pycom520g00980

Uncharacterized protein K02A2.6-like

Basic Information

Type: gene
Biological Identity
pyrus_communis
SuperScaffold_520
Physical Location & Seq
Reverse (-)
767570 .. 767929
360 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom520g00980.1

Sequence Viewer

Length: 360 bp
ATGGCTATACAAGAAGGCTTGACTGATGAAGAAAATGCAAAGTTGCGCCTTCAGGAGTTGGAAGCACTGGATGAGAGGAGGCTCGAAGCTCAACAACACTTGGAATGCTACCAAGCACGGTTATCCAAGGCATTCAACAAGAAAGTCCGCCCAAGGTCTTTCCAAGCCGGAGATCTCGTGCTGGCATTGCGTAGGCCTATCATTACAACTCATAAGACAAAAAGCAAGTTCACATCAAAATGGGATGGACCCTACGTAATACAAGAGATCTACACCAATGGCGCCTACTTAATCATGGCAGAAGACGGGTTGGAGATCGGCCCCATCAACGGCAGATTTTTGAAGCGCTACTACCCCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

120

Amino Acids

13.81

Weight (kDa)

9.04

Isoelectric Point (pI)

52.45

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000160)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g11612 FvH4_2g25851 FvH4_3g22802 FvH4_3g22805 FvH4_3g31361 FvH4_3g31382 FvH4_4g05272 FvH4_4g05273 FvH4_4g14567 FvH4_4g15161 FvH4_5g22540 FvH4_6g13113 FvH4_6g31923 FvH4_6g31924 FvH4_6g33651 FvH4_6g45122 FvH4_7g03662
pyrus_communis pycom01g04240 pycom01g24010 pycom02g18210 pycom02g19420 pycom05g06510 pycom09g15750 pycom09g18940 pycom12g02580 pycom12g03100 pycom12g08310 pycom13g22710 pycom13g28060 pycom16g18340 pycom16g18350 pycom16g24880 pycom16g26240 pycom461g00260 pycom520g00980 pycom520g01320
rosa_chinensis RchiOBHm_Chr1g0320731 RchiOBHm_Chr2g0102771 RchiOBHm_Chr3g0462151 RchiOBHm_Chr5g0038141 RchiOBHm_Chr5g0069371 RchiOBHm_Chr7g0239101
rosa_multiflora Rmu_co8038252.1_g000001 Rmu_co8138412.1_g000001 Rmu_co8331087.1_g000001 Rmu_co8479311.1_g000001 Rmu_sc0000112.1_g000018 Rmu_sc0000346.1_g000012 Rmu_sc0002102.1_g000002 Rmu_sc0003505.1_g000013 Rmu_sc0004249.1_g000007 Rmu_sc0004448.1_g000010 Rmu_sc0004594.1_g000011 Rmu_sc0004915.1_g000010 Rmu_sc0008019.1_g000019 Rmu_sc0008303.1_g000001 Rmu_sc0008355.1_g000005 Rmu_sc0009253.1_g000018 Rmu_sc0010211.1_g000002 Rmu_sc0010252.1_g000009 Rmu_sc0011534.1_g000008 Rmu_sc0014811.1_g000009 Rmu_sc0019475.1_g000001 Rmu_sc0024897.1_g000001 Rmu_sc0024898.1_g000001 Rmu_sc0031791.1_g000001 Rmu_sc0038715.1_g000001
