 MD00G1027800.v1.1 MD00G1028000.v1.1 MD00G1220000.v1.1 MD02G1024400.v1.1 MD02G1024800.v1.1 MD02G1026000.v1.1 MD02G1026100.v1.1 MD02G1031800.v1.1 MD02G1038500.v1.1 MD02G1038700.v1.1 MD02G1039200.v1.1 MD02G1040600.v1.1 MD02G1040900.v1.1 MD02G1041200.v1.1 MD02G1041300.v1.1 MD02G1041700.v1.1 MD02G1042000.v1.1 MD02G1043800.v1.1 MD02G1043900.v1.1 MD02G1044300.v1.1 MD02G1045200.v1.1 MD02G1045300.v1.1 MD02G1051200.v1.1 MD02G1052200.v1.1 MD02G1052800.v1.1 MD02G1053100.v1.1 MD02G1053600.v1.1 MD02G1055500.v1.1 MD02G1063300.v1.1 MD02G1063400.v1.1 MD02G1063800.v1.1 MD02G1306500.v1.1 MD02G1306600.v1.1 MD02G1306700.v1.1 MD02G1306900.v1.1 MD02G1307200.v1.1 MD04G1011700.v1.1 MD05G1315400.v1.1 MD05G1316000.v1.1 MD05G1316700.v1.1 MD05G1317000.v1.1 MD05G1317300.v1.1 MD05G1317600.v1.1 MD05G1317700.v1.1 MD07G1102800.v1.1 MD07G1238200.v1.1 MD08G1175900.v1.1 MD08G1203600.v1.1 MD09G1024200.v1.1 MD09G1039600.v1.1 MD09G1044800.v1.1 MD09G1045100.v1.1 MD10G1038700.v1.1 MD10G1039000.v1.1 MD10G1039200.v1.1 MD10G1040000.v1.1 MD10G1040200.v1.1 MD10G1040600.v1.1 MD10G1040800.v1.1 MD10G1297300.v1.1 MD12G1247500.v1.1 MD12G1247900.v1.1 MD12G1248300.v1.1 MD12G1248800.v1.1 MD15G1103700.v1.1 MD15G1103800.v1.1 MD15G1104000.v1.1 MD15G1179600.v1.1 MD15G1182500.v1.1 MD16G1068200.v1.1 MD16G1068300.v1.1 MD17G1024600.v1.1 MD17G1024700.v1.1 MD17G1025000.v1.1 MD17G1025900.v1.1
prunus_persica Prupe.1G539800_v2.0.a1 Prupe.1G550800_v2.0.a1 Prupe.1G550800_v2.0.a1 Prupe.1G550800_v2.0.a1 Prupe.1G550800_v2.0.a1 Prupe.1G550800_v2.0.a1 Prupe.1G550800_v2.0.a1 Prupe.1G557100_v2.0.a1 Prupe.1G557200_v2.0.a1 Prupe.1G557200_v2.0.a1 Prupe.1G557300_v2.0.a1
pyrus_communis pycom02g02080 pycom02g02090 pycom02g02110 pycom02g03220 pycom02g03260 pycom02g03370 pycom02g03390 pycom02g03410 pycom02g03420 pycom02g03450 pycom02g03500 pycom02g03730 pycom02g03770 pycom02g04400 pycom02g04410 pycom02g04430 pycom02g04450 pycom02g04460 pycom02g04490 pycom02g05200 pycom02g25710 pycom02g25750 pycom02g25790 pycom02g25810 pycom02g25830 pycom04g00920 pycom04g00930 pycom04g00940 pycom05g29300 pycom05g29310 pycom05g29380 pycom05g29410 pycom07g06310 pycom07g21420 pycom08g15070 pycom08g17540 pycom08g17560 pycom08g17570 pycom10g02670 pycom10g02680 pycom10g02700 pycom10g02770 pycom10g02790 pycom10g02800 pycom10g02810 pycom10g25020 pycom10g25030 pycom10g25050 pycom10g25080 pycom111g01990 pycom111g02000 pycom111g02030 pycom111g02040 pycom111g02050 pycom111g02060 pycom12g22710 pycom12g22720 pycom12g22730 pycom12g22740 pycom12g22750 pycom12g22770 pycom12g22780 pycom12g22790 pycom12g22800 pycom12g22810 pycom12g22830 pycom12g22840 pycom12g22860 pycom15g09440 pycom15g09480 pycom15g16120 pycom15g32380 pycom16g05970 pycom17g02100
rosa_chinensis RchiOBHm_Chr2g0144661 RchiOBHm_Chr4g0407491 RchiOBHm_Chr4g0407501 RchiOBHm_Chr4g0412381 RchiOBHm_Chr7g0208191 RchiOBHm_Chr7g0208201 RchiOBHm_Chr7g0208211 RchiOBHm_Chr7g0208221 RchiOBHm_Chr7g0228071 RchiOBHm_Chr7g0228121 RchiOBHm_Chr7g0230971 RchiOBHm_Chr7g0230981 RchiOBHm_Chr7g0233901 RchiOBHm_Chr7g0233951 RchiOBHm_Chr7g0233961 RchiOBHm_Chr7g0233991 RchiOBHm_Chr7g0234021 RchiOBHm_Chr7g0234151 RchiOBHm_Chr7g0234161 RchiOBHm_Chr7g0234241 RchiOBHm_Chr7g0234501 RchiOBHm_Chr7g0234641 RchiOBHm_Chr7g0234771 RchiOBHm_Chr7g0234781 RchiOBHm_Chr7g0234991 RchiOBHm_Chr7g0241291 RchiOBHm_Chr7g0241301
rosa_laevigata RLG00000001186 RLG00000001187 RLG00000001212 RLG00000001226 RLG00000001233 RLG00000001590 RLG00000003242 RLG00000003243 RLG00000003249 RLG00000008688 RLG00000008690
rosa_multiflora Rmu_co7966574.1_g000001 Rmu_co8120830.1_g000001 Rmu_co8142226.1_g000001 Rmu_co8293083.1_g000001 Rmu_co8351227.1_g000001 Rmu_co8380159.1_g000001 Rmu_co8456505.1_g000001 Rmu_sc0000676.1_g000025 Rmu_sc0000706.1_g000018 Rmu_sc0000706.1_g000040 Rmu_sc0000740.1_g000029 Rmu_sc0000740.1_g000032 Rmu_sc0000740.1_g000037 Rmu_sc0000740.1_g000040 Rmu_sc0000762.1_g000003 Rmu_sc0000762.1_g000019 Rmu_sc0000762.1_g000034 Rmu_sc0000762.1_g000069 Rmu_sc0000892.1_g000001 Rmu_sc0000945.1_g000040 Rmu_sc0001913.1_g000037 Rmu_sc0001913.1_g000041 Rmu_sc0001913.1_g000049 Rmu_sc0002775.1_g000017 Rmu_sc0002775.1_g000018 Rmu_sc0002775.1_g000020 Rmu_sc0002775.1_g000021 Rmu_sc0002775.1_g000022 Rmu_sc0002775.1_g000025 Rmu_sc0002775.1_g000026 Rmu_sc0002775.1_g000028 Rmu_sc0002775.1_g000030 Rmu_sc0004858.1_g000002 Rmu_sc0004864.1_g000022 Rmu_sc0005038.1_g000023 Rmu_sc0005840.1_g000014 Rmu_sc0006724.1_g000003 Rmu_sc0006824.1_g000005 Rmu_sc0007869.1_g000003 Rmu_sc0007869.1_g000005 Rmu_sc0007869.1_g000008 Rmu_sc0008646.1_g000007 Rmu_sc0009637.1_g000009 Rmu_sc0010500.1_g000002 Rmu_sc0010500.1_g000012 Rmu_sc0012403.1_g000025 Rmu_sc0013768.1_g000025 Rmu_sc0015625.1_g000001 Rmu_sc0019715.1_g000001 Rmu_sc0021133.1_g000002 Rmu_sc0021904.1_g000001 Rmu_sc0021904.1_g000003 Rmu_sc0021904.1_g000004 Rmu_sc0022054.1_g000001 Rmu_sc0026025.1_g000001 Rmu_sc0036828.1_g000002 Rmu_sc0041808.1_g000001 Rmu_ssc0000012.1_g000001
