Rmu_sc0007869.1_g000003

regulation of response to stimulus

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007869.1
Physical Location & Seq
Forward (+)
11007 .. 12883
1877 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007869.1_g000003.1.cds

Sequence Viewer

Length: 1134 bp
atgacatcgttgtctactctgcgtgcaaatgaaacagccataacagaactgccgtcttccattgtgagattaaagaaccttagatgtttatctctactacattggtcttccattacaggtttcaaaaggattaccttgaaatctctagtgtcgacacctaattttcatgatctcaatttgcctccttcggttcaaggcttaagctctttagttgatctatctttcaatggctgcattataactaatgttcctaaggatcttggaagtctatcttccttggaaagtttagatataagacactgttacttgcaaagcctgccaagcctcagtggcctctcccagcttgaatacctatgcttacttgattgcaatcttgggagtctatcttctttgacattgttgcgtctagatgataacagtttcagtagacttccaagcctccacagccattctaaacttgtcaatctaagtttgagaagttgtacaaaccttgttgcaattccatatttaccaacaagtgtgaagaacctctgcgcctccgactgcactgtattgcaaataatgcccgacttttcagacatgtccaatatgagacagagcagatgtgcgaaactcgttgaggttccaggcttggatgaatctttggtacagggatggaatttcataggacctggtggcatatatttcccaaggaatgatattccgaattggttgacgtgggccaatgatggtgccacagtcaattttcaagtacctcaaattagcaactgtaatgtaatagcgttgactctctgcttcactcttctggacaatggtgtagatcaaggtcgtctttttcctgataccttagggctatgggttacaaatcataccaagcgcactagcttcttcaaccattcagagaattattttgaagaatcttccaggttatgccagcacttttggctaggacatatttcaaacaataagttcaatttcgaaggcggtgacttggttgaagtgtttgtaagagttaaatccgagtatgttaaggtggagaaaacaggggtcagtcttgtatgggataccaaacaggctgattttagagttgctactccagaagccatgtatgacctgaaaagacccatttgttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

377

Amino Acids

42.09

Weight (kDa)

6.3

Isoelectric Point (pI)

