pycom09g18940

Uncharacterized protein K02A2.6-like

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr9
Physical Location & Seq
Reverse (-)
19732739 .. 19733077
339 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 339 bp
ATGCGACAAGAGTTAGAAGACTTAGAAGAAAGTCGAATCGATGCAGTTAATTTGTTAATAGCACAAAAGAAAATTGCCGAGCGAGCGTATAATCAGCGTGTAAGACAAAAAACGTTCGGCGAAGGAGAATTGGTTTGGCAAACTGTGTTGCCTGTTGGGATTAAAGACCCCAGATTTGGTAAATGGTCGCCAAATTGGGAAGGGCCATTCATCGTTCACAAAATACTCGGCAAGGGGGCATATCATTTACGAGATCGGACGGGTTCAGTTCACAAATTGCCGATTAATGGAAAGTTTTTAAAGAAGTACTACCCAATTACATGGGAAATGCAAGAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

113

Amino Acids

13.16

Weight (kDa)

9.56

Isoelectric Point (pI)

28.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000160)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g11612 FvH4_2g25851 FvH4_3g22802 FvH4_3g22805 FvH4_3g31361 FvH4_3g31382 FvH4_4g05272 FvH4_4g05273 FvH4_4g14567 FvH4_4g15161 FvH4_5g22540 FvH4_6g13113 FvH4_6g31923 FvH4_6g31924 FvH4_6g33651 FvH4_6g45122 FvH4_7g03662
pyrus_communis pycom01g04240 pycom01g24010 pycom02g18210 pycom02g19420 pycom05g06510 pycom09g15750 pycom09g18940 pycom12g02580 pycom12g03100 pycom12g08310 pycom13g22710 pycom13g28060 pycom16g18340 pycom16g18350 pycom16g24880 pycom16g26240 pycom461g00260 pycom520g00980 pycom520g01320
rosa_chinensis RchiOBHm_Chr1g0320731 RchiOBHm_Chr2g0102771 RchiOBHm_Chr3g0462151 RchiOBHm_Chr5g0038141 RchiOBHm_Chr5g0069371 RchiOBHm_Chr7g0239101
rosa_multiflora Rmu_co8038252.1_g000001 Rmu_co8138412.1_g000001 Rmu_co8331087.1_g000001 Rmu_co8479311.1_g000001 Rmu_sc0000112.1_g000018 Rmu_sc0000346.1_g000012 Rmu_sc0002102.1_g000002 Rmu_sc0003505.1_g000013 Rmu_sc0004249.1_g000007 Rmu_sc0004448.1_g000010 Rmu_sc0004594.1_g000011 Rmu_sc0004915.1_g000010 Rmu_sc0008019.1_g000019 Rmu_sc0008303.1_g000001 Rmu_sc0008355.1_g000005 Rmu_sc0009253.1_g000018 Rmu_sc0010211.1_g000002 Rmu_sc0010252.1_g000009 Rmu_sc0011534.1_g000008 Rmu_sc0014811.1_g000009 Rmu_sc0019475.1_g000001 Rmu_sc0024897.1_g000001 Rmu_sc0024898.1_g000001 Rmu_sc0031791.1_g000001 Rmu_sc0038715.1_g000001
