Rmu_sc0002775.1_g000018

TMV resistance protein N-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002775.1
Physical Location & Seq
Reverse (-)
86637 .. 87800
1164 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002775.1_g000018.1.cds

Sequence Viewer

Length: 909 bp
atggcttcatcctacgacgtgttcttgagcttcagaggtgtagacacacgaaacaacttcacgagccacctctacagcaaattagtttcatctagaatctttaccttcttcgacgacaacgaactaaggagaggggaagatatatcacagtcattcattacggcaatcgaagggtctaggatctctctcataatcttttcagcgaattatgcgagttcaaaatggtgtcttgatgagctggtgaagatcatggagtgtagaaaaacattggggcaaactgtttttccaatattctatcgtgttgagccttcagatgtcaggcatcagacgggtagttttgcggaggcatttgtacaacataaagctgcaaatagacatgcagagaatgtacccaggtggagagctgctcttcatgaagctgcaaatttgtctggcttccatcttagtagtactactgataggcgtgaggcagagtttatccatgacattgttgacctggttaatagactgcagaccgacacatacttacatgtagccaactacccagttggaatacagtctcgtgtcgaagagattagtagatcattatgtgttggagtagataatgatgttcacatggttggaatttggggtatgggtggaatgggcaaaacaactgttgcaaaaaccatatataacaaattttatcgtagttttgaaggtacatgttttctcgcaaatgttggagaaactgcgaagcagtcaaatggtaagattactttgcaaggaagacttctttctgatatcttaagaccaaccaagatagaagtaggtgatgctgctagagggatcattgtgataaaagaaagactcggaaagaaaaaggtacttgtcatttttgatgatgtagatgatgtggagcaattataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

302

Amino Acids

34.05

Weight (kDa)

7.13

Isoelectric Point (pI)

