Rmu_sc0002775.1_g000030

TMV resistance protein N-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002775.1
OG0000055
Physical Location & Seq
Reverse (-)
154913 .. 162552
7640 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002775.1_g000030.1.cds

Sequence Viewer

Length: 3816 bp
atggcttcatcctacgacgtctttttgagcttccgaggtgaagacacacgcaggaccttcacgggccacctcgtcgggcaattagttcggtctggaatcaataccttcattgacgacgtcctaacgagaggggaagagatatcaacggaattgatgagggcaatcgaagggtctaggatctctgtcatagtcttctcagcgaactatgcgagttcaagatggtgtcttgttgagctggtgaagatcatggagtgtagaaaaacattggggcgaactgcttttccaatattctatcgtattgatccttcagaagtcaggcatcagacgggtagttttggcgaggcatttgtaaaacttaaagctagatatgctgagaaagtatccagctggatagctgctcttcatgaagctgcaaatttgtcgggcttccatgttactgaagggcgtgacgcagattttatagatgacattgttgaccagattagtagacggctgaccaacacatacttacatatagccgactacccagttggaatagattctcgcgttgaagaaattagtaaatcattacgtgttggagttgatgatgatgttcacatggttggaatttggggtatgggtggaatgggcaaaacatctgttgcaaaagccatctataacaaattttatcatagttttgaaggtacaagttttcttgcaaatgttagggaaactgcaaaggactcaaatggtaagattgctctgcaagaaagacttctttctgatgtcttaaaatcaaccaagatatcagtaggtgatgtttccagagggatcaatgtgataaaacaaagacttggaaagaaaaaggtacttgtcattgttgatgatgtagatgatgtggagcaattaactgcattagccataaggcgtgattcgtttggtccaggaagtagaattgttataactacaagagatcaacatttgctagagcaacttgaagtgacaatacatccaactcgagaaatgaataaagaagaagctcttgagctctttagtaggcatgcatttcaaaataattgtcctgatgcagaatttttggaactcgcaaggagagtggttacttactgtggaggtttaccgctggctcttgaagttttagggtcttttctctttaaagggagcatacgacattggaaaagcactttgaagaaattggaaaaatttcctgatgacaaaatttataaagtcctcaaaataagctttgatgcgcttagtgaggatcagaaggaaatcttcctccacatatcttgtttcttcgttggaatggacaagaagtatgtcacacaaatcctgcacggctgtggtcattttccagatgcagaaatcagtgtcctcattcaacgttgcctagtcactgttagtgaaaaaaacaagctcatgatgcacgatttgcttcgagacatgggcagagaagttgtccgtgcagaatcccctaaacaacctgaaaaacgtagtagattgtggcatcaggaagatgtaatagatgtactgacagaagaatctggaactaaaaagattgaaggactagccctaaatttgcaaagatctgacaaaaagaggttccgaacaatagcatttagaaacatgacgagactgaaattgctccaactcaactatgtacagctcgatggagactatgactatctttccaaacagttaagatggctgtgctggcttggattctctctatcgactttcggaaatgaatttcctaatgaacaaaacctggtttctatcgacctgcggtacagcaatcttgtacaagtttgggaacagtccagggtgctagagaagttgaagatactcaatctcagtcattcacatgaccttgcacatacaccagacttttcacatctcccaaaacttaaatatctgatcctgaaagactgtaagagtttgtctgagattcacgagtctattgggcatcttggaagccttgccttggtaaaccttaagaactgcataatgctcaaggaccttccaaagagattttataagttgaaatcagttaaaactcttgttctttctggctgtttgagatttcagaatttgagtgataatatagggaacatgacatcattgacaactcttcttgtaagtggctcagccataagtcaagtaccatcctttttggaaagactgcagttgaactattcatctcgacaagacctgactcttgtgaaacaccgtttcccagaagtgcctagaaaccatttaaatatgggaagcagtagtgttcctagccttccggaacgtctatgtttcaataattgcacaaacgttcctgctagtggagatttaccaacttggtcgaaggacttggaatcagatcacagtactgcacttgcagtaattccaaattcttctaaagcatcaaggcagagcagcgtacagggatggactgcaaatggagagggccgccttttattcaatgattgcataaacctcggtgacctttccaattacacaagccttcctctgaacagagatttaccaactactttgaaggagttggaagcagatcactgtactaatgcactggaaatagttcccaacttttcaaaaacttcgaggcagagcatcctacaggaatggcctgcaagtggagatggtggcatttgtctgcctgcaaatgattttccagggccgttcacacatgtcagagaaactgatcatgtctttttccaagtgcctcaaattattggttgcaatttaaaagctttgactgtgcgcgtcgtttgttccctctgtttcagcgaggaaacgtctccaagtcgtaattccatttttgttacaaatcacaccaagctcattcgttttgttgtccggccagcttatgccactgaaataacatcacatgaagttatttggcagggaaatttatcaaacaatcagctcaatttggaaggcggcgattttgttgaggttgaagttgtaactggatctggtttgagagtgaagaaaacaggggtcaatcttatcattgaaaatatgattgagtgcgagcgtgtcccatatgagggtttagcaagtgatgctgataatgaggctggaccaagccatgactcatctgatggggacggaactttgaaaagatcgaagattctcactgttctgaacctcaccaatggcgacctccacttcttcccaggcttctgtaactcctcggcttcatcgcttcgagctcgtggaagggatgcaacttcagataacctcacatgcaggttgatggggctgggaaagaaattgataaatggttgcttgatgaaatctctcatagagagagaggctgagagatcttcaatgcatagtgaaattagtgaagctcaagataggtttaccactctactacagagagtatatttaaaccagccaaaggatcgcgacgtagtgagactactgatggcacatgttggtcgtgggggtcagggatatgttggacagacgattcgcgatgaaatacttgtaattcagaggaacaatgaccgcaagaatggcatgatggaggagtggcaccaaaagttgcacaataatagtagcccagatgatgtgataatttttgaggcactcatacattacattaagtctggttttagaatcaatgtttattggaaaacattaattccaaatggtctcacaaaagagaagcttgcaagttatgaccgccccatcgtctcagagcctcatttcagggctgatactagggggggtctcgttcacgacctgacggcatacttgaagacattaaaggtacagaaaccaatcatagtttactaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
NB-ARC TIR

Protein Analysis

1271

Amino Acids

143.24

Weight (kDa)

8.05

Isoelectric Point (pI)

40.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000055)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G36930 AT5G36930 AT5G36930 AT5G36930
fragaria_vesca FvH4_3g45361 FvH4_3g45380 FvH4_5g21061 FvH4_5g21062 FvH4_5g21063 FvH4_5g32050 FvH4_5g32970 FvH4_5g32990 FvH4_5g34190 FvH4_5g34210 FvH4_5g34210 FvH4_5g34210 FvH4_5g34210 FvH4_5g34210 FvH4_5g34210 FvH4_5g34211 FvH4_5g34240 FvH4_5g34250
malus_domestica MD00G1011700.v1.1 MD00G1026100.v1.1 MD00G1026500.v1.1 MD00G1027000.v1.1 MD00G1027100.v1.1 MD00G1027700.v1.1 MD00G1027800.v1.1 MD00G1028000.v1.1 MD00G1220000.v1.1 MD02G1024400.v1.1 MD02G1024800.v1.1 MD02G1026000.v1.1 MD02G1026100.v1.1 MD02G1031800.v1.1 MD02G1038500.v1.1 MD02G1038700.v1.1 MD02G1039200.v1.1 MD02G1040600.v1.1 MD02G1040900.v1.1 MD02G1041200.v1.1 MD02G1041300.v1.1 MD02G1041700.v1.1 MD02G1042000.v1.1 MD02G1043800.v1.1 MD02G1043900.v1.1 MD02G1044300.v1.1 MD02G1045200.v1.1 MD02G1045300.v1.1 MD02G1051200.v1.1 MD02G1052200.v1.1 MD02G1052800.v1.1 MD02G1053100.v1.1 MD02G1053600.v1.1 MD02G1055500.v1.1 MD02G1063300.v1.1 MD02G1063400.v1.1 MD02G1063800.v1.1 MD02G1306500.v1.1 MD02G1306600.v1.1 MD02G1306700.v1.1 MD02G1306900.v1.1 MD02G1307200.v1.1 MD04G1011700.v1.1 MD05G1315400.v1.1 MD05G1316000.v1.1 MD05G1316700.v1.1 MD05G1317000.v1.1 MD05G1317300.v1.1 MD05G1317600.v1.1 MD05G1317700.v1.1 MD07G1102800.v1.1 MD07G1238200.v1.1 MD08G1175900.v1.1 MD08G1203600.v1.1 MD09G1024200.v1.1 MD09G1039600.v1.1 MD09G1044800.v1.1 MD09G1045100.v1.1 MD10G1038700.v1.1 MD10G1039000.v1.1 MD10G1039200.v1.1 MD10G1040000.v1.1 MD10G1040200.v1.1 MD10G1040600.v1.1 MD10G1040800.v1.1 MD10G1297300.v1.1 MD12G1247500.v1.1 MD12G1247900.v1.1 MD12G1248300.v1.1 MD12G1248800.v1.1 MD15G1103700.v1.1 MD15G1103800.v1.1 MD15G1104000.v1.1 MD15G1179600.v1.1 MD15G1182500.v1.1 MD16G1068200.v1.1 MD16G1068300.v1.1 MD17G1024600.v1.1 MD17G1024700.v1.1 MD17G1025000.v1.1 MD17G1025900.v1.1
