AT5G25195

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
5
OG0000186
Physical Location & Seq
Forward (+)
8716180 .. 8716423
244 bp
Loading structure...
UTR
Exon/CDS
Intron
AT5G25195.1

Sequence Viewer

Length: 180 bp
ATGATACTGAGTTTTGAGATACGGATTACAACTAAGATTGAGGTCAAGATGGTGTCGTGGAGCAAGTTCTTGAGAATGGATACAGGATCTAAGATAGTCAACGTACTTGCACCCGAGTTGTTTCGGATGCTTTTCAAGGAAAACAAATTTAGTCAAGAGACAGGGATTATAGATATGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

59

Amino Acids

6.94

Weight (kDa)

9.3

Isoelectric Point (pI)

35.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000186)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G11608 AT1G11620 AT1G11810 AT1G12170 AT1G12190 AT1G24800 AT1G24881 AT1G25055 AT1G25141 AT1G25150 AT1G25150 AT1G25211 AT1G31510 AT1G32140 AT1G32430 AT1G47390 AT1G50470 AT1G51290 AT1G51320 AT1G53325 AT1G54550 AT1G58090 AT1G59630 AT1G59680 AT1G59680 AT1G62270 AT1G65990 AT1G66490 AT1G67450 AT1G67455 AT1G67455 AT1G77650 AT1G77655 AT2G04920 AT2G07120 AT2G07140 AT2G07140 AT2G11200 AT2G14710 AT2G17310 AT2G17830 AT2G18780 AT2G24510 AT2G27520 AT2G33655 AT2G38590 AT2G39355 AT3G03405 AT3G04250 AT3G08750 AT3G10430 AT3G13680 AT3G13820 AT3G13830 AT3G14030 AT3G16020 AT3G16020 AT3G16020 AT3G16555 AT3G16580 AT3G16590 AT3G16740 AT3G16820 AT3G16880 AT3G17265 AT3G17270 AT3G17280 AT3G17280 AT3G17320 AT3G17400 AT3G17480 AT3G17490 AT3G17500 AT3G17500 AT3G17530 AT3G17540 AT3G17560 AT3G17570 AT3G17620 AT3G17710 AT3G18120 AT3G18320 AT3G18330 AT3G18340 AT3G18905 AT3G18910 AT3G18980 AT3G18980 AT3G19410 AT3G19470 AT3G19470 AT3G19560 AT3G19565 AT3G19880 AT3G19890 AT3G20030 AT3G20400 AT3G20690 AT3G20700 AT3G20710 AT3G21120 AT3G21130 AT3G21170 AT3G21410 AT3G22350 AT3G22350 AT3G22421 AT3G22650 AT3G22650 AT3G22700 AT3G22710 AT3G22720 AT3G22730 AT3G22770 AT3G22870 AT3G22940 AT3G23260 AT3G23420 AT3G23420 AT3G23633 AT3G23633 AT3G23680 AT3G23685 AT3G24580 AT3G24700 AT3G24700 AT3G25090 AT3G25090 AT3G25460 AT3G44120 AT3G44130 AT3G49510 AT3G49520 AT3G49980 AT3G49980 AT3G51171 AT3G59590 AT3G59610 AT4G04690 AT4G05080 AT4G09870 AT4G10190 AT4G10740 AT4G17200 AT4G33290 AT5G25195 AT5G36190 AT5G36200 AT5G36730 AT5G36820 AT5G37040 AT5G41490 AT5G41500 AT5G41510 AT5G42460 AT5G47300 AT5G51000 AT5G60560 AT5G60560 AT5G62830

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 94
AcsI RAATTY 1 cut(s) 146
AfaI GTAC 1 cut(s) 105
AgsI TTSAA 1 cut(s) 136
Alw26I GTCTC 1 cut(s) 152
AlwI GGATC 1 cut(s) 94
Ama87I CYCGRG 1 cut(s) 113
ApoI RAATTY 1 cut(s) 146
AvaI CYCGRG 1 cut(s) 113
BccI CCATC 1 cut(s) 43
BciVI GTATCC 1 cut(s) 73
BcoDI GTCTC 1 cut(s) 152
BfuI GTATCC 1 cut(s) 73
BmeT110I CYCGRG 1 cut(s) 113
BmsI GCATC 1 cut(s) 117
BpuEI CTTGAG 1 cut(s) 91
BseGI GGATG 1 cut(s) 132
BsiHKCI CYCGRG 1 cut(s) 113
BsmAI GTCTC 1 cut(s) 152
BsoBI CYCGRG 1 cut(s) 113
Bsp143I GATC 1 cut(s) 86
BspPI GGATC 1 cut(s) 94
BssMI GATC 1 cut(s) 86
BstDEI CTNAG 3 cut(s) 8, 33, 90
BstF5I GGATG 1 cut(s) 132
BstKTI GATC 1 cut(s) 89
BstMAI GTCTC 1 cut(s) 152
BstMBI GATC 1 cut(s) 86
BstX2I RGATCY 1 cut(s) 86
BstYI RGATCY 1 cut(s) 86
BsuI GTATCC 1 cut(s) 73
BtsCI GGATG 1 cut(s) 132
Csp6I GTAC 1 cut(s) 104
CviQI GTAC 1 cut(s) 104
DdeI CTNAG 3 cut(s) 8, 33, 90
DpnI GATC 1 cut(s) 88
DpnII GATC 1 cut(s) 86
Eco88I CYCGRG 1 cut(s) 113
FaiI YATR 2 cut(s) 170, 176
FokI GGATG 1 cut(s) 139
HincII GTYRAC 1 cut(s) 100
HindII GTYRAC 1 cut(s) 100
Hpy166II GTNNAC 1 cut(s) 100
Hpy188I TCNGA 1 cut(s) 126
Hpy188III TCNNGA 3 cut(s) 46, 70, 155
Hpy8I GTNNAC 1 cut(s) 100
HpyCH4IV ACGT 1 cut(s) 102
HpyCH4V TGCA 1 cut(s) 110
HpyF3I CTNAG 3 cut(s) 8, 33, 90
HpySE526I ACGT 1 cut(s) 102
Kzo9I GATC 1 cut(s) 86
LmnI GCTCC 1 cut(s) 60
LpnPI CCDG 2 cut(s) 69, 147
LweI GCATC 1 cut(s) 117
MaeII ACGT 1 cut(s) 102
MalI GATC 1 cut(s) 88
MboI GATC 1 cut(s) 86
MflI RGATCY 1 cut(s) 86
MluCI AATT 1 cut(s) 146
MnlI CCTC 1 cut(s) 34
NdeII GATC 1 cut(s) 86
PsuI RGATCY 1 cut(s) 86
RsaI GTAC 1 cut(s) 105
RsaNI GTAC 1 cut(s) 104
Sau3AI GATC 1 cut(s) 86
SetI ASST 2 cut(s) 45, 105
SfaNI GCATC 1 cut(s) 117
SmlI CTYRAG 1 cut(s) 70
SmoI CTYRAG 1 cut(s) 70
Sse9I AATT 1 cut(s) 146
TaiI ACGT 1 cut(s) 105
TasI AATT 1 cut(s) 146
TspGWI ACGGA 1 cut(s) 37
XapI RAATTY 1 cut(s) 146
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.