rosa_roxburghii Rroxscaffold_3G00226370 Rroxscaffold_3G00226860 Rroxscaffold_3G00226900 Rroxscaffold_3G00226930 Rroxscaffold_3G00226940 Rroxscaffold_3G00226970 Rroxscaffold_3G00226980 Rroxscaffold_3G00231530 Rroxscaffold_3G00237090 Rroxscaffold_3G00250760 Rroxscaffold_3G00250800
rosa_rugosa Rorug04G0082300 Rorug07G0101800 Rorug07G0102000 Rorug07G0102100 Rorug07G0221200 Rorug07G0245700 Rorug07G0245700 Rorug07G0245700 Rorug07G0263900 Rorug07G0264000 Rorug07G0264000 Rorug07G0264500 Rorug07G0282900 Rorug07G0282900 Rorug07G0283100 Rorug07G0283200.1 Rorug07G0283300 Rorug07G0283900 Rorug07G0284000 Rorug07G0284100 Rorug07G0284300 Rorug07G0284400 Rorug07G0284500 Rorug07G0285000 Rorug07G0285200 Rorug07G0285300 Rorug07G0285500 Rorug07G0286800 Rorug07G0286900 Rorug07G0287100 Rorug07G0287200
rosa_samantha Rh7AG236100 Rh7AG236200 Rh7AG236300 Rh7AG440000 Rh7AG440100 Rh7BG411900 Rh7BG412000 Rh7BG412600 Rh7CG251300 Rh7CG417700 Rh7CG460100 Rh7DG242100 Rh7DG242200 Rh7DG242300 Rh7DG429300
rosa_wichuraiana Rw0G005070 Rw0G010780 Rw0G012530 Rw7G020110 Rw7G020160 Rw7G020170 Rw7G033210 Rw7G033230 Rw7G033250 Rw7G034540 Rw7G035150 Rw7G036190 Rw7G036210 Rw7G036260 Rw7G036270 Rw7G036290 Rw7G036300 Rw7G036310 Rw7G036350 Rw7G036360 Rw7G036440 Rw7G036510 Rw7G036530 Rw7G036570 Rw7G036590 Rw7G036730

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 2 cut(s) 1401, 2897
AasI GACNNNNNNGTC 1 cut(s) 3462
Acc36I ACCTGC 3 cut(s) 42, 1155, 3747
AccB1I GGYRCC 1 cut(s) 870
AccB7I CCANNNNNTGG 1 cut(s) 725
AccI GTMKAC 3 cut(s) 3454, 4174, 4470
AccII CGCG 2 cut(s) 279, 1587
AclI AACGTT 2 cut(s) 748, 3340
AclWI GGATC 5 cut(s) 200, 2129, 2774, 3981, 4212
AcoI YGGCCR 1 cut(s) 280
AcuI CTGAAG 9 cut(s) 936, 2235, 2424, 2577, 3462, 3705, 3953, 4463, 4799
AfiI CCNNNNNNNGG 7 cut(s) 367, 406, 466, 725, 993, 2017, 4859
AflIII ACRYGT 3 cut(s) 119, 1959, 2467
AhlI ACTAGT 1 cut(s) 1781
AjiI CACGTC 1 cut(s) 1960
AjnI CCWGG 8 cut(s) 32, 113, 873, 1131, 1184, 2878, 3723, 3776
