Rmu_ssc0000234.1_g000013

disease resistance

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000234.1
OG0000042
Physical Location & Seq
Forward (+)
69121 .. 81089
11969 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000234.1_g000013.1.cds

Sequence Viewer

Length: 4317 bp
atggagtttcttattgcaattggcactggaattgttggaaagattgccgagtacacagttgaaccagtcatacgccaagtgggatatataatctgctacaacaggaacctcaagaaactacagagtcaagtgggtgacttaggtgatgctagactaagggtgtggcatgatgtggaaacggaaaaaagaaaaggtaaacaaattgaaacagatgtgcacaactggctgactaaagtggaagagatcacggaagaagcaaatgattttttgaaagctgaacaccaagcaaagatcaagtgtctacatggcttttgtcctaatttaaagcttcgccaccagttgagcaggaagtctacaaaattggttcaagaggtcgttgaactctttggcaaaaaagattttcctaatattgcatactatgtttccccagaagaggtatgtgtgatatctaccaaagattacgaggcctttgattcaaggacttcagttgtgaagaaaattatggatgaactgagaaactctgatacagacataattggggtgtatggtattgggggagtgggcaagacaacactcgtcaaagaagtttataggcaggctataaaagacaagaagctgtttgatgatgtggtggtagtagttgatgtgaaacaaatttcagacttggaaggaattcaaaaaaaaattgttgataagttaggtatggacattgctggagatgagagtatggatagaagagcacgtcgtctatgtgataggctaaaagataaaagggctcttataattttggatgatgttgttgaaagaattgatttggaggttgtgggacttcctcgtttggtgacttgcaaaatattgttgacatctagaagcagacgagtattatctgtggagatgcatacacagaaagagtttcagctccacgtattagacgagaaagaaacttggagtttatttgccaagatggccggtgatgtagtcaagaatcccaatatacgaacagtagcaactaaagtagctgaaaaatgtgggggattgccagttttggttgtcactgtcgcaagtgctttaaagaagagtaccttaaatgcatggaaagatgctttgagacgactacagaattttgacaaggaaggatttactgaaaaagcatacttagctctggagtggagttacaatcaattagatgaggagaagctcaagtcgttattcttgctctgtggacttctattaggattcacacagagtgctccgtttgatgacttgttaaggtatggcatgggtttgggtttgttcgaaagtcttgaaacaatggaagaagcaagaaatgcattgcattcgctgcttgaaaagctaaaagattcgtgcttattggtagacagtgatgatatcacatataccagaatgcacgatcttgtacgagatgttgctaaccggattgcatcaagagatcatcatgtcttgtcattagcacacggaaatgagttgaaagaatggcctaataaggagttccttaaaaagtgcaccgcaatctcttccccttactgcaatatccccaaatttcctgatgttttggaatgcccagaactaaagatattttatttgtggggtggtgatcatgacacactagaaattccatgcaacctttttcaagacatggaaaatctcaaagtgttggatctaaccaagttgtgtattgggccatcactaccttcatctcttcggttcctaaggaatcttcggacactaggtttctataattgcatactgggagacatagctcaagttgggcaattgggaaacttagaagttcttacttttgatcaatccaatgtcaagttgttgcccaaagaaataggacaattgactcgtctacgattactggatttgactaattgctccaaactagaagtgatatcacctgatgttatatctagtttgaaaagactagaagaattgagagtaggaaaaaatagcttttaccaatgggagtatgaaggagtcatgagtacagaaagaagtaatgcaagccttcaagagctaaagcacttgtcccagttaacctcgttacaaatacatataccagatgctagcattcttccagcagatttgttcaccaataagttggagagattccaaatatgtattggttctgtgtggaattggaatgatgtggatgaaaccctcaacgcactaaagctccaactcactatcagcagtgaattggaccctagtctagatatgttgctgaaaagaactgaagacttgtacttggagttgatggagagtactaatagcaatattgtccatcaattaggtactgaagtttttcagcaactgaaacatctccacattcaaaacagtgctggacttgcatacgtcattaacgggaaggtcagttttcccaacttgacatggttggcagtgagtgaactcaacagttcaagattcttgttatcatcttcaatggctagatgccttgcacaactcaaacatcttcagatatctggatgtcaaatcatggaagagatagtatcaattgaagaatctaatgaagaaaataataagaacttgttttgccagctagaggatctagagctaaaagaccttccaaagctcactaaattctgctcttctctaaattcgtcctttgagagaatgaaatttgaggattgtactaaaagtagtacaatcagtgaagaaattgaagagaccgactcaaatggaattcttgacattgtgatacaacagtttctctttgacaacaaggtagagcttccaaacttgaagaagttgtccattagtggcctagaaaagttgaggacaatatggaacggtcaattctctttagaaagttcaaaaaatctagaatctgtaaaaattgactcatgccaaagtttgaaaaatatatttccagcgtcgatggccaaaaatcttcaggggttaagccggttggtggttaagaagtgtggagtggaggaaatcattgcaaacgacggggaaccacaaacaatgccaacttttgttttcccaaatgtcacttatgtgtccttaaaagaattgccccaacttaggtgtttctatccagccatgcatgcttcaacttggccagcacttcaaaaattggaggttgttggatgctacaaattggagattttctctgaggcactttcaagctttcaaggaaaatatgaatcaaacctgtccactccaattaaacaaactctcttttcaattgagaaggattcattcgccaacttggaaatcttgagtttatgcagcatggagatttggaatggtccacttccggtccacttctttagaaaactaaaatatcttgcagtttgttgtccacagtccaagtcagttgttttccttgacaaattactcgatgaaggaagctctagtactcggcaaagagaggaagcagtggagattgggaccctcccacatttaattaggttgaaactaagtctaactcccaacctgatgcatcttggcgaggataactcacaatcagccccccgcatcccaaattttccaaacctggaaattctactgctgaatggttgcgacagcttaaggaatctaagatcatccgcaatatccttcaagaatctgacaactttggaagtacgtcgttgcaagggattgaagtacttgctaacttactccgtggccaaaggtttaagacagctcacaaaactggaagttgaggattgcaagagacttgtgagtatagtgggaagcaccgaagaagacgagtcgggaaataataatgagattatattgaggcggttgaaacatttgaaactttcttttctaccaagactgcgaggcttttgctccggaaattgcattgctaaactcccagccttggaaactttatccatcagcaaccgtctcaaattgaagattttcccggctcaagacgaaccgctacagacaacaaacgaggaggaagacacagatgtcgatgcctgggaggcgaagctgaccgctgaggatgaaatgaatttggcaagtactgatttgatatctttgtttggctccaaaattagctggagagcaccaacctcgtcacagggttcttttcttgccttccggagaaggacttctttgccttacgcgggtaagggctttggatgtggtctcttcgcgttcaccaaatcgatactcaacgttggcgtttcccttgcttcgctggaagtaacagtggcggttgtgctcgcagtcggctcctggggagactgggactggaaatacggtcgccgagttgaactggtgaggctgacaatcggctcgcgaggagactag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04626 map04626
Pfam Domains
Protein Families
LRR_8 NB-ARC