prunus_persica Prupe.1G539800_v2.0.a1 Prupe.1G550800_v2.0.a1 Prupe.1G550800_v2.0.a1 Prupe.1G550800_v2.0.a1 Prupe.1G550800_v2.0.a1 Prupe.1G550800_v2.0.a1 Prupe.1G550800_v2.0.a1 Prupe.1G557100_v2.0.a1 Prupe.1G557200_v2.0.a1 Prupe.1G557200_v2.0.a1 Prupe.1G557300_v2.0.a1
pyrus_communis pycom02g02080 pycom02g02090 pycom02g02110 pycom02g03220 pycom02g03260 pycom02g03370 pycom02g03390 pycom02g03410 pycom02g03420 pycom02g03450 pycom02g03500 pycom02g03730 pycom02g03770 pycom02g04400 pycom02g04410 pycom02g04430 pycom02g04450 pycom02g04460 pycom02g04490 pycom02g05200 pycom02g25710 pycom02g25750 pycom02g25790 pycom02g25810 pycom02g25830 pycom04g00920 pycom04g00930 pycom04g00940 pycom05g29300 pycom05g29310 pycom05g29380 pycom05g29410 pycom07g06310 pycom07g21420 pycom08g15070 pycom08g17540 pycom08g17560 pycom08g17570 pycom10g02670 pycom10g02680 pycom10g02700 pycom10g02770 pycom10g02790 pycom10g02800 pycom10g02810 pycom10g25020 pycom10g25030 pycom10g25050 pycom10g25080 pycom111g01990 pycom111g02000 pycom111g02030 pycom111g02040 pycom111g02050 pycom111g02060 pycom12g22710 pycom12g22720 pycom12g22730 pycom12g22740 pycom12g22750 pycom12g22770 pycom12g22780 pycom12g22790 pycom12g22800 pycom12g22810 pycom12g22830 pycom12g22840 pycom12g22860 pycom15g09440 pycom15g09480 pycom15g16120 pycom15g32380 pycom16g05970 pycom17g02100
rosa_chinensis RchiOBHm_Chr2g0144661 RchiOBHm_Chr4g0407491 RchiOBHm_Chr4g0407501 RchiOBHm_Chr4g0412381 RchiOBHm_Chr7g0208191 RchiOBHm_Chr7g0208201 RchiOBHm_Chr7g0208211 RchiOBHm_Chr7g0208221 RchiOBHm_Chr7g0228071 RchiOBHm_Chr7g0228121 RchiOBHm_Chr7g0230971 RchiOBHm_Chr7g0230981 RchiOBHm_Chr7g0233901 RchiOBHm_Chr7g0233951 RchiOBHm_Chr7g0233961 RchiOBHm_Chr7g0233991 RchiOBHm_Chr7g0234021 RchiOBHm_Chr7g0234151 RchiOBHm_Chr7g0234161 RchiOBHm_Chr7g0234241 RchiOBHm_Chr7g0234501 RchiOBHm_Chr7g0234641 RchiOBHm_Chr7g0234771 RchiOBHm_Chr7g0234781 RchiOBHm_Chr7g0234991 RchiOBHm_Chr7g0241291 RchiOBHm_Chr7g0241301
rosa_laevigata RLG00000001186 RLG00000001187 RLG00000001212 RLG00000001226 RLG00000001233 RLG00000001590 RLG00000003242 RLG00000003243 RLG00000003249 RLG00000008688 RLG00000008690
rosa_multiflora Rmu_co7966574.1_g000001 Rmu_co8120830.1_g000001 Rmu_co8142226.1_g000001 Rmu_co8293083.1_g000001 Rmu_co8351227.1_g000001 Rmu_co8380159.1_g000001 Rmu_co8456505.1_g000001 Rmu_sc0000676.1_g000025 Rmu_sc0000706.1_g000018 Rmu_sc0000706.1_g000040 Rmu_sc0000740.1_g000029 Rmu_sc0000740.1_g000032 Rmu_sc0000740.1_g000037 Rmu_sc0000740.1_g000040 Rmu_sc0000762.1_g000003 Rmu_sc0000762.1_g000019 Rmu_sc0000762.1_g000034 Rmu_sc0000762.1_g000069 Rmu_sc0000892.1_g000001 Rmu_sc0000945.1_g000040 Rmu_sc0001913.1_g000037 Rmu_sc0001913.1_g000041 Rmu_sc0001913.1_g000049 Rmu_sc0002775.1_g000017 Rmu_sc0002775.1_g000018 Rmu_sc0002775.1_g000020 Rmu_sc0002775.1_g000021 Rmu_sc0002775.1_g000022 