41.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000055)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G36930 AT5G36930 AT5G36930 AT5G36930
fragaria_vesca FvH4_3g45361 FvH4_3g45380 FvH4_5g21061 FvH4_5g21062 FvH4_5g21063 FvH4_5g32050 FvH4_5g32970 FvH4_5g32990 FvH4_5g34190 FvH4_5g34210 FvH4_5g34210 FvH4_5g34210 FvH4_5g34210 FvH4_5g34210 FvH4_5g34210 FvH4_5g34211 FvH4_5g34240 FvH4_5g34250
malus_domestica MD00G1011700.v1.1 MD00G1026100.v1.1 MD00G1026500.v1.1 MD00G1027000.v1.1 MD00G1027100.v1.1 MD00G1027700.v1.1 MD00G1027800.v1.1 MD00G1028000.v1.1 MD00G1220000.v1.1 MD02G1024400.v1.1 MD02G1024800.v1.1 MD02G1026000.v1.1 MD02G1026100.v1.1 MD02G1031800.v1.1 MD02G1038500.v1.1 MD02G1038700.v1.1 MD02G1039200.v1.1 MD02G1040600.v1.1 MD02G1040900.v1.1 MD02G1041200.v1.1 MD02G1041300.v1.1 MD02G1041700.v1.1 MD02G1042000.v1.1 MD02G1043800.v1.1 MD02G1043900.v1.1 MD02G1044300.v1.1 MD02G1045200.v1.1 MD02G1045300.v1.1 MD02G1051200.v1.1 MD02G1052200.v1.1 MD02G1052800.v1.1 MD02G1053100.v1.1 MD02G1053600.v1.1 MD02G1055500.v1.1 MD02G1063300.v1.1 MD02G1063400.v1.1 MD02G1063800.v1.1 MD02G1306500.v1.1 MD02G1306600.v1.1 MD02G1306700.v1.1 MD02G1306900.v1.1 MD02G1307200.v1.1 MD04G1011700.v1.1 MD05G1315400.v1.1 MD05G1316000.v1.1 MD05G1316700.v1.1 MD05G1317000.v1.1 MD05G1317300.v1.1 MD05G1317600.v1.1 MD05G1317700.v1.1 MD07G1102800.v1.1 MD07G1238200.v1.1 MD08G1175900.v1.1 MD08G1203600.v1.1 MD09G1024200.v1.1 MD09G1039600.v1.1 MD09G1044800.v1.1 MD09G1045100.v1.1 MD10G1038700.v1.1 MD10G1039000.v1.1 MD10G1039200.v1.1 MD10G1040000.v1.1 MD10G1040200.v1.1 MD10G1040600.v1.1 MD10G1040800.v1.1 MD10G1297300.v1.1 MD12G1247500.v1.1 MD12G1247900.v1.1 MD12G1248300.v1.1 MD12G1248800.v1.1 MD15G1103700.v1.1 MD15G1103800.v1.1 MD15G1104000.v1.1 MD15G1179600.v1.1 MD15G1182500.v1.1 MD16G1068200.v1.1 MD16G1068300.v1.1 MD17G1024600.v1.1 MD17G1024700.v1.1 MD17G1025000.v1.1 MD17G1025900.v1.1
prunus_persica Prupe.1G539800_v2.0.a1 Prupe.1G550800_v2.0.a1 Prupe.1G550800_v2.0.a1 Prupe.1G550800_v2.0.a1 Prupe.1G550800_v2.0.a1 Prupe.1G550800_v2.0.a1 Prupe.1G550800_v2.0.a1 Prupe.1G557100_v2.0.a1 Prupe.1G557200_v2.0.a1 Prupe.1G557200_v2.0.a1 Prupe.1G557300_v2.0.a1
pyrus_communis pycom02g02080 pycom02g02090 pycom02g02110 pycom02g03220 pycom02g03260 pycom02g03370 pycom02g03390 pycom02g03410 pycom02g03420 pycom02g03450 pycom02g03500 pycom02g03730 pycom02g03770 pycom02g04400 pycom02g04410 pycom02g04430 pycom02g04450 pycom02g04460 pycom02g04490 pycom02g05200 pycom02g25710 pycom02g25750 pycom02g25790 pycom02g25810 pycom02g25830 pycom04g00920 pycom04g00930 pycom04g00940 pycom05g29300 pycom05g29310 pycom05g29380 pycom05g29410 pycom07g06310 pycom07g21420 pycom08g15070 pycom08g17540 pycom08g17560 pycom08g17570 pycom10g02670 pycom10g02680 pycom10g02700 pycom10g02770 pycom10g02790 pycom10g02800 pycom10g02810 pycom10g25020 pycom10g25030 pycom10g25050 pycom10g25080 pycom111g01990 pycom111g02000 pycom111g02030 pycom111g02040 pycom111g02050 pycom111g02060 pycom12g22710 pycom12g22720 pycom12g22730 pycom12g22740 pycom12g22750 pycom12g22770 pycom12g22780 pycom12g22790 pycom12g22800 pycom12g22810 pycom12g22830 pycom12g22840 pycom12g22860 pycom15g09440 pycom15g09480 pycom15g16120 pycom15g32380 pycom16g05970 pycom17g02100