Protein Analysis

1438

Amino Acids

162.48

Weight (kDa)

6.07

Isoelectric Point (pI)

45.03

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000042)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g07760 FvH4_1g18111 FvH4_1g18121 FvH4_1g18142 FvH4_1g18160 FvH4_3g04780 FvH4_3g04780 FvH4_3g04780 FvH4_3g05070 FvH4_3g29991 FvH4_4g06020 FvH4_4g06020 FvH4_4g06020 FvH4_4g06020 FvH4_4g06020 FvH4_4g06020 FvH4_4g06021 FvH4_4g06022 FvH4_4g10330 FvH4_5g02660 FvH4_5g02660 FvH4_5g02660 FvH4_5g02660 FvH4_5g02660 FvH4_5g02660 FvH4_5g02660 FvH4_5g02660 FvH4_5g02660 FvH4_5g05380 FvH4_5g18950 FvH4_5g18991 FvH4_5g18992 FvH4_6g53580 FvH4_7g31140 FvH4_7g31140 FvH4_7g31140 FvH4_7g31140 FvH4_7g31140 FvH4_7g31140 FvH4_7g31140
malus_domestica MD08G1082300.v1.1 MD08G1083200.v1.1 MD08G1083600.v1.1 MD08G1083700.v1.1 MD09G1272000.v1.1 MD09G1272400.v1.1 MD09G1272500.v1.1 MD09G1272700.v1.1 MD09G1272800.v1.1 MD09G1273400.v1.1 MD09G1273700.v1.1 MD09G1274000.v1.1 MD09G1274100.v1.1 MD09G1274200.v1.1 MD09G1274400.v1.1 MD11G1203100.v1.1 MD13G1197600.v1.1 MD15G1069900.v1.1 MD15G1070000.v1.1
prunus_persica Prupe.3G016600_v2.0.a1 Prupe.3G016700_v2.0.a1 Prupe.4G236500_v2.0.a1
pyrus_communis pycom08g06810 pycom08g06820 pycom08g06830 pycom08g06850 pycom08g06860 pycom08g06870 pycom08g06900 pycom08g06910 pycom08g06920 pycom08g06950 pycom09g18250 pycom09g18300 pycom09g18310 pycom09g18340 pycom09g18360 pycom09g18390 pycom09g18410 pycom09g18420 pycom09g18470 pycom09g18510 pycom11g17610 pycom15g06550 pycom15g06560 pycom15g06570 pycom15g06590 pycom15g06600
rosa_chinensis RchiOBHm_Chr1g0356991 RchiOBHm_Chr1g0357001 RchiOBHm_Chr2g0085061 RchiOBHm_Chr2g0085071 RchiOBHm_Chr2g0085111 RchiOBHm_Chr2g0085121 RchiOBHm_Chr2g0108611 RchiOBHm_Chr2g0109281 RchiOBHm_Chr4g0396311 RchiOBHm_Chr4g0397551 RchiOBHm_Chr4g0397781 RchiOBHm_Chr4g0397831 RchiOBHm_Chr4g0397841 RchiOBHm_Chr4g0397871 RchiOBHm_Chr4g0397911 RchiOBHm_Chr4g0397921 RchiOBHm_Chr4g0398201 RchiOBHm_Chr4g0398211 RchiOBHm_Chr4g0408401 RchiOBHm_Chr5g0016101 RchiOBHm_Chr5g0016111 RchiOBHm_Chr5g0016321 RchiOBHm_Chr5g0016331 RchiOBHm_Chr5g0016341 RchiOBHm_Chr5g0016351 RchiOBHm_Chr7g0203341 RchiOBHm_Chr7g0203371 RchiOBHm_Chr7g0203421 RchiOBHm_Chr7g0204211 RchiOBHm_Chr7g0204231 RchiOBHm_Chr7g0236741
rosa_laevigata RLG00000001063 RLG00000009379 RLG00000009397 RLG00000009399 RLG00000009402 RLG00000009403 RLG00000009407 RLG00000009411 RLG00000009429 RLG00000009550 RLG00000009551 RLG00000015657 RLG00000017681 RLG00000028063 RLG00000028065 RLG00000028066 RLG00000032242 RLG00000032245 RLG00000035025 RLG00000035026 RLG00000035027 RLG00000035031