rosa_roxburghii Rroxscaffold_165G00436940 Rroxscaffold_174G00435270 Rroxscaffold_177G00434330 Rroxscaffold_177G00434340 Rroxscaffold_177G00434350 Rroxscaffold_1G00002160 Rroxscaffold_1G00025260 Rroxscaffold_1G00042950 Rroxscaffold_1G00068010 Rroxscaffold_2G00107530 Rroxscaffold_3G00221190 Rroxscaffold_3G00221520 Rroxscaffold_3G00223200 Rroxscaffold_4G00322230 Rroxscaffold_4G00331810 Rroxscaffold_5G00385150 Rroxscaffold_5G00387510 Rroxscaffold_6G00410520 Rroxscaffold_6G00423360 Rroxscaffold_6G00423370 Rroxscaffold_6G00429210 Rroxscaffold_7G00158300 Rroxscaffold_7G00163480 Rroxscaffold_7G00171410 Rroxscaffold_7G00178940 Rroxscaffold_7G00199480 Rroxscaffold_7G00205630 Rroxscaffold_7G00207440
rosa_rugosa Rorug01G0056400 Rorug04G0063900 Rorug05G0251400 Rorug07G0221900
rosa_samantha Rh1DG169400 Rh2AG292900 Rh2DG519200 Rh4DG260600 Rh5AG042600 Rh6BG117500
rosa_wichuraiana Rw0G001900 Rw0G005150 Rw0G006380 Rw0G015140 Rw0G016320 Rw0G019440 Rw0G019840 Rw0G023740 Rw1G001590 Rw1G002180 Rw1G003560 Rw1G004280 Rw1G006110 Rw1G006680 Rw1G007920 Rw1G008480 Rw1G009120 Rw1G010310 Rw1G014900 Rw1G019650 Rw1G022070 Rw1G022170 Rw1G041570 Rw2G002740 Rw2G005760 Rw2G032370 Rw2G046770 Rw2G050600 Rw2G051420 Rw3G015930 Rw3G016280 Rw3G019580 Rw3G028420 Rw4G003430 Rw4G005350 Rw4G007530 Rw4G008150 Rw4G009580 Rw4G010250 Rw4G015800 Rw4G017000 Rw4G017910 Rw4G018510 Rw4G019700 Rw4G031010 Rw5G012650 Rw5G020140 Rw5G022060 Rw5G034420 Rw5G035560 Rw5G043010 Rw5G046750 Rw5G047340 Rw5G049500 Rw6G001390 Rw6G002210 Rw6G004530 Rw6G004770 Rw6G005100 Rw6G005890 Rw6G011860 Rw6G014680 Rw6G019480 Rw6G028970 Rw6G033800 Rw7G013050 Rw7G014800 Rw7G025760 Rw7G025850 Rw7G026730 Rw7G026870 Rw7G036330 Rw7G036430 Rw7G039320 Rw7G039510 Rw7G039560 Rw7G041370 Rw7G042050

