Rmu_sc0008355.1_g000005

Uncharacterized protein K02A2.6-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0008355.1
OG0000160
Physical Location & Seq
Forward (+)
9918 .. 10364
447 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0008355.1_g000005.1.cds

Sequence Viewer

Length: 447 bp
atgggaatcagaggcgtacaaatacttggcaattctctcttggttatcaatcagttgtgcaaagagtttagatgcattagcttcatgttagtcccttatttgaacaggacattagaactgttgaaccagtttgatgacatggatctgaagcacattcctctcgaacgaaatttcaccgctaacgagttggcccagctggcaacaagggtaacattgagatatggcgtgcgcgagagaatccttaaagccgagcatcgcacgcttccttcatggatggcgagaagtgatcctccaaacgataccttagtcgcgaccttggaatccattgacgtggattggcgcatccctttgatcaattatctcaagtatcctgatcagaccacagatagaaggattcgctatcttgccctcaactacttcctcagaagtgatgaactttgcagatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_1 RVT_3 rve

Protein Analysis

148

Amino Acids

17.46

Weight (kDa)

8.5

Isoelectric Point (pI)

27.26

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000160)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g11612 FvH4_2g25851 FvH4_3g22802 FvH4_3g22805 FvH4_3g31361 FvH4_3g31382 FvH4_4g05272 FvH4_4g05273 FvH4_4g14567 FvH4_4g15161 FvH4_5g22540 FvH4_6g13113 FvH4_6g31923 FvH4_6g31924 FvH4_6g33651 FvH4_6g45122 FvH4_7g03662
pyrus_communis pycom01g04240 pycom01g24010 pycom02g18210 pycom02g19420 pycom05g06510 pycom09g15750 pycom09g18940 pycom12g02580 pycom12g03100 pycom12g08310 pycom13g22710 pycom13g28060 pycom16g18340 pycom16g18350 pycom16g24880 pycom16g26240 pycom461g00260 pycom520g00980 pycom520g01320
rosa_chinensis RchiOBHm_Chr1g0320731 RchiOBHm_Chr2g0102771 RchiOBHm_Chr3g0462151 RchiOBHm_Chr5g0038141 RchiOBHm_Chr5g0069371 RchiOBHm_Chr7g0239101
rosa_multiflora Rmu_co8038252.1_g000001 Rmu_co8138412.1_g000001 Rmu_co8331087.1_g000001 Rmu_co8479311.1_g000001 Rmu_sc0000112.1_g000018 Rmu_sc0000346.1_g000012 Rmu_sc0002102.1_g000002 Rmu_sc0003505.1_g000013 Rmu_sc0004249.1_g000007 Rmu_sc0004448.1_g000010 Rmu_sc0004594.1_g000011 Rmu_sc0004915.1_g000010 Rmu_sc0008019.1_g000019 Rmu_sc0008303.1_g000001 Rmu_sc0008355.1_g000005 Rmu_sc0009253.1_g000018 Rmu_sc0010211.1_g000002 Rmu_sc0010252.1_g000009 Rmu_sc0011534.1_g000008 Rmu_sc0014811.1_g000009 Rmu_sc0019475.1_g000001 Rmu_sc0024897.1_g000001 Rmu_sc0024898.1_g000001 Rmu_sc0031791.1_g000001 Rmu_sc0038715.1_g000001