Rmu_sc0002775.1_g000025 Rmu_sc0002775.1_g000026 Rmu_sc0002775.1_g000028 Rmu_sc0002775.1_g000030 Rmu_sc0004858.1_g000002 Rmu_sc0004864.1_g000022 Rmu_sc0005038.1_g000023 Rmu_sc0005840.1_g000014 Rmu_sc0006724.1_g000003 Rmu_sc0006824.1_g000005 Rmu_sc0007869.1_g000003 Rmu_sc0007869.1_g000005 Rmu_sc0007869.1_g000008 Rmu_sc0008646.1_g000007 Rmu_sc0009637.1_g000009 Rmu_sc0010500.1_g000002 Rmu_sc0010500.1_g000012 Rmu_sc0012403.1_g000025 Rmu_sc0013768.1_g000025 Rmu_sc0015625.1_g000001 Rmu_sc0019715.1_g000001 Rmu_sc0021133.1_g000002 Rmu_sc0021904.1_g000001 Rmu_sc0021904.1_g000003 Rmu_sc0021904.1_g000004 Rmu_sc0022054.1_g000001 Rmu_sc0026025.1_g000001 Rmu_sc0036828.1_g000002 Rmu_sc0041808.1_g000001 Rmu_ssc0000012.1_g000001
rosa_roxburghii Rroxscaffold_3G00226370 Rroxscaffold_3G00226860 Rroxscaffold_3G00226900 Rroxscaffold_3G00226930 Rroxscaffold_3G00226940 Rroxscaffold_3G00226970 Rroxscaffold_3G00226980 Rroxscaffold_3G00231530 Rroxscaffold_3G00237090 Rroxscaffold_3G00250760 Rroxscaffold_3G00250800
rosa_rugosa Rorug04G0082300 Rorug07G0101800 Rorug07G0102000 Rorug07G0102100 Rorug07G0221200 Rorug07G0245700 Rorug07G0245700 Rorug07G0245700 Rorug07G0263900 Rorug07G0264000 Rorug07G0264000 Rorug07G0264500 Rorug07G0282900 Rorug07G0282900 Rorug07G0283100 Rorug07G0283200.1 Rorug07G0283300 Rorug07G0283900 Rorug07G0284000 Rorug07G0284100 Rorug07G0284300 Rorug07G0284400 Rorug07G0284500 Rorug07G0285000 Rorug07G0285200 Rorug07G0285300 Rorug07G0285500 Rorug07G0286800 Rorug07G0286900 Rorug07G0287100 Rorug07G0287200
rosa_samantha Rh7AG236100 Rh7AG236200 Rh7AG236300 Rh7AG440000 Rh7AG440100 Rh7BG411900 Rh7BG412000 Rh7BG412600 Rh7CG251300 Rh7CG417700 Rh7CG460100 Rh7DG242100 Rh7DG242200 Rh7DG242300 Rh7DG429300
rosa_wichuraiana Rw0G005070 Rw0G010780 Rw0G012530 Rw7G020110 Rw7G020160 Rw7G020170 Rw7G033210 Rw7G033230 Rw7G033250 Rw7G034540 Rw7G035150 Rw7G036190 Rw7G036210 Rw7G036260 Rw7G036270 Rw7G036290 Rw7G036300 Rw7G036310 Rw7G036350 Rw7G036360 Rw7G036440 Rw7G036510 Rw7G036530 Rw7G036570 Rw7G036590 Rw7G036730

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 3 cut(s) 941, 1221, 2034
AatII GACGTC 2 cut(s) 21, 120
Acc36I ACCTGC 2 cut(s) 1788, 3252
AccB1I GGYRCC 1 cut(s) 3552
AccI GTMKAC 1 cut(s) 487
AccII CGCG 4 cut(s) 546, 2772, 3423, 3492
AccIII TCCGGA 1 cut(s) 2287
AciI CCGC 6 cut(s) 1118, 1783, 2458, 2949, 3526, 3703
AclI AACGTT 2 cut(s) 1381, 2319
AclWI GGATC 7 cut(s) 185, 296, 818, 1266, 1909, 2989, 3426
AcoI YGGCCR 1 cut(s) 2867
AcuI CTGAAG 3 cut(s) 291, 459, 3228
AcyI GRCGYC 2 cut(s) 18, 117
AfiI CCNNNNNNNGG 6 cut(s) 1981, 2330, 2642, 3058, 3059, 3415
AflII CTTAAG 1 cut(s) 1991
AflIII ACRYGT 3 cut(s) 571, 2695, 3448
AjnI CCWGG 5 cut(s) 922, 1764, 1817, 2680, 3187
AjuI GAANNNNNNNTTGG 2 cut(s) 2803, 2835
AleI CACNNNNGTG 1 cut(s) 1338
AloI GAACNNNNNNTCC 2 cut(s) 265, 297
Alw21I GWGCWC 2 cut(s) 1029, 3226
Alw26I GTCTC 8 cut(s) 1431, 1624, 1665, 2811, 3427, 3677, 3718, 3755
AlwI GGATC 7 cut(s) 185, 296, 818, 1266, 1909, 2989, 3426