rosa_chinensis RchiOBHm_Chr2g0144661 RchiOBHm_Chr4g0407491 RchiOBHm_Chr4g0407501 RchiOBHm_Chr4g0412381 RchiOBHm_Chr7g0208191 RchiOBHm_Chr7g0208201 RchiOBHm_Chr7g0208211 RchiOBHm_Chr7g0208221 RchiOBHm_Chr7g0228071 RchiOBHm_Chr7g0228121 RchiOBHm_Chr7g0230971 RchiOBHm_Chr7g0230981 RchiOBHm_Chr7g0233901 RchiOBHm_Chr7g0233951 RchiOBHm_Chr7g0233961 RchiOBHm_Chr7g0233991 RchiOBHm_Chr7g0234021 RchiOBHm_Chr7g0234151 RchiOBHm_Chr7g0234161 RchiOBHm_Chr7g0234241 RchiOBHm_Chr7g0234501 RchiOBHm_Chr7g0234641 RchiOBHm_Chr7g0234771 RchiOBHm_Chr7g0234781 RchiOBHm_Chr7g0234991 RchiOBHm_Chr7g0241291 RchiOBHm_Chr7g0241301
rosa_laevigata RLG00000001186 RLG00000001187 RLG00000001212 RLG00000001226 RLG00000001233 RLG00000001590 RLG00000003242 RLG00000003243 RLG00000003249 RLG00000008688 RLG00000008690
rosa_multiflora Rmu_co7966574.1_g000001 Rmu_co8120830.1_g000001 Rmu_co8142226.1_g000001 Rmu_co8293083.1_g000001 Rmu_co8351227.1_g000001 Rmu_co8380159.1_g000001 Rmu_co8456505.1_g000001 Rmu_sc0000676.1_g000025 Rmu_sc0000706.1_g000018 Rmu_sc0000706.1_g000040 Rmu_sc0000740.1_g000029 Rmu_sc0000740.1_g000032 Rmu_sc0000740.1_g000037 Rmu_sc0000740.1_g000040 Rmu_sc0000762.1_g000003 Rmu_sc0000762.1_g000019 Rmu_sc0000762.1_g000034 Rmu_sc0000762.1_g000069 Rmu_sc0000892.1_g000001 Rmu_sc0000945.1_g000040 Rmu_sc0001913.1_g000037 Rmu_sc0001913.1_g000041 Rmu_sc0001913.1_g000049 Rmu_sc0002775.1_g000017 Rmu_sc0002775.1_g000018 Rmu_sc0002775.1_g000020 Rmu_sc0002775.1_g000021 Rmu_sc0002775.1_g000022 Rmu_sc0002775.1_g000025 Rmu_sc0002775.1_g000026 Rmu_sc0002775.1_g000028 Rmu_sc0002775.1_g000030 Rmu_sc0004858.1_g000002 Rmu_sc0004864.1_g000022 Rmu_sc0005038.1_g000023 Rmu_sc0005840.1_g000014 Rmu_sc0006724.1_g000003 Rmu_sc0006824.1_g000005 Rmu_sc0007869.1_g000003 Rmu_sc0007869.1_g000005 Rmu_sc0007869.1_g000008 Rmu_sc0008646.1_g000007 Rmu_sc0009637.1_g000009 Rmu_sc0010500.1_g000002 Rmu_sc0010500.1_g000012 Rmu_sc0012403.1_g000025 Rmu_sc0013768.1_g000025 Rmu_sc0015625.1_g000001 Rmu_sc0019715.1_g000001 Rmu_sc0021133.1_g000002 Rmu_sc0021904.1_g000001 Rmu_sc0021904.1_g000003 Rmu_sc0021904.1_g000004 Rmu_sc0022054.1_g000001 Rmu_sc0026025.1_g000001 Rmu_sc0036828.1_g000002 Rmu_sc0041808.1_g000001 Rmu_ssc0000012.1_g000001
rosa_roxburghii Rroxscaffold_3G00226370 Rroxscaffold_3G00226860 Rroxscaffold_3G00226900 Rroxscaffold_3G00226930 Rroxscaffold_3G00226940 Rroxscaffold_3G00226970 Rroxscaffold_3G00226980 Rroxscaffold_3G00231530 Rroxscaffold_3G00237090 Rroxscaffold_3G00250760 Rroxscaffold_3G00250800
rosa_rugosa Rorug04G0082300 Rorug07G0101800 Rorug07G0102000 Rorug07G0102100 Rorug07G0221200 Rorug07G0245700 Rorug07G0245700 Rorug07G0245700 Rorug07G0263900 Rorug07G0264000 Rorug07G0264000 Rorug07G0264500 Rorug07G0282900 Rorug07G0282900 Rorug07G0283100 Rorug07G0283200.1 Rorug07G0283300 Rorug07G0283900 Rorug07G0284000 Rorug07G0284100 Rorug07G0284300 Rorug07G0284400 Rorug07G0284500 Rorug07G0285000 Rorug07G0285200 Rorug07G0285300 Rorug07G0285500 Rorug07G0286800 Rorug07G0286900 Rorug07G0287100 Rorug07G0287200
rosa_samantha Rh7AG236100 Rh7AG236200 Rh7AG236300 Rh7AG440000 Rh7AG440100 Rh7BG411900 Rh7BG412000 Rh7BG412600 Rh7CG251300 Rh7CG417700 Rh7CG460100 Rh7DG242100 Rh7DG242200 Rh7DG242300 Rh7DG429300
rosa_wichuraiana Rw0G005070 Rw0G010780 Rw0G012530 Rw7G020110 Rw7G020160 Rw7G020170 Rw7G033210 Rw7G033230 Rw7G033250 Rw7G034540 Rw7G035150 Rw7G036190 Rw7G036210 Rw7G036260 Rw7G036270 Rw7G036290 Rw7G036300 Rw7G036310 Rw7G036350 Rw7G036360 Rw7G036440 Rw7G036510 Rw7G036530 Rw7G036570 Rw7G036590 Rw7G036730