AleI CACNNNNGTG 1 cut(s) 705
AloI GAACNNNNNNTCC 2 cut(s) 1550, 1582
Alw21I GWGCWC 4 cut(s) 111, 548, 2988, 4059
Alw26I GTCTC 3 cut(s) 3390, 3583, 3624
AlwI GGATC 5 cut(s) 200, 2129, 2774, 3981, 4212
AlwNI CAGNNNCTG 2 cut(s) 725, 2978
Ama87I CYCGRG 3 cut(s) 12, 339, 4788
AoxI GGCC 9 cut(s) 209, 251, 280, 358, 397, 1381, 1576, 1711, 1978
ArsI GACNNNNNNTTYG 2 cut(s) 4834, 4866
Asp700I GAANNNNTTC 6 cut(s) 822, 2494, 2709, 3159, 4486, 4812
AspA2I CCTAGG 1 cut(s) 475
AspLEI GCGC 3 cut(s) 172, 279, 312
AspS9I GGNCC 7 cut(s) 225, 358, 397, 1804, 2005, 2836, 2876
AsuC2I CCSGG 3 cut(s) 1604, 2338, 3419
AsuHPI GGTGA 9 cut(s) 167, 311, 1236, 1307, 1472, 2079, 2762, 3828, 4064
AsuII TTCGAA 1 cut(s) 4840
AvaI CYCGRG 3 cut(s) 12, 339, 4788
AvaII GGWCC 5 cut(s) 225, 1804, 2005, 2836, 2876
AvrII CCTAGG 1 cut(s) 475
BanI GGYRCC 1 cut(s) 870
BanII GRGCYC 2 cut(s) 111, 2988
BarI GAAGNNNNNNTAC 4 cut(s) 3678, 3710, 4436, 4468
BauI CACGAG 3 cut(s) 268, 2028, 4491
BbsI GAAGAC 3 cut(s) 2128, 4205, 4674
Bbv12I GWGCWC 4 cut(s) 111, 548, 2988, 4059
BccI CCATC 9 cut(s) 119, 152, 1062, 1537, 1850, 3287, 3620, 4325, 4526
BceAI ACGGC 2 cut(s) 1060, 4451
BcgI CGANNNNNNTGC 6 cut(s) 816, 850, 3290, 3324, 4820, 4854
BciT130I CCWGG 8 cut(s) 34, 115, 875, 1133, 1186, 2880, 3725, 3778
BciVI GTATCC 2 cut(s) 2932, 4765
BcnI CCSGG 3 cut(s) 1604, 2338, 3419
BcoDI GTCTC 3 cut(s) 3390, 3583, 3624
BcuI ACTAGT 1 cut(s) 1781
BfmI CTRYAG 4 cut(s) 198, 286, 1536, 1862
BfoI RGCGCY 1 cut(s) 313
BfuAI ACCTGC 3 cut(s) 42, 1155, 3747
BfuI GTATCC 2 cut(s) 2932, 4765
BglI GCCNNNNNGGC 1 cut(s) 4198
BglII AGATCT 3 cut(s) 2345, 3542, 4741
BlnI CCTAGG 1 cut(s) 475
Bme18I GGWCC 5 cut(s) 225, 1804, 2005, 2836, 2876
BmeT110I CYCGRG 3 cut(s) 12, 339, 4788
BmgBI CACGTC 1 cut(s) 1960
BmgT120I GGNCC 7 cut(s) 225, 358, 397, 1804, 2005, 2836, 2876
BmiI GGNNCC 2 cut(s) 872, 2038
BmrI ACTGGG 1 cut(s) 4469
BmsI GCATC 8 cut(s) 601, 777, 2272, 2743, 3193, 3369, 3781, 4342
BmuI ACTGGG 1 cut(s) 4469
BpiI GAAGAC 3 cut(s) 2128, 4205, 4674
BplI GAGNNNNNCTC 4 cut(s) 2335, 2367, 4326, 4358
BpmI CTGGAG 1 cut(s) 315
Bpu10I CCTNAGC 1 cut(s) 782
Bpu14I TTCGAA 1 cut(s) 4840
BpuEI CTTGAG 6 cut(s) 1214, 1292, 1987, 3806, 3884, 4169
BpuMI CCSGG 3 cut(s) 1604, 2338, 3419
Bsc4I CCNNNNNNNGG 7 cut(s) 367, 406, 466, 725, 993, 2017, 4859