39.09

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000055)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G36930 AT5G36930 AT5G36930 AT5G36930
fragaria_vesca FvH4_3g45361 FvH4_3g45380 FvH4_5g21061 FvH4_5g21062 FvH4_5g21063 FvH4_5g32050 FvH4_5g32970 FvH4_5g32990 FvH4_5g34190 FvH4_5g34210 FvH4_5g34210 FvH4_5g34210 FvH4_5g34210 FvH4_5g34210 FvH4_5g34210 FvH4_5g34211 FvH4_5g34240 FvH4_5g34250
malus_domestica MD00G1011700.v1.1 MD00G1026100.v1.1 MD00G1026500.v1.1 MD00G1027000.v1.1 MD00G1027100.v1.1 MD00G1027700.v1.1 MD00G1027800.v1.1 MD00G1028000.v1.1 MD00G1220000.v1.1 MD02G1024400.v1.1 MD02G1024800.v1.1 MD02G1026000.v1.1 MD02G1026100.v1.1 MD02G1031800.v1.1 MD02G1038500.v1.1 MD02G1038700.v1.1 MD02G1039200.v1.1 MD02G1040600.v1.1 MD02G1040900.v1.1 MD02G1041200.v1.1 MD02G1041300.v1.1 MD02G1041700.v1.1 MD02G1042000.v1.1 MD02G1043800.v1.1 MD02G1043900.v1.1 MD02G1044300.v1.1 MD02G1045200.v1.1 MD02G1045300.v1.1 MD02G1051200.v1.1 MD02G1052200.v1.1 MD02G1052800.v1.1 MD02G1053100.v1.1 MD02G1053600.v1.1 MD02G1055500.v1.1 MD02G1063300.v1.1 MD02G1063400.v1.1 MD02G1063800.v1.1 MD02G1306500.v1.1 MD02G1306600.v1.1 MD02G1306700.v1.1 MD02G1306900.v1.1 MD02G1307200.v1.1 MD04G1011700.v1.1 MD05G1315400.v1.1 MD05G1316000.v1.1 MD05G1316700.v1.1 MD05G1317000.v1.1 MD05G1317300.v1.1 MD05G1317600.v1.1 MD05G1317700.v1.1 MD07G1102800.v1.1 MD07G1238200.v1.1 MD08G1175900.v1.1 MD08G1203600.v1.1 MD09G1024200.v1.1 MD09G1039600.v1.1 MD09G1044800.v1.1 MD09G1045100.v1.1 MD10G1038700.v1.1 MD10G1039000.v1.1 MD10G1039200.v1.1 MD10G1040000.v1.1 MD10G1040200.v1.1 MD10G1040600.v1.1 MD10G1040800.v1.1 MD10G1297300.v1.1 MD12G1247500.v1.1 MD12G1247900.v1.1 MD12G1248300.v1.1 MD12G1248800.v1.1 MD15G1103700.v1.1 MD15G1103800.v1.1 MD15G1104000.v1.1 MD15G1179600.v1.1 MD15G1182500.v1.1 MD16G1068200.v1.1 MD16G1068300.v1.1 MD17G1024600.v1.1 MD17G1024700.v1.1 MD17G1025000.v1.1 MD17G1025900.v1.1
prunus_persica Prupe.1G539800_v2.0.a1 Prupe.1G550800_v2.0.a1 Prupe.1G550800_v2.0.a1 Prupe.1G550800_v2.0.a1 Prupe.1G550800_v2.0.a1 Prupe.1G550800_v2.0.a1 Prupe.1G550800_v2.0.a1 Prupe.1G557100_v2.0.a1 Prupe.1G557200_v2.0.a1 Prupe.1G557200_v2.0.a1 Prupe.1G557300_v2.0.a1