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 907
AccI GTMKAC 1 cut(s) 42
AciI CCGC 1 cut(s) 341
AclWI GGATC 2 cut(s) 188, 836
AcsI RAATTY 3 cut(s) 424, 624, 680
AcuI CTGAAG 2 cut(s) 16, 294
AfaI GTAC 5 cut(s) 354, 390, 451, 703, 867
AflII CTTAAG 1 cut(s) 787
AflIII ACRYGT 3 cut(s) 18, 529, 704
AgsI TTSAA 2 cut(s) 219, 698
AjiI CACGTC 1 cut(s) 19
AjnI CCWGG 2 cut(s) 392, 495
AluBI AGCT 5 cut(s) 30, 238, 365, 404, 419
AluI AGCT 5 cut(s) 30, 238, 365, 404, 419
Alw26I GTCTC 1 cut(s) 564
AlwI GGATC 2 cut(s) 188, 836
ApeKI GCWGC 4 cut(s) 365, 404, 419, 818
ApoI RAATTY 3 cut(s) 424, 624, 680
AsuHPI GGTGA 2 cut(s) 253, 824
BauI CACGAG 2 cut(s) 61, 561
BbsI GAAGAC 1 cut(s) 775
BbvI GCAGC 4 cut(s) 352, 391, 406, 805
BccI CCATC 1 cut(s) 447
BceAI ACGGC 1 cut(s) 177
BciT130I CCWGG 2 cut(s) 394, 497
BcoDI GTCTC 1 cut(s) 564
BfaI CTAG 3 cut(s) 93, 177, 822
BfmI CTRYAG 2 cut(s) 73, 509
BfrI CTTAAG 1 cut(s) 787
BisI GCNGC 4 cut(s) 366, 405, 420, 819
BlsI GCNGC 4 cut(s) 367, 406, 421, 820
BmcAI AGTACT 1 cut(s) 451
Bme1390I CCNGG 2 cut(s) 394, 497
BmgBI CACGTC 1 cut(s) 19
BmrFI CCNGG 2 cut(s) 394, 497
BmrI ACTGGG 1 cut(s) 539
BmsI GCATC 2 cut(s) 331, 805
BmuI ACTGGG 1 cut(s) 539
BpiI GAAGAC 1 cut(s) 775
BplI GAGNNNNNCTC 2 cut(s) 391, 423
BpuEI CTTGAG 1 cut(s) 46
BsaJI CCNNGG 1 cut(s) 392
Bse1I ACTGG 1 cut(s) 545
BseBI CCWGG 2 cut(s) 394, 497
BseDI CCNNGG 1 cut(s) 392
BseGI GGATG 1 cut(s) 8
BseNI ACTGG 1 cut(s) 545
BseXI GCAGC 4 cut(s) 352, 391, 406, 805
BsmAI GTCTC 1 cut(s) 564
Bsp1407I TGTACA 1 cut(s) 352
Bsp143I GATC 4 cut(s) 180, 246, 581, 828
BspACI CCGC 1 cut(s) 341
BspHI TCATGA 1 cut(s) 412
BspMAI CTGCAG 1 cut(s) 513
BspPI GGATC 2 cut(s) 188, 836
BspQI GCTCTTC 1 cut(s) 414
BspTI CTTAAG 1 cut(s) 787
BsrGI TGTACA 1 cut(s) 352
BsrI ACTGG 1 cut(s) 545
BssECI CCNNGG 1 cut(s) 392
BssMI GATC 4 cut(s) 180, 246, 581, 828
BssSI CACGAG 2 cut(s) 61, 561
Bst2BI CACGAG 2 cut(s) 61, 561
Bst2UI CCWGG 2 cut(s) 394, 497
Bst4CI ACNGT 4 cut(s) 150, 280, 558, 658
Bst6I CTCTTC 2 cut(s) 414, 564
BstAFI CTTAAG 1 cut(s) 787
BstAUI TGTACA 1 cut(s) 352
BstDEI CTNAG 2 cut(s) 125, 443
BstF5I GGATG 1 cut(s) 8
BstKTI GATC 4 cut(s) 183, 249, 584, 831
BstMAI GTCTC 1 cut(s) 564