Bse118I RCCGGY 1 cut(s) 2089
Bse1I ACTGG 7 cut(s) 492, 730, 1318, 1824, 3084, 4475, 4917
Bse3DI GCAATG 1 cut(s) 2424
BseBI CCWGG 8 cut(s) 34, 115, 875, 1133, 1186, 2880, 3725, 3778
BseGI GGATG 8 cut(s) 792, 1529, 1565, 1857, 1919, 1956, 2947, 3772
BseLI CCNNNNNNNGG 7 cut(s) 367, 406, 466, 725, 993, 2017, 4859
BseMI GCAATG 1 cut(s) 2424
BseMII CTCAG 7 cut(s) 610, 796, 1720, 2133, 3800, 4148, 4403
BseNI ACTGG 7 cut(s) 492, 730, 1318, 1824, 3084, 4475, 4917
BseRI GAGGAG 3 cut(s) 1009, 1915, 1918
BseYI CCCAGC 1 cut(s) 2379
BsgI GTGCAG 4 cut(s) 70, 683, 1795, 2168
Bsh1236I CGCG 2 cut(s) 279, 1587
Bsh1285I CGRYCG 1 cut(s) 232
BshFI GGCC 9 cut(s) 211, 253, 282, 360, 399, 1383, 1578, 1713, 1980
BshNI GGYRCC 1 cut(s) 870
BsiEI CGRYCG 1 cut(s) 232
BsiHKAI GWGCWC 4 cut(s) 111, 548, 2988, 4059
BsiHKCI CYCGRG 3 cut(s) 12, 339, 4788
BsiSI CCGG 5 cut(s) 1604, 2034, 2090, 2337, 3418
BslI CCNNNNNNNGG 7 cut(s) 367, 406, 466, 725, 993, 2017, 4859
BsmAI GTCTC 3 cut(s) 3390, 3583, 3624
BsmI GAATGC 2 cut(s) 839, 1180
BsnI GGCC 9 cut(s) 211, 253, 282, 360, 399, 1383, 1578, 1713, 1980
BsoBI CYCGRG 3 cut(s) 12, 339, 4788
Bsp119I TTCGAA 1 cut(s) 4840
Bsp1286I GDGCHC 4 cut(s) 111, 548, 2988, 4059
Bsp1407I TGTACA 2 cut(s) 1024, 3616
Bsp19I CCATGG 1 cut(s) 212
BspANI GGCC 9 cut(s) 211, 253, 282, 360, 399, 1383, 1578, 1713, 1980
BspCNI CTCAG 7 cut(s) 609, 795, 1719, 2134, 3801, 4147, 4402
BspFNI CGCG 2 cut(s) 279, 1587
BspHI TCATGA 2 cut(s) 2431, 3375
BspLI GGNNCC 2 cut(s) 872, 2038
BspMAI CTGCAG 1 cut(s) 202
BspMI ACCTGC 3 cut(s) 42, 1155, 3747
BspPI GGATC 5 cut(s) 200, 2129, 2774, 3981, 4212
BspQI GCTCTTC 2 cut(s) 2358, 4818
BspT104I TTCGAA 1 cut(s) 4840
BspT107I GGYRCC 1 cut(s) 870
BsrDI GCAATG 1 cut(s) 2424
BsrFI RCCGGY 1 cut(s) 2089
BsrGI TGTACA 2 cut(s) 1024, 3616
BsrI ACTGG 7 cut(s) 492, 730, 1318, 1824, 3084, 4475, 4917
BssAI RCCGGY 1 cut(s) 2089
BssSI CACGAG 3 cut(s) 268, 2028, 4491
BssT1I CCWWGG 8 cut(s) 212, 361, 380, 475, 1388, 2110, 2736, 4624
Bst2BI CACGAG 3 cut(s) 268, 2028, 4491
Bst2UI CCWGG 8 cut(s) 34, 115, 875, 1133, 1186, 2880, 3725, 3778
Bst6I CTCTTC 6 cut(s) 912, 1096, 1936, 2358, 3581, 4818
BstAPI GCANNNNNTGC 2 cut(s) 796, 3388
BstAUI TGTACA 2 cut(s) 1024, 3616
BstBI TTCGAA 1 cut(s) 4840
BstC8I GCNNGC 6 cut(s) 314, 336, 1765, 3000, 3671, 4833