pyrus_communis pycom02g02080 pycom02g02090 pycom02g02110 pycom02g03220 pycom02g03260 pycom02g03370 pycom02g03390 pycom02g03410 pycom02g03420 pycom02g03450 pycom02g03500 pycom02g03730 pycom02g03770 pycom02g04400 pycom02g04410 pycom02g04430 pycom02g04450 pycom02g04460 pycom02g04490 pycom02g05200 pycom02g25710 pycom02g25750 pycom02g25790 pycom02g25810 pycom02g25830 pycom04g00920 pycom04g00930 pycom04g00940 pycom05g29300 pycom05g29310 pycom05g29380 pycom05g29410 pycom07g06310 pycom07g21420 pycom08g15070 pycom08g17540 pycom08g17560 pycom08g17570 pycom10g02670 pycom10g02680 pycom10g02700 pycom10g02770 pycom10g02790 pycom10g02800 pycom10g02810 pycom10g25020 pycom10g25030 pycom10g25050 pycom10g25080 pycom111g01990 pycom111g02000 pycom111g02030 pycom111g02040 pycom111g02050 pycom111g02060 pycom12g22710 pycom12g22720 pycom12g22730 pycom12g22740 pycom12g22750 pycom12g22770 pycom12g22780 pycom12g22790 pycom12g22800 pycom12g22810 pycom12g22830 pycom12g22840 pycom12g22860 pycom15g09440 pycom15g09480 pycom15g16120 pycom15g32380 pycom16g05970 pycom17g02100
rosa_chinensis RchiOBHm_Chr2g0144661 RchiOBHm_Chr4g0407491 RchiOBHm_Chr4g0407501 RchiOBHm_Chr4g0412381 RchiOBHm_Chr7g0208191 RchiOBHm_Chr7g0208201 RchiOBHm_Chr7g0208211 RchiOBHm_Chr7g0208221 RchiOBHm_Chr7g0228071 RchiOBHm_Chr7g0228121 RchiOBHm_Chr7g0230971 RchiOBHm_Chr7g0230981 RchiOBHm_Chr7g0233901 RchiOBHm_Chr7g0233951 RchiOBHm_Chr7g0233961 RchiOBHm_Chr7g0233991 RchiOBHm_Chr7g0234021 RchiOBHm_Chr7g0234151 RchiOBHm_Chr7g0234161 RchiOBHm_Chr7g0234241 RchiOBHm_Chr7g0234501 RchiOBHm_Chr7g0234641 RchiOBHm_Chr7g0234771 RchiOBHm_Chr7g0234781 RchiOBHm_Chr7g0234991 RchiOBHm_Chr7g0241291 RchiOBHm_Chr7g0241301
rosa_laevigata RLG00000001186 RLG00000001187 RLG00000001212 RLG00000001226 RLG00000001233 RLG00000001590 RLG00000003242 RLG00000003243 RLG00000003249 RLG00000008688 RLG00000008690
rosa_multiflora Rmu_co7966574.1_g000001 Rmu_co8120830.1_g000001 Rmu_co8142226.1_g000001 Rmu_co8293083.1_g000001 Rmu_co8351227.1_g000001 Rmu_co8380159.1_g000001 Rmu_co8456505.1_g000001 Rmu_sc0000676.1_g000025 Rmu_sc0000706.1_g000018 Rmu_sc0000706.1_g000040 Rmu_sc0000740.1_g000029 Rmu_sc0000740.1_g000032 Rmu_sc0000740.1_g000037 Rmu_sc0000740.1_g000040 Rmu_sc0000762.1_g000003 Rmu_sc0000762.1_g000019 Rmu_sc0000762.1_g000034 Rmu_sc0000762.1_g000069 Rmu_sc0000892.1_g000001 