BstMBI GATC 4 cut(s) 180, 246, 581, 828
BstMWI GCNNNNNNNGC 1 cut(s) 209
BstNI CCWGG 2 cut(s) 394, 497
BstNSI RCATGY 3 cut(s) 380, 533, 708
BstSCI CCNGG 2 cut(s) 392, 495
BstSFI CTRYAG 2 cut(s) 73, 509
BstV1I GCAGC 4 cut(s) 352, 391, 406, 805
BstV2I GAAGAC 1 cut(s) 775
BstX2I RGATCY 1 cut(s) 180
BstYI RGATCY 1 cut(s) 180
BtrI CACGTC 1 cut(s) 19
BtsCI GGATG 1 cut(s) 8
CciI TCATGA 1 cut(s) 412
CsiI ACCWGGT 1 cut(s) 495
Csp6I GTAC 5 cut(s) 353, 389, 450, 702, 866
CviAII CATG 7 cut(s) 250, 377, 413, 482, 530, 616, 705
CviQI GTAC 5 cut(s) 353, 389, 450, 702, 866
DdeI CTNAG 2 cut(s) 125, 443
DpnI GATC 4 cut(s) 182, 248, 583, 830
DpnII GATC 4 cut(s) 180, 246, 581, 828
Eam1104I CTCTTC 2 cut(s) 414, 564
EarI CTCTTC 2 cut(s) 414, 564
Eco32I GATATC 1 cut(s) 784
Eco57I CTGAAG 2 cut(s) 16, 294
EcoRII CCWGG 2 cut(s) 392, 495
EcoRV GATATC 1 cut(s) 784
FaeI CATG 7 cut(s) 253, 380, 416, 485, 533, 619, 708
FalI AAGNNNNNCTT 2 cut(s) 756, 788
FatI CATG 7 cut(s) 249, 376, 412, 481, 529, 615, 704
FblI GTMKAC 1 cut(s) 42
Fnu4HI GCNGC 4 cut(s) 366, 405, 420, 819
Fsp4HI GCNGC 4 cut(s) 366, 405, 420, 819
FspBI CTAG 3 cut(s) 93, 177, 822
GluI GCNGC 4 cut(s) 366, 405, 420, 819
Hin1II CATG 7 cut(s) 253, 380, 416, 485, 533, 619, 708
HincII GTYRAC 1 cut(s) 493
HindII GTYRAC 1 cut(s) 493
HinfI GANTC 2 cut(s) 96, 849
HphI GGTGA 2 cut(s) 253, 824
Hpy166II GTNNAC 3 cut(s) 43, 493, 613
Hpy188I TCNGA 5 cut(s) 35, 313, 327, 781, 854
Hpy188III TCNNGA 5 cut(s) 25, 61, 93, 230, 413
Hpy8I GTNNAC 3 cut(s) 43, 493, 613
Hpy99I CGWCG 2 cut(s) 20, 116
HpyAV CCTTC 4 cut(s) 115, 164, 318, 692
HpyCH4III ACNGT 4 cut(s) 150, 280, 558, 658
HpyCH4IV ACGT 1 cut(s) 18
HpyCH4V TGCA 6 cut(s) 368, 380, 422, 511, 662, 763
HpyF10VI GCNNNNNNNGC 1 cut(s) 209
HpyF3I CTNAG 2 cut(s) 125, 443
HpySE526I ACGT 1 cut(s) 18
Hsp92II CATG 7 cut(s) 253, 380, 416, 485, 533, 619, 708
Kzo9I GATC 4 cut(s) 180, 246, 581, 828
LguI GCTCTTC 1 cut(s) 414
LmnI GCTCC 1 cut(s) 898
LpnPI CCDG 8 cut(s) 224, 304, 379, 406, 417, 482, 509, 558
Lsp1109I GCAGC 4 cut(s) 352, 391, 406, 805
LweI GCATC 2 cut(s) 331, 805
MabI ACCWGGT 1 cut(s) 495
MaeI CTAG 3 cut(s) 93, 177, 822
MaeII ACGT 1 cut(s) 18
MalI GATC 4 cut(s) 182, 248, 583, 830