rosa_multiflora Rmu_co7992674.1_g000001 Rmu_co8252071.1_g000001 Rmu_co8481849.1_g000001 Rmu_sc0000166.1_g000026 Rmu_sc0000166.1_g000032 Rmu_sc0000166.1_g000036 Rmu_sc0000299.1_g000001 Rmu_sc0000332.1_g000001 Rmu_sc0000361.1_g000022 Rmu_sc0000361.1_g000023 Rmu_sc0000361.1_g000024 Rmu_sc0000361.1_g000034 Rmu_sc0000361.1_g000053 Rmu_sc0000571.1_g000009 Rmu_sc0000777.1_g000005 Rmu_sc0000777.1_g000013 Rmu_sc0000787.1_g000002 Rmu_sc0000795.1_g000061 Rmu_sc0000795.1_g000068 Rmu_sc0001074.1_g000012 Rmu_sc0001074.1_g000024 Rmu_sc0001196.1_g000010 Rmu_sc0001196.1_g000013 Rmu_sc0001235.1_g000035 Rmu_sc0001320.1_g000009 Rmu_sc0001320.1_g000010 Rmu_sc0001588.1_g000017 Rmu_sc0001779.1_g000028 Rmu_sc0001807.1_g000009 Rmu_sc0001959.1_g000001 Rmu_sc0001959.1_g000003 Rmu_sc0001959.1_g000004 Rmu_sc0001959.1_g000025 Rmu_sc0002148.1_g000007 Rmu_sc0002148.1_g000013 Rmu_sc0002212.1_g000007 Rmu_sc0002321.1_g000015 Rmu_sc0002460.1_g000018 Rmu_sc0002540.1_g000008 Rmu_sc0002647.1_g000001 Rmu_sc0003347.1_g000005 Rmu_sc0003347.1_g000013 Rmu_sc0003582.1_g000009 Rmu_sc0003720.1_g000025 Rmu_sc0004527.1_g000001 Rmu_sc0004557.1_g000001 Rmu_sc0004595.1_g000015 Rmu_sc0004595.1_g000020 Rmu_sc0004834.1_g000001 Rmu_sc0004904.1_g000029 Rmu_sc0005276.1_g000007 Rmu_sc0005276.1_g000008 Rmu_sc0005276.1_g000010 Rmu_sc0005276.1_g000019 Rmu_sc0005506.1_g000016 Rmu_sc0005723.1_g000003 Rmu_sc0005766.1_g000006 Rmu_sc0006749.1_g000001 Rmu_sc0006749.1_g000002 Rmu_sc0006985.1_g000001 Rmu_sc0007032.1_g000011 Rmu_sc0007315.1_g000007 Rmu_sc0007574.1_g000003 Rmu_sc0008179.1_g000001 Rmu_sc0008179.1_g000002 Rmu_sc0008208.1_g000001 Rmu_sc0008647.1_g000014 Rmu_sc0008647.1_g000016 Rmu_sc0009960.1_g000001 Rmu_sc0010313.1_g000013 Rmu_sc0010376.1_g000001 Rmu_sc0012840.1_g000006 Rmu_sc0013807.1_g000003 Rmu_sc0013807.1_g000004 Rmu_sc0013807.1_g000005 Rmu_sc0014155.1_g000001 Rmu_sc0015959.1_g000003 Rmu_sc0015959.1_g000004 Rmu_sc0016628.1_g000001 Rmu_sc0018579.1_g000001 Rmu_sc0019842.1_g000001 Rmu_sc0022243.1_g000001 Rmu_sc0022243.1_g000002 Rmu_sc0023640.1_g000001 Rmu_sc0028411.1_g000001 Rmu_sc0033723.1_g000001 Rmu_sc0038038.1_g000001 Rmu_sc0039543.1_g000001 Rmu_sc0040505.1_g000001 Rmu_sc0043049.1_g000001 Rmu_ssc0000234.1_g000013