rosa_roxburghii Rroxscaffold_165G00436940 Rroxscaffold_174G00435270 Rroxscaffold_177G00434330 Rroxscaffold_177G00434340 Rroxscaffold_177G00434350 Rroxscaffold_1G00002160 Rroxscaffold_1G00025260 Rroxscaffold_1G00042950 Rroxscaffold_1G00068010 Rroxscaffold_2G00107530 Rroxscaffold_3G00221190 Rroxscaffold_3G00221520 Rroxscaffold_3G00223200 Rroxscaffold_4G00322230 Rroxscaffold_4G00331810 Rroxscaffold_5G00385150 Rroxscaffold_5G00387510 Rroxscaffold_6G00410520 Rroxscaffold_6G00423360 Rroxscaffold_6G00423370 Rroxscaffold_6G00429210 Rroxscaffold_7G00158300 Rroxscaffold_7G00163480 Rroxscaffold_7G00171410 Rroxscaffold_7G00178940 Rroxscaffold_7G00199480 Rroxscaffold_7G00205630 Rroxscaffold_7G00207440
rosa_rugosa Rorug01G0056400 Rorug04G0063900 Rorug05G0251400 Rorug07G0221900
rosa_samantha Rh1DG169400 Rh2AG292900 Rh2DG519200 Rh4DG260600 Rh5AG042600 Rh6BG117500
rosa_wichuraiana Rw0G001900 Rw0G005150 Rw0G006380 Rw0G015140 Rw0G016320 Rw0G019440 Rw0G019840 Rw0G023740 Rw1G001590 Rw1G002180 Rw1G003560 Rw1G004280 Rw1G006110 Rw1G006680 Rw1G007920 Rw1G008480 Rw1G009120 Rw1G010310 Rw1G014900 Rw1G019650 Rw1G022070 Rw1G022170 Rw1G041570 Rw2G002740 Rw2G005760 Rw2G032370 Rw2G046770 Rw2G050600 Rw2G051420 Rw3G015930 Rw3G016280 Rw3G019580 Rw3G028420 Rw4G003430 Rw4G005350 Rw4G007530 Rw4G008150 Rw4G009580 Rw4G010250 Rw4G015800 Rw4G017000 Rw4G017910 Rw4G018510 Rw4G019700 Rw4G031010 Rw5G012650 Rw5G020140 Rw5G022060 Rw5G034420 Rw5G035560 Rw5G043010 Rw5G046750 Rw5G047340 Rw5G049500 Rw6G001390 Rw6G002210 Rw6G004530 Rw6G004770 Rw6G005100 Rw6G005890 Rw6G011860 Rw6G014680 Rw6G019480 Rw6G028970 Rw6G033800 Rw7G013050 Rw7G014800 Rw7G025760 Rw7G025850 Rw7G026730 Rw7G026870 Rw7G036330 Rw7G036430 Rw7G039320 Rw7G039510 Rw7G039560 Rw7G041370 Rw7G042050