Rmu_sc0000945.1_g000040 Rmu_sc0001913.1_g000037 Rmu_sc0001913.1_g000041 Rmu_sc0001913.1_g000049 Rmu_sc0002775.1_g000017 Rmu_sc0002775.1_g000018 Rmu_sc0002775.1_g000020 Rmu_sc0002775.1_g000021 Rmu_sc0002775.1_g000022 Rmu_sc0002775.1_g000025 Rmu_sc0002775.1_g000026 Rmu_sc0002775.1_g000028 Rmu_sc0002775.1_g000030 Rmu_sc0004858.1_g000002 Rmu_sc0004864.1_g000022 Rmu_sc0005038.1_g000023 Rmu_sc0005840.1_g000014 Rmu_sc0006724.1_g000003 Rmu_sc0006824.1_g000005 Rmu_sc0007869.1_g000003 Rmu_sc0007869.1_g000005 Rmu_sc0007869.1_g000008 Rmu_sc0008646.1_g000007 Rmu_sc0009637.1_g000009 Rmu_sc0010500.1_g000002 Rmu_sc0010500.1_g000012 Rmu_sc0012403.1_g000025 Rmu_sc0013768.1_g000025 Rmu_sc0015625.1_g000001 Rmu_sc0019715.1_g000001 Rmu_sc0021133.1_g000002 Rmu_sc0021904.1_g000001 Rmu_sc0021904.1_g000003 Rmu_sc0021904.1_g000004 Rmu_sc0022054.1_g000001 Rmu_sc0026025.1_g000001 Rmu_sc0036828.1_g000002 Rmu_sc0041808.1_g000001 Rmu_ssc0000012.1_g000001
rosa_roxburghii Rroxscaffold_3G00226370 Rroxscaffold_3G00226860 Rroxscaffold_3G00226900 Rroxscaffold_3G00226930 Rroxscaffold_3G00226940 Rroxscaffold_3G00226970 Rroxscaffold_3G00226980 Rroxscaffold_3G00231530 Rroxscaffold_3G00237090 Rroxscaffold_3G00250760 Rroxscaffold_3G00250800
rosa_rugosa Rorug04G0082300 Rorug07G0101800 Rorug07G0102000 Rorug07G0102100 Rorug07G0221200 Rorug07G0245700 Rorug07G0245700 Rorug07G0245700 Rorug07G0263900 Rorug07G0264000 Rorug07G0264000 Rorug07G0264500 Rorug07G0282900 Rorug07G0282900 Rorug07G0283100 Rorug07G0283200.1 Rorug07G0283300 Rorug07G0283900 Rorug07G0284000 Rorug07G0284100 Rorug07G0284300 Rorug07G0284400 Rorug07G0284500 Rorug07G0285000 Rorug07G0285200 Rorug07G0285300 Rorug07G0285500 Rorug07G0286800 Rorug07G0286900 Rorug07G0287100 Rorug07G0287200
rosa_samantha Rh7AG236100 Rh7AG236200 Rh7AG236300 Rh7AG440000 Rh7AG440100 Rh7BG411900 Rh7BG412000 Rh7BG412600 Rh7CG251300 Rh7CG417700 Rh7CG460100 Rh7DG242100 Rh7DG242200 Rh7DG242300 Rh7DG429300
rosa_wichuraiana Rw0G005070 Rw0G010780 Rw0G012530 Rw7G020110 Rw7G020160 Rw7G020170 Rw7G033210 Rw7G033230 Rw7G033250 Rw7G034540 Rw7G035150 Rw7G036190 Rw7G036210 Rw7G036260 Rw7G036270 Rw7G036290 Rw7G036300 Rw7G036310 Rw7G036350 Rw7G036360 Rw7G036440 Rw7G036510 Rw7G036530 Rw7G036570 Rw7G036590 Rw7G036730