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 113
AfaI GTAC 1 cut(s) 308
AfiI CCNNNNNNNGG 2 cut(s) 176, 287
AoxI GGCC 1 cut(s) 203
ArsI GACNNNNNNTTYG 2 cut(s) 158, 190
AseI ATTAAT 1 cut(s) 285
AspS9I GGNCC 1 cut(s) 203
BbsI GAAGAC 1 cut(s) 24
BmcAI AGTACT 1 cut(s) 308
BmgT120I GGNCC 1 cut(s) 203
BmsI GCATC 1 cut(s) 31
BpiI GAAGAC 1 cut(s) 24
Bsa29I ATCGAT 1 cut(s) 39
BsaXI ACNNNNNCTCC 2 cut(s) 117, 147
Bsc4I CCNNNNNNNGG 2 cut(s) 176, 287
BseCI ATCGAT 1 cut(s) 39
BseLI CCNNNNNNNGG 2 cut(s) 176, 287
BshFI GGCC 1 cut(s) 205
BshVI ATCGAT 1 cut(s) 39
BslI CCNNNNNNNGG 2 cut(s) 176, 287
BsnI GGCC 1 cut(s) 205
Bsp143I GATC 1 cut(s) 253
BspANI GGCC 1 cut(s) 205
BspDI ATCGAT 1 cut(s) 39
BssMI GATC 1 cut(s) 253
Bst4CI ACNGT 1 cut(s) 145
BstC8I GCNNGC 1 cut(s) 84
BstDEI CTNAG 1 cut(s) 22
BstKTI GATC 1 cut(s) 256
BstMBI GATC 1 cut(s) 253
BstMWI GCNNNNNNNGC 1 cut(s) 83
BstV2I GAAGAC 1 cut(s) 24
BstXI CCANNNNNNTGG 1 cut(s) 321
Bsu15I ATCGAT 1 cut(s) 39
BsuRI GGCC 1 cut(s) 205
BsuTUI ATCGAT 1 cut(s) 39
Cac8I GCNNGC 1 cut(s) 84
Cfr13I GGNCC 1 cut(s) 203
ClaI ATCGAT 1 cut(s) 39
Csp6I GTAC 1 cut(s) 307
CviAII CATG 1 cut(s) 321
CviJI RGCY 1 cut(s) 205
CviKI_1 RGCY 1 cut(s) 205
CviQI GTAC 1 cut(s) 307
DdeI CTNAG 1 cut(s) 22
DpnI GATC 1 cut(s) 255
DpnII GATC 1 cut(s) 253
DraI TTTAAA 1 cut(s) 300
FaeI CATG 1 cut(s) 324
FaiI YATR 3 cut(s) 90, 241, 322
FatI CATG 1 cut(s) 320
HaeIII GGCC 1 cut(s) 205
Hin1II CATG 1 cut(s) 324
HinfI GANTC 1 cut(s) 36
Hpy166II GTNNAC 2 cut(s) 217, 271
Hpy188I TCNGA 1 cut(s) 258
Hpy8I GTNNAC 2 cut(s) 217, 271
HpyAV CCTTC 2 cut(s) 116, 194
HpyCH4III ACNGT 1 cut(s) 145
HpyCH4IV ACGT 1 cut(s) 113
HpyCH4V TGCA 2 cut(s) 44, 331
HpyF10VI GCNNNNNNNGC 1 cut(s) 83
HpyF3I CTNAG 1 cut(s) 22
HpySE526I ACGT 1 cut(s) 113
Hsp92II CATG 1 cut(s) 324
Kzo9I GATC 1 cut(s) 253
LpnPI CCDG 2 cut(s) 165, 184
LweI GCATC 1 cut(s) 31
MaeII ACGT 1 cut(s) 113
MalI GATC 1 cut(s) 255
MboI GATC 1 cut(s) 253
MboII GAAGA 2 cut(s) 29, 38
MluCI AATT 6 cut(s) 49, 72, 128, 193, 275, 315
MseI TTAA 5 cut(s) 48, 56, 162, 285, 299
MwoI GCNNNNNNNGC 1 cut(s) 83
NdeII GATC 1 cut(s) 253
NlaIII CATG 1 cut(s) 324
NmeAIII GCCGAG 2 cut(s) 103, 207
PfeI GAWTC 1 cut(s) 36
PshBI ATTAAT 1 cut(s) 285
Psp1406I AACGTT 1 cut(s) 113
PspPI GGNCC 1 cut(s) 203
RsaI GTAC 1 cut(s) 308
RsaNI GTAC 1 cut(s) 307
SaqAI TTAA 5 cut(s) 48, 56, 162, 285, 299
Sau3AI GATC 1 cut(s) 253
Sau96I GGNCC 1 cut(s) 203
ScaI AGTACT 1 cut(s) 308
SetI ASST 1 cut(s) 116
SfaNI GCATC 1 cut(s) 31
Sse9I AATT 6 cut(s) 49, 72, 128, 193, 275, 315
TaaI ACNGT 1 cut(s) 145
TaiI ACGT 1 cut(s) 116
TaqI TCGA 2 cut(s) 34, 39
TasI AATT 6 cut(s) 49, 72, 128, 193, 275, 315
TatI WGTACW 1 cut(s) 306
TfiI GAWTC 1 cut(s) 36
Tru1I TTAA 5 cut(s) 48, 56, 162, 285, 299
Tru9I TTAA 5 cut(s) 48, 56, 162, 285, 299
TspDTI ATGAA 1 cut(s) 199
VspI ATTAAT 1 cut(s) 285
ZrmI AGTACT 1 cut(s) 308
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.