BstDSI CCRYGG 1 cut(s) 212
BstENI CCTNNNNNAGG 1 cut(s) 4857
BstF5I GGATG 8 cut(s) 792, 1529, 1565, 1857, 1919, 1956, 2947, 3772
BstFNI CGCG 2 cut(s) 279, 1587
BstH2I RGCGCY 1 cut(s) 313
BstHHI GCGC 3 cut(s) 172, 279, 312
BstMAI GTCTC 3 cut(s) 3390, 3583, 3624
BstMCI CGRYCG 1 cut(s) 232
BstNI CCWGG 8 cut(s) 34, 115, 875, 1133, 1186, 2880, 3725, 3778
BstNSI RCATGY 4 cut(s) 123, 2471, 3002, 4835
BstSFI CTRYAG 4 cut(s) 198, 286, 1536, 1862
BstUI CGCG 2 cut(s) 279, 1587
BstV2I GAAGAC 3 cut(s) 2128, 4205, 4674
BstX2I RGATCY 5 cut(s) 2121, 2345, 3542, 3973, 4741
BstXI CCANNNNNNTGG 1 cut(s) 1325
BstYI RGATCY 5 cut(s) 2121, 2345, 3542, 3973, 4741
BsuI GTATCC 2 cut(s) 2932, 4765
BsuRI GGCC 9 cut(s) 211, 253, 282, 360, 399, 1383, 1578, 1713, 1980
BtgI CCRYGG 1 cut(s) 212
BtrI CACGTC 1 cut(s) 1960
BtsCI GGATG 8 cut(s) 792, 1529, 1565, 1857, 1919, 1956, 2947, 3772
BtsI GCAGTG 2 cut(s) 1807, 2444
BveI ACCTGC 3 cut(s) 42, 1155, 3747
Cac8I GCNNGC 6 cut(s) 314, 336, 1765, 3000, 3671, 4833
CaiI CAGNNNCTG 2 cut(s) 725, 2978
CciI TCATGA 2 cut(s) 2431, 3375
CfoI GCGC 3 cut(s) 172, 279, 312
Cfr10I RCCGGY 1 cut(s) 2089
Cfr13I GGNCC 7 cut(s) 225, 358, 397, 1804, 2005, 2836, 2876
CseI GACGC 1 cut(s) 3838
CsiI ACCWGGT 2 cut(s) 1131, 3723
DraI TTTAAA 3 cut(s) 520, 939, 3112
DrdI GACNNNNNNGTC 1 cut(s) 3462
DseDI GACNNNNNNGTC 1 cut(s) 3462
EaeI YGGCCR 1 cut(s) 280
Eam1104I CTCTTC 6 cut(s) 912, 1096, 1936, 2358, 3581, 4818
EarI CTCTTC 6 cut(s) 912, 1096, 1936, 2358, 3581, 4818
EciI GGCGGA 1 cut(s) 331
Ecl136II GAGCTC 2 cut(s) 109, 2986
Eco130I CCWWGG 8 cut(s) 212, 361, 380, 475, 1388, 2110, 2736, 4624
Eco147I AGGCCT 1 cut(s) 1578
Eco24I GRGCYC 2 cut(s) 111, 2988
Eco32I GATATC 6 cut(s) 1482, 2334, 2512, 2722, 4074, 4504
Eco47I GGWCC 5 cut(s) 225, 1804, 2005, 2836, 2876
Eco53kI GAGCTC 2 cut(s) 109, 2986
Eco57I CTGAAG 9 cut(s) 936, 2235, 2424, 2577, 3462, 3705, 3953, 4463, 4799
Eco88I CYCGRG 3 cut(s) 12, 339, 4788
EcoICRI GAGCTC 2 cut(s) 109, 2986
EcoNI CCTNNNNNAGG 1 cut(s) 4857
EcoRII CCWGG 8 cut(s) 32, 113, 873, 1131, 1184, 2878, 3723, 3776
EcoRV GATATC 6 cut(s) 1482, 2334, 2512, 2722, 4074, 4504
EcoT14I CCWWGG 8 cut(s) 212, 361, 380, 475, 1388, 2110, 2736, 4624
EcoT22I ATGCAT 2 cut(s) 792, 3384
EcoT38I GRGCYC 2 cut(s) 111, 2988
ErhI CCWWGG 8 cut(s) 212, 361, 380, 475, 1388, 2110, 2736, 4624