Ama87I CYCGRG 1 cut(s) 996
Aor13HI TCCGGA 1 cut(s) 2287
AoxI GGCC 5 cut(s) 64, 2455, 2633, 2684, 2867
ApeKI GCWGC 3 cut(s) 395, 410, 2424
ArsI GACNNNNNNTTYG 4 cut(s) 1042, 1074, 3471, 3503
AseI ATTAAT 1 cut(s) 3659
Asp700I GAANNNNTTC 4 cut(s) 538, 753, 1200, 2586
AspLEI GCGC 2 cut(s) 1249, 2772
AspS9I GGNCC 7 cut(s) 54, 64, 920, 2014, 2455, 2684, 3092
AsuHPI GGTGA 5 cut(s) 50, 250, 806, 2501, 3154
AvaI CYCGRG 1 cut(s) 996
AvaII GGWCC 4 cut(s) 54, 920, 2014, 3092
BanI GGYRCC 1 cut(s) 3552
BanII GRGCYC 2 cut(s) 1029, 3226
BarI GAAGNNNNNNTAC 4 cut(s) 289, 321, 969, 1001
BauI CACGAG 2 cut(s) 1949, 3225
BbsI GAAGAC 3 cut(s) 48, 184, 3785
Bbv12I GWGCWC 2 cut(s) 1029, 3226
BbvI GCAGC 3 cut(s) 382, 397, 2436
BceAI ACGGC 4 cut(s) 506, 1351, 2671, 3783
BcgI CGANNNNNNTGC 6 cut(s) 68, 102, 402, 436, 2467, 2501
BciT130I CCWGG 5 cut(s) 924, 1766, 1819, 2682, 3189
BciVI GTATCC 1 cut(s) 391
BclI TGATCA 1 cut(s) 2710
BcoDI GTCTC 8 cut(s) 1431, 1624, 1665, 2811, 3427, 3677, 3718, 3755
BfmI CTRYAG 3 cut(s) 2180, 2624, 3389
BfrI CTTAAG 1 cut(s) 1991
BfuAI ACCTGC 2 cut(s) 1788, 3252
BfuI GTATCC 1 cut(s) 391
BglII AGATCT 2 cut(s) 1583, 3335
BisI GCNGC 5 cut(s) 396, 411, 2425, 2458, 2950
BlpI GCTNAGC 1 cut(s) 2143
BlsI GCNGC 5 cut(s) 397, 412, 2426, 2459, 2951
BmcAI AGTACT 1 cut(s) 2377
Bme1390I CCNGG 5 cut(s) 924, 1766, 1819, 2682, 3189
Bme18I GGWCC 4 cut(s) 54, 920, 2014, 3092
BmeT110I CYCGRG 1 cut(s) 996
BmgT120I GGNCC 7 cut(s) 54, 64, 920, 2014, 2455, 2684, 3092
BmiI GGNNCC 2 cut(s) 1601, 3554
BmrFI CCNGG 5 cut(s) 924, 1766, 1819, 2682, 3189
BmrI ACTGGG 1 cut(s) 521
BmuI ACTGGG 1 cut(s) 521
BpiI GAAGAC 3 cut(s) 48, 184, 3785
Bpu1102I GCTNAGC 1 cut(s) 2143
BpuEI CTTGAG 3 cut(s) 1043, 1994, 3351
BsaAI YACGTR 1 cut(s) 572
BsaHI GRCGYC 2 cut(s) 18, 117
BsaI GGTCTC 2 cut(s) 3677, 3755
BsaJI CCNNGG 7 cut(s) 34, 1818, 1980, 2485, 2681, 3187, 3204
BsaWI WCCGGW 1 cut(s) 2287
Bsc4I CCNNNNNNNGG 6 cut(s) 1981, 2330, 2642, 3058, 3059, 3415
Bse1I ACTGG 3 cut(s) 527, 2583, 2983
BseAI TCCGGA 1 cut(s) 2287
BseBI CCWGG 5 cut(s) 924, 1766, 1819, 2682, 3189
BseDI CCNNGG 7 cut(s) 34, 1818, 1980, 2485, 2681, 3187, 3204
BseGI GGATG 6 cut(s) 8, 988, 2162, 2441, 2619, 3241
BseLI CCNNNNNNNGG 6 cut(s) 1981, 2330, 2642, 3058, 3059, 3415
BseMII CTCAG 7 cut(s) 210, 363, 1864, 1932, 2157, 3321, 3729
BseNI ACTGG 3 cut(s) 527, 2583, 2983
BseRI GAGGAG 2 cut(s) 3193, 3560
BseXI GCAGC 3 cut(s) 382, 397, 2436
BseYI CCCAGC 1 cut(s) 3274
BsgI GTGCAG 3 cut(s) 1316, 1482, 2364
Bsh1236I CGCG 4 cut(s) 546, 2772, 3423, 3492
BshFI GGCC 5 cut(s) 66, 2457, 2635, 2686, 2869
BshNI GGYRCC 1 cut(s) 3552
BsiHKAI GWGCWC 2 cut(s) 1029, 3226
BsiHKCI CYCGRG 1 cut(s) 996
BsiSI CCGG 2 cut(s) 2288, 2866
BslFI GGGAC 2 cut(s) 3035, 3131
BslI CCNNNNNNNGG 6 cut(s) 1981, 2330, 2642, 3058, 3059, 3415
BsmAI GTCTC 8 cut(s) 1431, 1624, 1665, 2811, 3427, 3677, 3718, 3755
BsmBI CGTCTC 2 cut(s) 2811, 3718
BsmFI GGGAC 2 cut(s) 3035, 3131
BsnI GGCC 5 cut(s) 66, 2457, 2635, 2686, 2869
Bso31I GGTCTC 2 cut(s) 3677, 3755