rosa_roxburghii Rroxscaffold_165G00436940 Rroxscaffold_174G00435270 Rroxscaffold_177G00434330 Rroxscaffold_177G00434340 Rroxscaffold_177G00434350 Rroxscaffold_1G00002160 Rroxscaffold_1G00025260 Rroxscaffold_1G00042950 Rroxscaffold_1G00068010 Rroxscaffold_2G00107530 Rroxscaffold_3G00221190 Rroxscaffold_3G00221520 Rroxscaffold_3G00223200 Rroxscaffold_4G00322230 Rroxscaffold_4G00331810 Rroxscaffold_5G00385150 Rroxscaffold_5G00387510 Rroxscaffold_6G00410520 Rroxscaffold_6G00423360 Rroxscaffold_6G00423370 Rroxscaffold_6G00429210 Rroxscaffold_7G00158300 Rroxscaffold_7G00163480 Rroxscaffold_7G00171410 Rroxscaffold_7G00178940 Rroxscaffold_7G00199480 Rroxscaffold_7G00205630 Rroxscaffold_7G00207440
rosa_rugosa Rorug01G0056400 Rorug04G0063900 Rorug05G0251400 Rorug07G0221900
rosa_samantha Rh1DG169400 Rh2AG292900 Rh2DG519200 Rh4DG260600 Rh5AG042600 Rh6BG117500
rosa_wichuraiana Rw0G001900 Rw0G005150 Rw0G006380 Rw0G015140 Rw0G016320 Rw0G019440 Rw0G019840 Rw0G023740 Rw1G001590 Rw1G002180 Rw1G003560 Rw1G004280 Rw1G006110 Rw1G006680 Rw1G007920 Rw1G008480 Rw1G009120 Rw1G010310 Rw1G014900 Rw1G019650 Rw1G022070 Rw1G022170 Rw1G041570 Rw2G002740 Rw2G005760 Rw2G032370 Rw2G046770 Rw2G050600 Rw2G051420 Rw3G015930 Rw3G016280 Rw3G019580 Rw3G028420 Rw4G003430 Rw4G005350 Rw4G007530 Rw4G008150 Rw4G009580 Rw4G010250 Rw4G015800 Rw4G017000 Rw4G017910 Rw4G018510 Rw4G019700 Rw4G031010 Rw5G012650 Rw5G020140 Rw5G022060 Rw5G034420 Rw5G035560 Rw5G043010 Rw5G046750 Rw5G047340 Rw5G049500 Rw6G001390 Rw6G002210 Rw6G004530 Rw6G004770 Rw6G005100 Rw6G005890 Rw6G011860 Rw6G014680 Rw6G019480 Rw6G028970 Rw6G033800 Rw7G013050 Rw7G014800 Rw7G025760 Rw7G025850 Rw7G026730 Rw7G026870 Rw7G036330 Rw7G036430 Rw7G039320 Rw7G039510 Rw7G039560 Rw7G041370 Rw7G042050