FauI CCCGC 3 cut(s) 86, 1666, 2146
FblI GTMKAC 3 cut(s) 3454, 4174, 4470
FokI GGATG 8 cut(s) 799, 1516, 1552, 1844, 1906, 1963, 2934, 3759
FriOI GRGCYC 2 cut(s) 111, 2988
GlaI GCGC 3 cut(s) 171, 278, 311
GsaI CCCAGC 1 cut(s) 2383
GsuI CTGGAG 1 cut(s) 315
HaeII RGCGCY 1 cut(s) 313
HaeIII GGCC 9 cut(s) 211, 253, 282, 360, 399, 1383, 1578, 1713, 1980
HapII CCGG 5 cut(s) 1604, 2034, 2090, 2337, 3418
HgaI GACGC 1 cut(s) 3838
HhaI GCGC 3 cut(s) 172, 279, 312
Hin6I GCGC 3 cut(s) 170, 277, 310
HinP1I GCGC 3 cut(s) 170, 277, 310
HincII GTYRAC 3 cut(s) 2025, 3657, 4257
HindII GTYRAC 3 cut(s) 2025, 3657, 4257
HindIII AAGCTT 3 cut(s) 604, 3196, 4145
HpaI GTTAAC 1 cut(s) 3657
HpaII CCGG 5 cut(s) 1604, 2034, 2090, 2337, 3418
HphI GGTGA 9 cut(s) 167, 311, 1236, 1307, 1472, 2079, 2762, 3828, 4064
Hpy99I CGWCG 5 cut(s) 71, 106, 309, 1961, 2135
HpyCH4IV ACGT 6 cut(s) 748, 856, 1959, 3340, 3448, 4161
HpySE526I ACGT 6 cut(s) 748, 856, 1959, 3340, 3448, 4161
HspAI GCGC 3 cut(s) 170, 277, 310
KspAI GTTAAC 1 cut(s) 3657
LguI GCTCTTC 2 cut(s) 2358, 4818
LweI GCATC 8 cut(s) 601, 777, 2272, 2743, 3193, 3369, 3781, 4342
MabI ACCWGGT 2 cut(s) 1131, 3723
MaeII ACGT 6 cut(s) 748, 856, 1959, 3340, 3448, 4161
MaeIII GTNAC 7 cut(s) 445, 757, 2242, 2516, 3055, 3349, 4888
MfeI CAATTG 4 cut(s) 615, 4168, 4184, 4248
MflI RGATCY 5 cut(s) 2121, 2345, 3542, 3973, 4741
MhlI GDGCHC 4 cut(s) 111, 548, 2988, 4059
Mph1103I ATGCAT 2 cut(s) 792, 3384
MroXI GAANNNNTTC 6 cut(s) 822, 2494, 2709, 3159, 4486, 4812
MslI CAYNNNNRTG 4 cut(s) 705, 1227, 1514, 3260
MspA1I CMGCKG 1 cut(s) 705
MspI CCGG 5 cut(s) 1604, 2034, 2090, 2337, 3418
MunI CAATTG 4 cut(s) 615, 4168, 4184, 4248
Mva1269I GAATGC 2 cut(s) 839, 1180
MvaI CCWGG 8 cut(s) 34, 115, 875, 1133, 1186, 2880, 3725, 3778
MvnI CGCG 2 cut(s) 279, 1587
NciI CCSGG 3 cut(s) 1604, 2338, 3419
NcoI CCATGG 1 cut(s) 212
NlaIV GGNNCC 2 cut(s) 872, 2038
NsiI ATGCAT 2 cut(s) 792, 3384
NspI RCATGY 4 cut(s) 123, 2471, 3002, 4835
NspV TTCGAA 1 cut(s) 4840
OliI CACNNNNGTG 1 cut(s) 705
PaeI GCATGC 2 cut(s) 3002, 4835
PaeR7I CTCGAG 2 cut(s) 12, 4788
PagI TCATGA 2 cut(s) 2431, 3375
PceI AGGCCT 1 cut(s) 1578
PciI ACATGT 2 cut(s) 119, 2467
PciSI GCTCTTC 2 cut(s) 2358, 4818
PctI GAATGC 2 cut(s) 839, 1180
PdmI GAANNNNTTC 6 cut(s) 822, 2494, 2709, 3159, 4486, 4812