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 239
AasI GACNNNNNNGTC 1 cut(s) 10
AccB1I GGYRCC 1 cut(s) 731
AccI GTMKAC 3 cut(s) 14, 152, 427
AciI CCGC 1 cut(s) 984
AclWI GGATC 1 cut(s) 264
AcsI RAATTY 1 cut(s) 658
AfaI GTAC 3 cut(s) 484, 648, 753
AflII CTTAAG 1 cut(s) 199
AflIII ACRYGT 1 cut(s) 579
AjiI CACGTC 1 cut(s) 717
AjnI CCWGG 3 cut(s) 625, 670, 923
AluBI AGCT 3 cut(s) 204, 343, 885
AluI AGCT 3 cut(s) 204, 343, 885
Alw26I GTCTC 1 cut(s) 586
AlwI GGATC 1 cut(s) 264
AoxI GGCC 2 cut(s) 331, 720
ApeKI GCWGC 1 cut(s) 231
ApoI RAATTY 1 cut(s) 658
AspLEI GCGC 2 cut(s) 536, 879
AspS9I GGNCC 2 cut(s) 668, 720
AsuHPI GGTGA 1 cut(s) 998
AsuII TTCGAA 1 cut(s) 978
AvaII GGWCC 1 cut(s) 668
AxyI CCTNAGG 2 cut(s) 252, 847
BanI GGYRCC 1 cut(s) 731
BbsI GAAGAC 2 cut(s) 48, 99
BbvI GCAGC 1 cut(s) 218
BccI CCATC 2 cut(s) 648, 722
BceAI ACGGC 1 cut(s) 37
BciT130I CCWGG 3 cut(s) 627, 672, 925
BciVI GTATCC 1 cut(s) 1057
BcoDI GTCTC 1 cut(s) 586
BfaI CTAG 4 cut(s) 146, 407, 882, 947
BfrI CTTAAG 1 cut(s) 199
BfuI GTATCC 1 cut(s) 1057
BglI GCCNNNNNGGC 1 cut(s) 330
BisI GCNGC 1 cut(s) 232
BlsI GCNGC 1 cut(s) 233
Bme1390I CCNGG 3 cut(s) 627, 672, 925
Bme18I GGWCC 1 cut(s) 668
BmgBI CACGTC 1 cut(s) 717
BmgT120I GGNCC 2 cut(s) 668, 720
BmiI GGNNCC 2 cut(s) 624, 733
BmrFI CCNGG 3 cut(s) 627, 672, 925
BpiI GAAGAC 2 cut(s) 48, 99
BpmI CTGGAG 1 cut(s) 1080
Bpu14I TTCGAA 1 cut(s) 978
BsaBI GATNNNNATC 2 cut(s) 88, 369
BsaJI CCNNGG 2 cut(s) 276, 689
Bse21I CCTNAGG 2 cut(s) 252, 847
Bse8I GATNNNNATC 2 cut(s) 88, 369
BseBI CCWGG 3 cut(s) 627, 672, 925
BseDI CCNNGG 2 cut(s) 276, 689
BseGI GGATG 2 cut(s) 640, 659
BseJI GATNNNNATC 2 cut(s) 88, 369
BseMII CTCAG 1 cut(s) 340
BseXI GCAGC 1 cut(s) 218
BseYI CCCAGC 1 cut(s) 339
BsgI GTGCAG 1 cut(s) 529
BshFI GGCC 2 cut(s) 333, 722
BshNI GGYRCC 1 cut(s) 731
BsmAI GTCTC 1 cut(s) 586
BsnI GGCC 2 cut(s) 333, 722
Bsp119I TTCGAA 1 cut(s) 978
Bsp1407I TGTACA 1 cut(s) 482
Bsp143I GATC 4 cut(s) 169, 214, 256, 820
BspACI CCGC 1 cut(s) 984
BspANI GGCC 2 cut(s) 333, 722
BspCNI CTCAG 1 cut(s) 339
BspHI TCATGA 1 cut(s) 166
BspLI GGNNCC 2 cut(s) 624, 733
BspPI GGATC 1 cut(s) 264
BspT104I TTCGAA 1 cut(s) 978
BspT107I GGYRCC 1 cut(s) 731
BspTI CTTAAG 1 cut(s) 199
BsrGI TGTACA 1 cut(s) 482
BssECI CCNNGG 2 cut(s) 276, 689
BssMI GATC 4 cut(s) 169, 214, 256, 820
BssT1I CCWWGG 2 cut(s) 276, 689
Bst2UI CCWGG 3 cut(s) 627, 672, 925
Bst4CI ACNGT 5 cut(s) 302, 419, 550, 739, 770
Bst6I CTCTTC 1 cut(s) 807
BstAFI CTTAAG 1 cut(s) 199
BstAPI GCANNNNNTGC 2 cut(s) 316, 562
BstAUI TGTACA 1 cut(s) 482
BstBI TTCGAA 1 cut(s) 978
BstC8I GCNNGC 3 cut(s) 24, 317, 935
BstDEI CTNAG 5 cut(s) 80, 252, 326, 467, 847