BsoBI CYCGRG 1 cut(s) 996
Bsp1286I GDGCHC 2 cut(s) 1029, 3226
Bsp13I TCCGGA 1 cut(s) 2287
Bsp1407I TGTACA 2 cut(s) 1657, 1798
Bsp1720I GCTNAGC 1 cut(s) 2143
Bsp68I TCGCGA 2 cut(s) 3423, 3492
BspACI CCGC 6 cut(s) 1118, 1783, 2458, 2949, 3526, 3703
BspANI GGCC 5 cut(s) 66, 2457, 2635, 2686, 2869
BspCNI CTCAG 7 cut(s) 209, 364, 1863, 1933, 2156, 3322, 3728
BspEI TCCGGA 1 cut(s) 2287
BspFNI CGCG 4 cut(s) 546, 2772, 3423, 3492
BspHI TCATGA 2 cut(s) 403, 1416
BspLI GGNNCC 2 cut(s) 1601, 3554
BspMAI CTGCAG 1 cut(s) 2184
BspMI ACCTGC 2 cut(s) 1788, 3252
BspPI GGATC 7 cut(s) 185, 296, 818, 1266, 1909, 2989, 3426
BspQI GCTCTTC 1 cut(s) 405
BspT107I GGYRCC 1 cut(s) 3552
BspTI CTTAAG 1 cut(s) 1991
BspTNI GGTCTC 2 cut(s) 3677, 3755
BsrGI TGTACA 2 cut(s) 1657, 1798
BsrI ACTGG 3 cut(s) 527, 2583, 2983
BssECI CCNNGG 7 cut(s) 34, 1818, 1980, 2485, 2681, 3187, 3204
BssNI GRCGYC 2 cut(s) 18, 117
BssSI CACGAG 2 cut(s) 1949, 3225
BssT1I CCWWGG 1 cut(s) 1980
Bst2BI CACGAG 2 cut(s) 1949, 3225
Bst2UI CCWGG 5 cut(s) 924, 1766, 1819, 2682, 3189
Bst6I CTCTTC 3 cut(s) 129, 405, 2133
BstACI GRCGYC 2 cut(s) 18, 117
BstAFI CTTAAG 1 cut(s) 1991
BstAPI GCANNNNNTGC 2 cut(s) 1429, 3074
BstAUI TGTACA 2 cut(s) 1657, 1798
BstBAI YACGTR 1 cut(s) 572
BstC8I GCNNGC 8 cut(s) 1041, 1122, 1712, 2637, 2667, 2871, 3044, 3690
BstDEI CTNAG 8 cut(s) 196, 372, 1250, 1850, 1941, 2143, 3330, 3715
BstEII GGTNACC 1 cut(s) 2489
BstF5I GGATG 6 cut(s) 8, 988, 2162, 2441, 2619, 3241
BstFNI CGCG 4 cut(s) 546, 2772, 3423, 3492
BstHHI GCGC 2 cut(s) 1249, 2772
BstMAI GTCTC 8 cut(s) 1431, 1624, 1665, 2811, 3427, 3677, 3718, 3755
BstMWI GCNNNNNNNGC 7 cut(s) 206, 368, 1420, 1429, 1711, 3074, 3534
BstNI CCWGG 5 cut(s) 924, 1766, 1819, 2682, 3189
BstNSI RCATGY 4 cut(s) 1043, 2699, 3261, 3452
BstPI GGTNACC 1 cut(s) 2489
BstSCI CCNGG 5 cut(s) 922, 1764, 1817, 2680, 3187
BstSFI CTRYAG 3 cut(s) 2180, 2624, 3389
BstUI CGCG 4 cut(s) 546, 2772, 3423, 3492
BstV1I GCAGC 3 cut(s) 382, 397, 2436
BstV2I GAAGAC 3 cut(s) 48, 184, 3785
BstX2I RGATCY 4 cut(s) 177, 1583, 2981, 3335
BstYI RGATCY 4 cut(s) 177, 1583, 2981, 3335
BsuI GTATCC 1 cut(s) 391
BsuRI GGCC 5 cut(s) 66, 2457, 2635, 2686, 2869
BtgZI GCGATG 2 cut(s) 3198, 3507
BtsCI GGATG 6 cut(s) 8, 988, 2162, 2441, 2619, 3241
BtsIMutI CAGTG 6 cut(s) 1372, 1392, 2563, 2576, 2880, 3147
BtuMI TCGCGA 2 cut(s) 3423, 3492
BveI ACCTGC 2 cut(s) 1788, 3252
Cac8I GCNNGC 8 cut(s) 1041, 1122, 1712, 2637, 2667, 2871, 3044, 3690
CciI TCATGA 2 cut(s) 403, 1416
CfoI GCGC 2 cut(s) 1249, 2772
Cfr13I GGNCC 7 cut(s) 54, 64, 920, 2014, 2455, 2684, 3092
CseI GACGC 2 cut(s) 458, 2761
CsiI ACCWGGT 1 cut(s) 1764
CspCI CAANNNNNGTGG 4 cut(s) 1074, 1109, 1268, 1303
DdeI CTNAG 8 cut(s) 196, 372, 1250, 1850, 1941, 2143, 3330, 3715
DraI TTTAAA 4 cut(s) 1153, 2256, 2754, 3405
EaeI YGGCCR 1 cut(s) 2867
Eam1104I CTCTTC 3 cut(s) 129, 405, 2133
EarI CTCTTC 3 cut(s) 129, 405, 2133
Ecl136II GAGCTC 2 cut(s) 1027, 3224
Eco130I CCWWGG 1 cut(s) 1980
Eco24I GRGCYC 2 cut(s) 1029, 3226
Eco31I GGTCTC 2 cut(s) 3677, 3755