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 2 cut(s) 231, 311
AciI CCGC 1 cut(s) 177
AclWI GGATC 2 cut(s) 150, 281
AcsI RAATTY 1 cut(s) 169
AcuI CTGAAG 1 cut(s) 167
AfaI GTAC 1 cut(s) 18
AgsI TTSAA 2 cut(s) 103, 124
AjiI CACGTC 1 cut(s) 331
AluBI AGCT 2 cut(s) 81, 196
AluI AGCT 2 cut(s) 81, 196
AlwI GGATC 2 cut(s) 150, 281
AoxI GGCC 1 cut(s) 189
ApoI RAATTY 1 cut(s) 169
AspLEI GCGC 2 cut(s) 231, 342
AspS9I GGNCC 1 cut(s) 190
AsuHPI GGTGA 1 cut(s) 166
BaeI ACNNNNGTAYC 2 cut(s) 291, 324
BccI CCATC 1 cut(s) 268
BciVI GTATCC 1 cut(s) 378
BclI TGATCA 2 cut(s) 351, 373
BfuI GTATCC 1 cut(s) 378
BglI GCCNNNNNGGC 1 cut(s) 197
BmgBI CACGTC 1 cut(s) 331
BmgT120I GGNCC 1 cut(s) 190
BmsI GCATC 3 cut(s) 62, 262, 351
BpuEI CTTGAG 1 cut(s) 347
BsaJI CCNNGG 1 cut(s) 315
Bse1I ACTGG 1 cut(s) 127
BseDI CCNNGG 1 cut(s) 315
BseGI GGATG 2 cut(s) 279, 342
BseMII CTCAG 1 cut(s) 436
BseNI ACTGG 1 cut(s) 127
BseYI CCCAGC 1 cut(s) 192
Bsh1236I CGCG 2 cut(s) 231, 311
BshFI GGCC 1 cut(s) 191
BslFI GGGAC 1 cut(s) 77
BsmFI GGGAC 1 cut(s) 77
BsnI GGCC 1 cut(s) 191
Bsp143I GATC 4 cut(s) 142, 286, 351, 373
Bsp68I TCGCGA 1 cut(s) 311
BspACI CCGC 1 cut(s) 177
BspANI GGCC 1 cut(s) 191
BspCNI CTCAG 1 cut(s) 435
BspFNI CGCG 2 cut(s) 231, 311
BspPI GGATC 2 cut(s) 150, 281
BsrI ACTGG 1 cut(s) 127
BssECI CCNNGG 1 cut(s) 315
BssMI GATC 4 cut(s) 142, 286, 351, 373
BssT1I CCWWGG 1 cut(s) 315
Bst4CI ACNGT 1 cut(s) 120
BstC8I GCNNGC 3 cut(s) 198, 227, 260
BstDEI CTNAG 2 cut(s) 304, 422
BstF5I GGATG 2 cut(s) 279, 342
BstFNI CGCG 2 cut(s) 231, 311
BstHHI GCGC 2 cut(s) 231, 342
BstKTI GATC 4 cut(s) 145, 289, 354, 376
BstMBI GATC 4 cut(s) 142, 286, 351, 373
BstMWI GCNNNNNNNGC 2 cut(s) 197, 259
BstUI CGCG 2 cut(s) 231, 311
BstX2I RGATCY 1 cut(s) 142
BstXI CCANNNNNNTGG 1 cut(s) 331
BstYI RGATCY 1 cut(s) 142
BsuI GTATCC 1 cut(s) 378
BsuRI GGCC 1 cut(s) 191
BtgZI GCGATG 1 cut(s) 239
BtrI CACGTC 1 cut(s) 331
BtsCI GGATG 2 cut(s) 279, 342
BtuMI TCGCGA 1 cut(s) 311
Cac8I GCNNGC 3 cut(s) 198, 227, 260
CfoI GCGC 2 cut(s) 231, 342
Cfr13I GGNCC 1 cut(s) 190
Csp6I GTAC 1 cut(s) 17
CviAII CATG 3 cut(s) 85, 139, 270
CviJI RGCY 4 cut(s) 81, 191, 196, 248
CviKI_1 RGCY 4 cut(s) 81, 191, 196, 248
CviQI GTAC 1 cut(s) 17
DdeI CTNAG 2 cut(s) 304, 422
DpnI GATC 4 cut(s) 144, 288, 353, 375
DpnII GATC 4 cut(s) 142, 286, 351, 373
Eco130I CCWWGG 1 cut(s) 315
Eco57I CTGAAG 1 cut(s) 167
EcoT14I CCWWGG 1 cut(s) 315
EcoT22I ATGCAT 1 cut(s) 77