MboI GATC 4 cut(s) 180, 246, 581, 828
MboII GAAGA 6 cut(s) 100, 149, 256, 401, 581, 780
MflI RGATCY 1 cut(s) 180
MluCI AATT 6 cut(s) 80, 205, 424, 624, 680, 902
MlyI GAGTC 1 cut(s) 843
MmeI TCCRAC 4 cut(s) 529, 574, 601, 703
MnlI CCTC 6 cut(s) 29, 80, 125, 337, 460, 818
MseI TTAA 2 cut(s) 501, 788
MspCI CTTAAG 1 cut(s) 787
MspR9I CCNGG 2 cut(s) 394, 497
MvaI CCWGG 2 cut(s) 394, 497
MwoI GCNNNNNNNGC 1 cut(s) 209
NdeII GATC 4 cut(s) 180, 246, 581, 828
NlaIII CATG 7 cut(s) 253, 380, 416, 485, 533, 619, 708
NspI RCATGY 3 cut(s) 380, 533, 708
PagI TCATGA 1 cut(s) 412
PciI ACATGT 2 cut(s) 529, 704
PciSI GCTCTTC 1 cut(s) 414
PcsI WCGNNNNNNNCGW 1 cut(s) 117
PfeI GAWTC 1 cut(s) 96
PkrI GCNGC 4 cut(s) 367, 406, 421, 820
PleI GAGTC 1 cut(s) 843
PpsI GAGTC 1 cut(s) 843
PscI ACATGT 2 cut(s) 529, 704
PsiI TTATAA 1 cut(s) 907
Psp6I CCWGG 2 cut(s) 392, 495
PspGI CCWGG 2 cut(s) 392, 495
PstI CTGCAG 1 cut(s) 513
PsuI RGATCY 1 cut(s) 180
RsaI GTAC 5 cut(s) 354, 390, 451, 703, 867
RsaNI GTAC 5 cut(s) 353, 389, 450, 702, 866
SapI GCTCTTC 1 cut(s) 414
SaqAI TTAA 2 cut(s) 501, 788
SatI GCNGC 4 cut(s) 366, 405, 420, 819
Sau3AI GATC 4 cut(s) 180, 246, 581, 828
ScaI AGTACT 1 cut(s) 451
SchI GAGTC 1 cut(s) 843
ScrFI CCNGG 2 cut(s) 394, 497
SexAI ACCWGGT 1 cut(s) 495
SfaNI GCATC 2 cut(s) 331, 805
SfcI CTRYAG 2 cut(s) 73, 509
SmlI CTYRAG 2 cut(s) 25, 787
SmoI CTYRAG 2 cut(s) 25, 787
Sse9I AATT 6 cut(s) 80, 205, 424, 624, 680, 902
SsiI CCGC 1 cut(s) 341
SspI AATATT 1 cut(s) 291
SspMI CTAG 3 cut(s) 93, 177, 822
StyD4I CCNGG 2 cut(s) 392, 495
TaaI ACNGT 4 cut(s) 150, 280, 558, 658
TaiI ACGT 1 cut(s) 21
TaqI TCGA 3 cut(s) 111, 168, 567
TaqII GACCGA 1 cut(s) 530
TasI AATT 6 cut(s) 80, 205, 424, 624, 680, 902
TatI WGTACW 2 cut(s) 352, 449
TfiI GAWTC 1 cut(s) 96
Tru1I TTAA 2 cut(s) 501, 788
Tru9I TTAA 2 cut(s) 501, 788
TseI GCWGC 4 cut(s) 365, 404, 419, 818
TspDTI ATGAA 4 cut(s) 78, 145, 401, 429
Vha464I CTTAAG 1 cut(s) 787
XapI RAATTY 3 cut(s) 424, 624, 680
XbaI TCTAGA 1 cut(s) 92
XceI RCATGY 3 cut(s) 380, 533, 708
XmiI GTMKAC 1 cut(s) 42
XspI CTAG 3 cut(s) 93, 177, 822
ZrmI AGTACT 1 cut(s) 451
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.