Eco32I GATATC 2 cut(s) 141, 786
Eco47I GGWCC 4 cut(s) 54, 920, 2014, 3092
Eco53kI GAGCTC 2 cut(s) 1027, 3224
Eco57I CTGAAG 3 cut(s) 291, 459, 3228
Eco88I CYCGRG 1 cut(s) 996
Eco91I GGTNACC 1 cut(s) 2489
EcoICRI GAGCTC 2 cut(s) 1027, 3224
EcoO109I RGGNCCY 2 cut(s) 54, 2014
EcoO65I GGTNACC 1 cut(s) 2489
EcoRII CCWGG 5 cut(s) 922, 1764, 1817, 2680, 3187
EcoRV GATATC 2 cut(s) 141, 786
EcoT14I CCWWGG 1 cut(s) 1980
EcoT22I ATGCAT 2 cut(s) 1045, 3348
EcoT38I GRGCYC 2 cut(s) 1029, 3226
ErhI CCWWGG 1 cut(s) 1980
Esp3I CGTCTC 2 cut(s) 2811, 3718
FalI AAGNNNNNCTT 8 cut(s) 738, 770, 1005, 1037, 1256, 1288, 3672, 3704
FaqI GGGAC 2 cut(s) 3035, 3131
FauNDI CATATG 1 cut(s) 3055
FbaI TGATCA 1 cut(s) 2710
FblI GTMKAC 1 cut(s) 487
Fnu4HI GCNGC 5 cut(s) 396, 411, 2425, 2458, 2950
FokI GGATG 5 cut(s) 975, 2149, 2448, 2606, 3248
FriOI GRGCYC 2 cut(s) 1029, 3226
Fsp4HI GCNGC 5 cut(s) 396, 411, 2425, 2458, 2950
GlaI GCGC 2 cut(s) 1248, 2771
GluI GCNGC 5 cut(s) 396, 411, 2425, 2458, 2950
GsaI CCCAGC 1 cut(s) 3278
HaeIII GGCC 5 cut(s) 66, 2457, 2635, 2686, 2869
HapII CCGG 2 cut(s) 2288, 2866
HgaI GACGC 2 cut(s) 458, 2761
HhaI GCGC 2 cut(s) 1249, 2772
Hin1I GRCGYC 2 cut(s) 18, 117
Hin6I GCGC 2 cut(s) 1247, 2770
HinP1I GCGC 2 cut(s) 1247, 2770
HincII GTYRAC 1 cut(s) 475
HindII GTYRAC 1 cut(s) 475
HindIII AAGCTT 3 cut(s) 1237, 2757, 3686
HpaII CCGG 2 cut(s) 2288, 2866
HphI GGTGA 5 cut(s) 50, 250, 806, 2501, 3154
Hpy166II GTNNAC 9 cut(s) 475, 488, 595, 1115, 1987, 2691, 3378, 3757, 3811
Hpy8I GTNNAC 9 cut(s) 475, 488, 595, 1115, 1987, 2691, 3378, 3757, 3811
Hpy99I CGWCG 5 cut(s) 20, 77, 119, 2777, 3428
HpyCH4IV ACGT 9 cut(s) 18, 117, 571, 1381, 1489, 2293, 2319, 2804, 3426
HpyF10VI GCNNNNNNNGC 7 cut(s) 206, 368, 1420, 1429, 1711, 3074, 3534
HpyF3I CTNAG 8 cut(s) 196, 372, 1250, 1850, 1941, 2143, 3330, 3715
HpySE526I ACGT 9 cut(s) 18, 117, 571, 1381, 1489, 2293, 2319, 2804, 3426
Hsp92I GRCGYC 2 cut(s) 18, 117
HspAI GCGC 2 cut(s) 1247, 2770
Kpn2I TCCGGA 1 cut(s) 2287
Ksp22I TGATCA 1 cut(s) 2710
LguI GCTCTTC 1 cut(s) 405
LmnI GCTCC 3 cut(s) 880, 1158, 1647
Lsp1109I GCAGC 3 cut(s) 382, 397, 2436
MabI ACCWGGT 1 cut(s) 1764
MaeII ACGT 9 cut(s) 18, 117, 571, 1381, 1489, 2293, 2319, 2804, 3426
MflI RGATCY 4 cut(s) 177, 1583, 2981, 3335
MhlI GDGCHC 2 cut(s) 1029, 3226
MlyI GAGTC 4 cut(s) 716, 1961, 2206, 3098
MmeI TCCRAC 8 cut(s) 511, 556, 583, 1016, 1279, 1669, 2532, 3457
Mph1103I ATGCAT 2 cut(s) 1045, 3348
MroI TCCGGA 1 cut(s) 2287
MroXI GAANNNNTTC 4 cut(s) 538, 753, 1200, 2586
MslI CAYNNNNRTG 2 cut(s) 1338, 1860
MspA1I CMGCKG 2 cut(s) 387, 1120
MspCI CTTAAG 1 cut(s) 1991
MspI CCGG 2 cut(s) 2288, 2866
MspR9I CCNGG 5 cut(s) 924, 1766, 1819, 2682, 3189
MvaI CCWGG 5 cut(s) 924, 1766, 1819, 2682, 3189
MvnI CGCG 4 cut(s) 546, 2772, 3423, 3492
MwoI GCNNNNNNNGC 7 cut(s) 206, 368, 1420, 1429, 1711, 3074, 3534
NdeI CATATG 1 cut(s) 3055
NlaIV GGNNCC 2 cut(s) 1601, 3554
NmeAIII GCCGAG 1 cut(s) 3185
NmuCI GTSAC 5 cut(s) 446, 979, 1318, 1390, 2489