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 281
AciI CCGC 1 cut(s) 148
AcuI CTGAAG 1 cut(s) 35
AcyI GRCGYC 1 cut(s) 282
AfeI AGCGCT 1 cut(s) 347
AfiI CCNNNNNNNGG 1 cut(s) 329
AgsI TTSAA 2 cut(s) 136, 343
AluBI AGCT 1 cut(s) 89
AluI AGCT 1 cut(s) 89
Aor51HI AGCGCT 1 cut(s) 347
AoxI GGCC 2 cut(s) 194, 319
AspLEI GCGC 3 cut(s) 48, 284, 348
AspS9I GGNCC 2 cut(s) 248, 320
AvaII GGWCC 1 cut(s) 248
BanI GGYRCC 1 cut(s) 281
BarI GAAGNNNNNNTAC 1 cut(s) 335
BauI CACGAG 1 cut(s) 176
BbsI GAAGAC 1 cut(s) 309
BccI CCATC 2 cut(s) 239, 332
BceAI ACGGC 1 cut(s) 346
BfoI RGCGCY 2 cut(s) 285, 349
BglII AGATCT 2 cut(s) 172, 267
Bme18I GGWCC 1 cut(s) 248
BmgT120I GGNCC 2 cut(s) 248, 320
BmiI GGNNCC 3 cut(s) 250, 283, 322
BpiI GAAGAC 1 cut(s) 309
BsaAI YACGTR 1 cut(s) 256
BsaHI GRCGYC 1 cut(s) 282
BsaJI CCNNGG 2 cut(s) 126, 152
BsaXI ACNNNNNCTCC 2 cut(s) 162, 192
Bsc4I CCNNNNNNNGG 1 cut(s) 329
Bse1I ACTGG 1 cut(s) 72
Bse3DI GCAATG 1 cut(s) 185
BseDI CCNNGG 2 cut(s) 126, 152
BseGI GGATG 2 cut(s) 76, 250
BseLI CCNNNNNNNGG 1 cut(s) 329
BseMI GCAATG 1 cut(s) 185
BseNI ACTGG 1 cut(s) 72
BseRI GAGGAG 1 cut(s) 91
BshFI GGCC 2 cut(s) 196, 321
BshNI GGYRCC 1 cut(s) 281
BsiSI CCGG 1 cut(s) 168
BslI CCNNNNNNNGG 1 cut(s) 329
BsmI GAATGC 2 cut(s) 110, 131
BsnI GGCC 2 cut(s) 196, 321
Bsp143I GATC 3 cut(s) 172, 267, 315
BspACI CCGC 1 cut(s) 148
BspANI GGCC 2 cut(s) 196, 321
BspLI GGNNCC 3 cut(s) 250, 283, 322
BspT107I GGYRCC 1 cut(s) 281
BsrDI GCAATG 1 cut(s) 185
BsrI ACTGG 1 cut(s) 72
BssECI CCNNGG 2 cut(s) 126, 152
BssMI GATC 3 cut(s) 172, 267, 315
BssNI GRCGYC 1 cut(s) 282
BssSI CACGAG 1 cut(s) 176
BssT1I CCWWGG 2 cut(s) 126, 152
Bst2BI CACGAG 1 cut(s) 176
Bst4CI ACNGT 1 cut(s) 120
BstACI GRCGYC 1 cut(s) 282
BstBAI YACGTR 1 cut(s) 256
BstC8I GCNNGC 1 cut(s) 183
BstF5I GGATG 2 cut(s) 76, 250
BstH2I RGCGCY 2 cut(s) 285, 349
BstHHI GCGC 3 cut(s) 48, 284, 348
BstKTI GATC 3 cut(s) 175, 270, 318
BstMBI GATC 3 cut(s) 172, 267, 315
BstMWI GCNNNNNNNGC 1 cut(s) 187
BstSNI TACGTA 1 cut(s) 256
BstV2I GAAGAC 1 cut(s) 309
BstX2I RGATCY 2 cut(s) 172, 267
BstYI RGATCY 2 cut(s) 172, 267
BsuRI GGCC 2 cut(s) 196, 321
BtsCI GGATG 2 cut(s) 76, 250
BtsIMutI CAGTG 1 cut(s) 65
Cac8I GCNNGC 1 cut(s) 183
CfoI GCGC 3 cut(s) 48, 284, 348
Cfr13I GGNCC 2 cut(s) 248, 320
CviAII CATG 1 cut(s) 295
CviJI RGCY 7 cut(s) 5, 18, 82, 89, 167, 196, 321
CviKI_1 RGCY 7 cut(s) 5, 18, 82, 89, 167, 196, 321
DinI GGCGCC 1 cut(s) 283
DpnI GATC 3 cut(s) 174, 269, 317
DpnII GATC 3 cut(s) 172, 267, 315