ErhI CCWWGG 1 cut(s) 315
FaeI CATG 3 cut(s) 88, 142, 273
FaiI YATR 4 cut(s) 86, 140, 222, 271
FaqI GGGAC 1 cut(s) 77
FatI CATG 3 cut(s) 84, 138, 269
FbaI TGATCA 2 cut(s) 351, 373
FokI GGATG 2 cut(s) 286, 329
GlaI GCGC 2 cut(s) 230, 341
GsaI CCCAGC 1 cut(s) 196
HaeIII GGCC 1 cut(s) 191
HhaI GCGC 2 cut(s) 231, 342
Hin1II CATG 3 cut(s) 88, 142, 273
Hin6I GCGC 2 cut(s) 229, 340
HinP1I GCGC 2 cut(s) 229, 340
HinfI GANTC 4 cut(s) 6, 237, 320, 394
HphI GGTGA 1 cut(s) 166
Hpy188I TCNGA 4 cut(s) 11, 147, 378, 425
Hpy188III TCNNGA 3 cut(s) 161, 310, 371
HpyAV CCTTC 2 cut(s) 276, 384
HpyCH4III ACNGT 1 cut(s) 120
HpyCH4IV ACGT 1 cut(s) 330
HpyCH4V TGCA 3 cut(s) 60, 75, 441
HpyF10VI GCNNNNNNNGC 2 cut(s) 197, 259
HpyF3I CTNAG 2 cut(s) 304, 422
HpySE526I ACGT 1 cut(s) 330
Hsp92II CATG 3 cut(s) 88, 142, 273
HspAI GCGC 2 cut(s) 229, 340
Ksp22I TGATCA 2 cut(s) 351, 373
Kzo9I GATC 4 cut(s) 142, 286, 351, 373
LpnPI CCDG 5 cut(s) 91, 140, 182, 206, 384
LweI GCATC 3 cut(s) 62, 262, 351
MaeII ACGT 1 cut(s) 330
MaeIII GTNAC 1 cut(s) 208
MalI GATC 4 cut(s) 144, 288, 353, 375
MboI GATC 4 cut(s) 142, 286, 351, 373
MflI RGATCY 1 cut(s) 142
MluCI AATT 3 cut(s) 31, 169, 355
MnlI CCTC 5 cut(s) 5, 168, 300, 419, 431
Mph1103I ATGCAT 1 cut(s) 77
MseI TTAA 1 cut(s) 243
MslI CAYNNNNRTG 1 cut(s) 329
MspA1I CMGCKG 1 cut(s) 196
MvnI CGCG 2 cut(s) 231, 311
MwoI GCNNNNNNNGC 2 cut(s) 197, 259
NdeII GATC 4 cut(s) 142, 286, 351, 373
NlaIII CATG 3 cut(s) 88, 142, 273
NmeAIII GCCGAG 1 cut(s) 274
NruI TCGCGA 1 cut(s) 311
NsiI ATGCAT 1 cut(s) 77
PfeI GAWTC 4 cut(s) 6, 237, 320, 394
PspFI CCCAGC 1 cut(s) 192
PspPI GGNCC 1 cut(s) 190
PsuI RGATCY 1 cut(s) 142
PvuII CAGCTG 1 cut(s) 196
RruI TCGCGA 1 cut(s) 311
RsaI GTAC 1 cut(s) 18
RsaNI GTAC 1 cut(s) 17
RseI CAYNNNNRTG 1 cut(s) 329
SaqAI TTAA 1 cut(s) 243
Sau3AI GATC 4 cut(s) 142, 286, 351, 373
Sau96I GGNCC 1 cut(s) 190
SetI ASST 5 cut(s) 83, 198, 305, 317, 333
SfaNI GCATC 3 cut(s) 62, 262, 351
SmiMI CAYNNNNRTG 1 cut(s) 329
SmlI CTYRAG 1 cut(s) 362
SmoI CTYRAG 1 cut(s) 362
Sse9I AATT 3 cut(s) 31, 169, 355
SsiI CCGC 1 cut(s) 177
StyI CCWWGG 1 cut(s) 315
TaaI ACNGT 1 cut(s) 120
TaiI ACGT 1 cut(s) 333
TaqI TCGA 1 cut(s) 162
TasI AATT 3 cut(s) 31, 169, 355
TfiI GAWTC 4 cut(s) 6, 237, 320, 394
Tru1I TTAA 1 cut(s) 243
Tru9I TTAA 1 cut(s) 243
TspDTI ATGAA 3 cut(s) 73, 258, 447
XapI RAATTY 1 cut(s) 169
Zsp2I ATGCAT 1 cut(s) 77
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.