NruI TCGCGA 2 cut(s) 3423, 3492
NsiI ATGCAT 2 cut(s) 1045, 3348
NspI RCATGY 4 cut(s) 1043, 2699, 3261, 3452
OliI CACNNNNGTG 1 cut(s) 1338
PaeI GCATGC 1 cut(s) 1043
PaeR7I CTCGAG 1 cut(s) 996
PagI TCATGA 2 cut(s) 403, 1416
PciI ACATGT 2 cut(s) 2695, 3448
PciSI GCTCTTC 1 cut(s) 405
PdmI GAANNNNTTC 4 cut(s) 538, 753, 1200, 2586
PflFI GACNNNGTC 1 cut(s) 116
PfoI TCCNGGA 1 cut(s) 922
PkrI GCNGC 5 cut(s) 397, 412, 2426, 2459, 2951
PleI GAGTC 4 cut(s) 716, 1960, 2206, 3098
PpsI GAGTC 4 cut(s) 716, 1960, 2206, 3098
Ppu21I YACGTR 1 cut(s) 572
PpuMI RGGWCCY 2 cut(s) 54, 2014
PscI ACATGT 2 cut(s) 2695, 3448
PshBI ATTAAT 1 cut(s) 3659
PsiI TTATAA 3 cut(s) 941, 1221, 2034
Psp124BI GAGCTC 2 cut(s) 1029, 3226
Psp1406I AACGTT 2 cut(s) 1381, 2319
Psp5II RGGWCCY 2 cut(s) 54, 2014
Psp6I CCWGG 5 cut(s) 922, 1764, 1817, 2680, 3187
PspEI GGTNACC 1 cut(s) 2489
PspFI CCCAGC 1 cut(s) 3274
PspGI CCWGG 5 cut(s) 922, 1764, 1817, 2680, 3187
PspN4I GGNNCC 2 cut(s) 1601, 3554
PspPI GGNCC 7 cut(s) 54, 64, 920, 2014, 2455, 2684, 3092
PspPPI RGGWCCY 2 cut(s) 54, 2014
PstI CTGCAG 1 cut(s) 2184
PsuI RGATCY 4 cut(s) 177, 1583, 2981, 3335
PsyI GACNNNGTC 1 cut(s) 116
PvuII CAGCTG 1 cut(s) 387
RruI TCGCGA 2 cut(s) 3423, 3492
RseI CAYNNNNRTG 2 cut(s) 1338, 1860
SacI GAGCTC 2 cut(s) 1029, 3226
SapI GCTCTTC 1 cut(s) 405
SatI GCNGC 5 cut(s) 396, 411, 2425, 2458, 2950
Sau96I GGNCC 7 cut(s) 54, 64, 920, 2014, 2455, 2684, 3092
ScaI AGTACT 1 cut(s) 2377
SchI GAGTC 4 cut(s) 716, 1961, 2206, 3098
ScrFI CCNGG 5 cut(s) 924, 1766, 1819, 2682, 3189
SduI GDGCHC 2 cut(s) 1029, 3226
SexAI ACCWGGT 1 cut(s) 1764
SfcI CTRYAG 3 cut(s) 2180, 2624, 3389
Sfr274I CTCGAG 1 cut(s) 996
SinI GGWCC 4 cut(s) 54, 920, 2014, 3092
SlaI CTCGAG 1 cut(s) 996
SmiI ATTTAAAT 1 cut(s) 2256
SmiMI CAYNNNNRTG 2 cut(s) 1338, 1860
SmlI CTYRAG 5 cut(s) 996, 1022, 1991, 2009, 3366
SmoI CTYRAG 5 cut(s) 996, 1022, 1991, 2009, 3366
SphI GCATGC 1 cut(s) 1043
SsiI CCGC 6 cut(s) 1118, 1783, 2458, 2949, 3526, 3703
SspI AATATT 1 cut(s) 288
SstI GAGCTC 2 cut(s) 1029, 3226
StyD4I CCNGG 5 cut(s) 922, 1764, 1817, 2680, 3187
StyI CCWWGG 1 cut(s) 1980
SwaI ATTTAAAT 1 cut(s) 2256
TaiI ACGT 9 cut(s) 21, 120, 574, 1384, 1492, 2296, 2322, 2807, 3429
TaqII GACCGA 1 cut(s) 78
TatI WGTACW 5 cut(s) 1525, 1657, 1798, 2375, 2567
TauI GCSGC 2 cut(s) 2460, 2952
TscAI CASTG 6 cut(s) 1372, 1399, 2570, 2583, 2887, 3154
TseFI GTSAC 5 cut(s) 446, 979, 1318, 1390, 2489
TseI GCWGC 3 cut(s) 395, 410, 2424
Tsp45I GTSAC 5 cut(s) 446, 979, 1318, 1390, 2489
TspGWI ACGGA 3 cut(s) 161, 1448, 3135
TspRI CASTG 6 cut(s) 1372, 1399, 2570, 2583, 2887, 3154
Tth111I GACNNNGTC 1 cut(s) 116
Vha464I CTTAAG 1 cut(s) 1991
VpaK11BI GGWCC 4 cut(s) 54, 920, 2014, 3092
VspI ATTAAT 1 cut(s) 3659
XceI RCATGY 4 cut(s) 1043, 2699, 3261, 3452
XhoI CTCGAG 1 cut(s) 996
XmiI GTMKAC 1 cut(s) 487
XmnI GAANNNNTTC 4 cut(s) 538, 753, 1200, 2586
ZraI GACGTC 2 cut(s) 19, 118
ZrmI AGTACT 1 cut(s) 2377
Zsp2I ATGCAT 2 cut(s) 1045, 3348
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.