EciI GGCGGA 1 cut(s) 137
Eco105I TACGTA 1 cut(s) 256
Eco130I CCWWGG 2 cut(s) 126, 152
Eco147I AGGCCT 1 cut(s) 196
Eco47I GGWCC 1 cut(s) 248
Eco47III AGCGCT 1 cut(s) 347
Eco57I CTGAAG 1 cut(s) 35
EcoT14I CCWWGG 2 cut(s) 126, 152
EgeI GGCGCC 1 cut(s) 283
EheI GGCGCC 1 cut(s) 283
ErhI CCWWGG 2 cut(s) 126, 152
FaeI CATG 1 cut(s) 298
FaiI YATR 3 cut(s) 8, 213, 296
FatI CATG 1 cut(s) 294
FokI GGATG 2 cut(s) 83, 257
GlaI GCGC 3 cut(s) 47, 283, 347
HaeII RGCGCY 2 cut(s) 285, 349
HaeIII GGCC 2 cut(s) 196, 321
HapII CCGG 1 cut(s) 168
HhaI GCGC 3 cut(s) 48, 284, 348
Hin1I GRCGYC 1 cut(s) 282
Hin1II CATG 1 cut(s) 298
Hin6I GCGC 3 cut(s) 46, 282, 346
HinP1I GCGC 3 cut(s) 46, 282, 346
HpaII CCGG 1 cut(s) 168
Hpy166II GTNNAC 1 cut(s) 231
Hpy188III TCNNGA 1 cut(s) 53
Hpy8I GTNNAC 1 cut(s) 231
HpyAV CCTTC 2 cut(s) 8, 59
HpyCH4III ACNGT 1 cut(s) 120
HpyCH4IV ACGT 1 cut(s) 255
HpyCH4V TGCA 1 cut(s) 38
HpyF10VI GCNNNNNNNGC 1 cut(s) 187
HpySE526I ACGT 1 cut(s) 255
Hsp92I GRCGYC 1 cut(s) 282
Hsp92II CATG 1 cut(s) 298
HspAI GCGC 3 cut(s) 46, 282, 346
KasI GGCGCC 1 cut(s) 281
Kzo9I GATC 3 cut(s) 172, 267, 315
LpnPI CCDG 4 cut(s) 38, 53, 167, 181
MaeII ACGT 1 cut(s) 255
MalI GATC 3 cut(s) 174, 269, 317
MboI GATC 3 cut(s) 172, 267, 315
MboII GAAGA 2 cut(s) 41, 314
MflI RGATCY 2 cut(s) 172, 267
Mly113I GGCGCC 1 cut(s) 282
MmeI TCCRAC 2 cut(s) 39, 291
MnlI CCTC 2 cut(s) 69, 72
MseI TTAA 1 cut(s) 290
MslI CAYNNNNRTG 1 cut(s) 238
MspI CCGG 1 cut(s) 168
Mva1269I GAATGC 2 cut(s) 110, 131
MwoI GCNNNNNNNGC 1 cut(s) 187
NarI GGCGCC 1 cut(s) 282
NdeII GATC 3 cut(s) 172, 267, 315
NlaIII CATG 1 cut(s) 298
NlaIV GGNNCC 3 cut(s) 250, 283, 322
PceI AGGCCT 1 cut(s) 196
PctI GAATGC 2 cut(s) 110, 131
PluTI GGCGCC 1 cut(s) 285
Ppu21I YACGTR 1 cut(s) 256
PspN4I GGNNCC 3 cut(s) 250, 283, 322
PspPI GGNCC 2 cut(s) 248, 320
PsuI RGATCY 2 cut(s) 172, 267
RseI CAYNNNNRTG 1 cut(s) 238
SaqAI TTAA 1 cut(s) 290
Sau3AI GATC 3 cut(s) 172, 267, 315
Sau96I GGNCC 2 cut(s) 248, 320
SetI ASST 3 cut(s) 91, 158, 258
SfoI GGCGCC 1 cut(s) 283
SinI GGWCC 1 cut(s) 248
SmiMI CAYNNNNRTG 1 cut(s) 238
SnaBI TACGTA 1 cut(s) 256
SseBI AGGCCT 1 cut(s) 196
SsiI CCGC 1 cut(s) 148
SspDI GGCGCC 1 cut(s) 281
StuI AGGCCT 1 cut(s) 196
StyI CCWWGG 2 cut(s) 126, 152
TaaI ACNGT 1 cut(s) 120
TaiI ACGT 1 cut(s) 258
TaqI TCGA 1 cut(s) 84
Tru1I TTAA 1 cut(s) 290
Tru9I TTAA 1 cut(s) 290
TscAI CASTG 1 cut(s) 72
TspDTI ATGAA 1 cut(s) 42
TspRI CASTG 1 cut(s) 72
VpaK11BI GGWCC 1 cut(s) 248
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.