PflMI CCANNNNNTGG 1 cut(s) 725
PfoI TCCNGGA 3 cut(s) 113, 1602, 2878
Ple19I CGATCG 1 cut(s) 232
PscI ACATGT 2 cut(s) 119, 2467
PsiI TTATAA 2 cut(s) 1401, 2897
Psp124BI GAGCTC 2 cut(s) 111, 2988
Psp1406I AACGTT 2 cut(s) 748, 3340
Psp6I CCWGG 8 cut(s) 32, 113, 873, 1131, 1184, 2878, 3723, 3776
PspFI CCCAGC 1 cut(s) 2379
PspGI CCWGG 8 cut(s) 32, 113, 873, 1131, 1184, 2878, 3723, 3776
PspN4I GGNNCC 2 cut(s) 872, 2038
PspPI GGNCC 7 cut(s) 225, 358, 397, 1804, 2005, 2836, 2876
PspXI VCTCGAGB 1 cut(s) 12
PsrI GAACNNNNNNTAC 4 cut(s) 1946, 1978, 2444, 2476
PstI CTGCAG 1 cut(s) 202
PstNI CAGNNNCTG 2 cut(s) 725, 2978
PsuI RGATCY 5 cut(s) 2121, 2345, 3542, 3973, 4741
PvuI CGATCG 1 cut(s) 232
PvuII CAGCTG 1 cut(s) 705
RseI CAYNNNNRTG 4 cut(s) 705, 1227, 1514, 3260
SacI GAGCTC 2 cut(s) 111, 2988
SapI GCTCTTC 2 cut(s) 2358, 4818
Sau96I GGNCC 7 cut(s) 225, 358, 397, 1804, 2005, 2836, 2876
SduI GDGCHC 4 cut(s) 111, 548, 2988, 4059
SexAI ACCWGGT 2 cut(s) 1131, 3723
SfaNI GCATC 8 cut(s) 601, 777, 2272, 2743, 3193, 3369, 3781, 4342
SfcI CTRYAG 4 cut(s) 198, 286, 1536, 1862
Sfr274I CTCGAG 2 cut(s) 12, 4788
SfuI TTCGAA 1 cut(s) 4840
SinI GGWCC 5 cut(s) 225, 1804, 2005, 2836, 2876
SlaI CTCGAG 2 cut(s) 12, 4788
SmiMI CAYNNNNRTG 4 cut(s) 705, 1227, 1514, 3260
SmlI CTYRAG 8 cut(s) 12, 1193, 1271, 1966, 3785, 3863, 4148, 4788
SmoI CTYRAG 8 cut(s) 12, 1193, 1271, 1966, 3785, 3863, 4148, 4788
SpeI ACTAGT 1 cut(s) 1781
SphI GCATGC 2 cut(s) 3002, 4835
SseBI AGGCCT 1 cut(s) 1578
SspI AATATT 1 cut(s) 2232
SstI GAGCTC 2 cut(s) 111, 2988
StuI AGGCCT 1 cut(s) 1578
StyI CCWWGG 8 cut(s) 212, 361, 380, 475, 1388, 2110, 2736, 4624
TaiI ACGT 6 cut(s) 751, 859, 1962, 3343, 3451, 4164
TaqII GACCGA 2 cut(s) 242, 2408
TatI WGTACW 5 cut(s) 971, 1024, 2441, 3616, 4777
TauI GCSGC 3 cut(s) 93, 243, 282
TspGWI ACGGA 4 cut(s) 722, 914, 2018, 3333
Van91I CCANNNNNTGG 1 cut(s) 725
VpaK11BI GGWCC 5 cut(s) 225, 1804, 2005, 2836, 2876
XagI CCTNNNNNAGG 1 cut(s) 4857
XceI RCATGY 4 cut(s) 123, 2471, 3002, 4835
XcmI CCANNNNNNNNNTGG 2 cut(s) 219, 290
XhoI CTCGAG 2 cut(s) 12, 4788
XmaJI CCTAGG 1 cut(s) 475
XmiI GTMKAC 3 cut(s) 3454, 4174, 4470
XmnI GAANNNNTTC 6 cut(s) 822, 2494, 2709, 3159, 4486, 4812
Zsp2I ATGCAT 2 cut(s) 792, 3384
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.