BstF5I GGATG 2 cut(s) 640, 659
BstHHI GCGC 2 cut(s) 536, 879
BstKTI GATC 4 cut(s) 172, 217, 259, 823
BstMAI GTCTC 1 cut(s) 586
BstMBI GATC 4 cut(s) 169, 214, 256, 820
BstMWI GCNNNNNNNGC 6 cut(s) 316, 321, 330, 444, 562, 943
BstNI CCWGG 3 cut(s) 627, 672, 925
BstNSI RCATGY 1 cut(s) 583
BstSCI CCNGG 3 cut(s) 625, 670, 923
BstV1I GCAGC 1 cut(s) 218
BstV2I GAAGAC 2 cut(s) 48, 99
BstX2I RGATCY 1 cut(s) 256
BstYI RGATCY 1 cut(s) 256
Bsu36I CCTNAGG 2 cut(s) 252, 847
BsuI GTATCC 1 cut(s) 1057
BsuRI GGCC 2 cut(s) 333, 722
BtrI CACGTC 1 cut(s) 717
BtsCI GGATG 2 cut(s) 640, 659
BtsIMutI CAGTG 3 cut(s) 298, 334, 546
Cac8I GCNNGC 3 cut(s) 24, 317, 935
CciI TCATGA 1 cut(s) 166
CfoI GCGC 2 cut(s) 536, 879
Cfr13I GGNCC 2 cut(s) 668, 720
CseI GACGC 1 cut(s) 392
CsiI ACCWGGT 1 cut(s) 670
Csp6I GTAC 3 cut(s) 483, 647, 752
CviAII CATG 3 cut(s) 167, 580, 1105
CviQI GTAC 3 cut(s) 483, 647, 752
DdeI CTNAG 5 cut(s) 80, 252, 326, 467, 847
DpnI GATC 4 cut(s) 171, 216, 258, 822
DpnII GATC 4 cut(s) 169, 214, 256, 820
DrdI GACNNNNNNGTC 1 cut(s) 10
DseDI GACNNNNNNGTC 1 cut(s) 10
Eam1104I CTCTTC 1 cut(s) 807
EarI CTCTTC 1 cut(s) 807
Eco130I CCWWGG 2 cut(s) 276, 689
Eco47I GGWCC 1 cut(s) 668
Eco81I CCTNAGG 2 cut(s) 252, 847
EcoO109I RGGNCCY 1 cut(s) 668
EcoRII CCWGG 3 cut(s) 625, 670, 923
EcoT14I CCWWGG 2 cut(s) 276, 689
ErhI CCWWGG 2 cut(s) 276, 689
FaeI CATG 3 cut(s) 170, 583, 1108
FalI AAGNNNNNCTT 4 cut(s) 256, 288, 816, 848
FatI CATG 3 cut(s) 166, 579, 1104
FblI GTMKAC 3 cut(s) 14, 152, 427
Fnu4HI GCNGC 1 cut(s) 232
FokI GGATG 2 cut(s) 647, 666
Fsp4HI GCNGC 1 cut(s) 232
FspBI CTAG 4 cut(s) 146, 407, 882, 947
GlaI GCGC 2 cut(s) 535, 878
GluI GCNGC 1 cut(s) 232
GsaI CCCAGC 1 cut(s) 343
GsuI CTGGAG 1 cut(s) 1080
HaeIII GGCC 2 cut(s) 333, 722
HgaI GACGC 1 cut(s) 392
HhaI GCGC 2 cut(s) 536, 879
Hin1II CATG 3 cut(s) 170, 583, 1108
Hin6I GCGC 2 cut(s) 534, 877
HinP1I GCGC 2 cut(s) 534, 877
HincII GTYRAC 3 cut(s) 153, 714, 786
HindII GTYRAC 3 cut(s) 153, 714, 786
HinfI GANTC 4 cut(s) 379, 638, 787, 917
HphI GGTGA 1 cut(s) 998
Hpy166II GTNNAC 5 cut(s) 15, 153, 428, 714, 786
Hpy188I TCNGA 5 cut(s) 541, 577, 705, 901, 1021
Hpy188III TCNNGA 5 cut(s) 167, 407, 806, 839, 1097
Hpy8I GTNNAC 5 cut(s) 15, 153, 428, 714, 786
HpyAV CCTTC 2 cut(s) 195, 974
HpyCH4III ACNGT 5 cut(s) 302, 419, 550, 739, 770
HpyCH4IV ACGT 1 cut(s) 716
HpyCH4V TGCA 7 cut(s) 26, 234, 310, 369, 497, 546, 556
HpyF10VI GCNNNNNNNGC 6 cut(s) 316, 321, 330, 444, 562, 943
HpyF3I CTNAG 5 cut(s) 80, 252, 326, 467, 847
HpySE526I ACGT 1 cut(s) 716
Hsp92II CATG 3 cut(s) 170, 583, 1108
HspAI GCGC 2 cut(s) 534, 877
Kzo9I GATC 4 cut(s) 169, 214, 256, 820
Lsp1109I GCAGC 1 cut(s) 218
MabI ACCWGGT 1 cut(s) 670
MaeI CTAG 4 cut(s) 146, 407, 882, 947
MaeII ACGT 1 cut(s) 716
MaeIII GTNAC 3 cut(s) 302, 859, 986
MalI GATC 4 cut(s) 171, 216, 258, 822
MboI GATC 4 cut(s) 169, 214, 256, 820
MboII GAAGA 9 cut(s) 48, 99, 264, 378, 535, 794, 880, 912, 926
MflI RGATCY 1 cut(s) 256
MluCI AATT 9 cut(s) 160, 175, 498, 658, 706, 742, 759, 904, 973
MlyI GAGTC 2 cut(s) 388, 781
MmeI TCCRAC 1 cut(s) 564
MnlI CCTC 8 cut(s) 192, 335, 344, 449, 539, 547, 613, 765
MseI TTAA 4 cut(s) 71, 200, 1014, 1029
MspCI CTTAAG 1 cut(s) 199
MspR9I CCNGG 3 cut(s) 627, 672, 925
MvaI CCWGG 3 cut(s) 627, 672, 925
MwoI GCNNNNNNNGC 6 cut(s) 316, 321, 330, 444, 562, 943
NdeII GATC 4 cut(s) 169, 214, 256, 820
NlaIII CATG 3 cut(s) 170, 583, 1108
NlaIV GGNNCC 2 cut(s) 624, 733
NmuCI GTSAC 1 cut(s) 986
NspI RCATGY 1 cut(s) 583
NspV TTCGAA 1 cut(s) 978
PagI TCATGA 1 cut(s) 166
PciI ACATGT 1 cut(s) 579
PfeI GAWTC 2 cut(s) 638, 917
PkrI GCNGC 1 cut(s) 233
PleI GAGTC 2 cut(s) 387, 781
PpsI GAGTC 2 cut(s) 387, 781
PpuMI RGGWCCY 1 cut(s) 668
PscI ACATGT 1 cut(s) 579
PsiI TTATAA 1 cut(s) 239
Psp5II RGGWCCY 1 cut(s) 668
Psp6I CCWGG 3 cut(s) 625, 670, 923
PspFI CCCAGC 1 cut(s) 339
PspGI CCWGG 3 cut(s) 625, 670, 923
PspN4I GGNNCC 2 cut(s) 624, 733
PspPI GGNCC 2 cut(s) 668, 720
PspPPI RGGWCCY 1 cut(s) 668
PsuI RGATCY 1 cut(s) 256
RsaI GTAC 3 cut(s) 484, 648, 753
RsaNI GTAC 3 cut(s) 483, 647, 752
SalI GTCGAC 1 cut(s) 151
SaqAI TTAA 4 cut(s) 71, 200, 1014, 1029
SatI GCNGC 1 cut(s) 232
Sau3AI GATC 4 cut(s) 169, 214, 256, 820
Sau96I GGNCC 2 cut(s) 668, 720
SchI GAGTC 2 cut(s) 388, 781
ScrFI CCNGG 3 cut(s) 627, 672, 925
SexAI ACCWGGT 1 cut(s) 670
SfuI TTCGAA 1 cut(s) 978
SinI GGWCC 1 cut(s) 668
SmlI CTYRAG 1 cut(s) 199
SmoI CTYRAG 1 cut(s) 199
Sse9I AATT 9 cut(s) 160, 175, 498, 658, 706, 742, 759, 904, 973
SsiI CCGC 1 cut(s) 984
SspMI CTAG 4 cut(s) 146, 407, 882, 947
StyD4I CCNGG 3 cut(s) 625, 670, 923
StyI CCWWGG 2 cut(s) 276, 689
TaaI ACNGT 5 cut(s) 302, 419, 550, 739, 770
TaiI ACGT 1 cut(s) 719
TaqI TCGA 2 cut(s) 152, 978
TasI AATT 9 cut(s) 160, 175, 498, 658, 706, 742, 759, 904, 973
TatI WGTACW 1 cut(s) 482
TfiI GAWTC 2 cut(s) 638, 917
Tru1I TTAA 4 cut(s) 71, 200, 1014, 1029
Tru9I TTAA 4 cut(s) 71, 200, 1014, 1029
TscAI CASTG 3 cut(s) 305, 334, 553
TseFI GTSAC 1 cut(s) 986
TseI GCWGC 1 cut(s) 231
Tsp45I GTSAC 1 cut(s) 986
TspDTI ATGAA 4 cut(s) 45, 155, 651, 652
TspRI CASTG 3 cut(s) 305, 334, 553
Vha464I CTTAAG 1 cut(s) 199
VpaK11BI GGWCC 1 cut(s) 668
XapI RAATTY 1 cut(s) 658
XbaI TCTAGA 1 cut(s) 406
XceI RCATGY 1 cut(s) 583
XmiI GTMKAC 3 cut(s) 14, 152, 427
XspI CTAG 4 cut(s) 146, 407, 882, 947
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.