rosa_roxburghii Rroxscaffold_1G00024370 Rroxscaffold_1G00024400 Rroxscaffold_1G00024420 Rroxscaffold_1G00039110 Rroxscaffold_1G00060530 Rroxscaffold_1G00060560 Rroxscaffold_2G00132370 Rroxscaffold_2G00134940 Rroxscaffold_2G00134960 Rroxscaffold_2G00155630 Rroxscaffold_3G00253360 Rroxscaffold_3G00253840 Rroxscaffold_3G00253850 Rroxscaffold_4G00299140 Rroxscaffold_4G00299150 Rroxscaffold_5G00341140 Rroxscaffold_5G00341150 Rroxscaffold_5G00342380 Rroxscaffold_5G00342390 Rroxscaffold_5G00342580 Rroxscaffold_5G00342590 Rroxscaffold_5G00342600 Rroxscaffold_5G00342620 Rroxscaffold_5G00342640 Rroxscaffold_5G00342670 Rroxscaffold_5G00342680 Rroxscaffold_5G00342720 Rroxscaffold_5G00342750 Rroxscaffold_5G00342760 Rroxscaffold_5G00342770 Rroxscaffold_5G00342780 Rroxscaffold_5G00342790 Rroxscaffold_5G00342820 Rroxscaffold_5G00342880
rosa_rugosa Rorug01G0064000 Rorug01G0252600 Rorug01G0252700 Rorug01G0252900 Rorug01G0253000 Rorug01G0457800 Rorug02G0154700 Rorug02G0154800 Rorug02G0159000 Rorug03G0342700 Rorug03G0350300 Rorug04G0004400 Rorug05G0031200 Rorug05G0031300 Rorug05G0031400 Rorug05G0031800 Rorug05G0295400 Rorug05G0295500 Rorug07G0075800.1 Rorug07G0075900 Rorug07G0076000
rosa_samantha Rh1AG267100 Rh1BG234600 Rh1BG234800 Rh1BG234900 Rh1CG250500 Rh1CG250900 Rh1CG251100 Rh1DG262000 Rh1DG262200 Rh1DG262300 Rh2AG005800 Rh2AG006000 Rh2AG203700 Rh2AG204000 Rh2AG204400 Rh2AG210500 Rh2AG210600 Rh2BG006700 Rh2BG216500 Rh2BG220800 Rh2CG007100 Rh2CG007200 Rh2CG007400 Rh2CG007500 Rh2CG207700 Rh2CG212800 Rh2DG007100 Rh2DG007500 Rh2DG210800 Rh2DG216700 Rh2DG216800 Rh4AG078900 Rh4AG079000 Rh4AG080700 Rh4AG081300 Rh4AG084000 Rh4AG150000 Rh4BG066400 Rh4BG074400 Rh4BG074500 Rh4BG074900 Rh4BG075200 Rh4BG075300 Rh4BG075900 Rh4BG076700 Rh4BG078500 Rh4BG078600 Rh4BG078700 Rh4BG081500 Rh4CG073200 Rh4CG081000 Rh4CG084300 Rh4CG084400 Rh4CG084500 Rh4CG087200 Rh4CG087300 Rh4CG087800 Rh4CG088200 Rh4CG088900 Rh4CG091200 Rh4CG157300 Rh4DG063300 Rh4DG073700 Rh4DG074000 Rh4DG074100 Rh4DG074200 Rh4DG074300 Rh4DG142800 Rh5AG124600 Rh5AG125000 Rh5AG125100 Rh5AG125200 Rh5AG125300 Rh5AG367000 Rh5AG367100 Rh5AG367200 Rh5AG367300 Rh5AG367400 Rh5BG123600 Rh5BG123800 Rh5BG124300 Rh5BG377200 Rh5BG377500 Rh5CG135300 Rh5CG136400 Rh5CG136500 Rh5CG400600 Rh5CG400700 Rh5CG400800 Rh5DG122900 Rh5DG123000 Rh5DG124000 Rh5DG389900 Rh5DG390200 Rh5DG390700 Rh5DG390800 Rh7AG205300 Rh7AG210900 Rh7AG211500 Rh7AG221400 Rh7BG205100 Rh7BG209200 Rh7BG209400 Rh7BG425000 Rh7BG425100 Rh7CG216600 Rh7CG217200 Rh7CG217300 Rh7CG217700 Rh7DG115300 Rh7DG211800 Rh7DG212400 Rh7DG217600 Rh7DG218400
rosa_wichuraiana Rw0G002820 Rw0G003970 Rw0G003980 Rw0G015020 Rw0G018950 Rw0G020820 Rw0G021460 Rw0G021470 Rw1G023590 Rw1G023600 Rw2G000530 Rw2G000550 Rw2G016290 Rw4G005460 Rw4G006420 Rw4G006430 Rw4G006620 Rw4G006660 Rw4G006670 Rw4G006700 Rw4G006710 Rw4G006750 Rw4G006990 Rw4G007000 Rw4G012240 Rw5G010800 Rw5G010840 Rw5G010860 Rw5G034410 Rw5G034450 Rw5G034460 Rw7G017900 Rw7G017910 Rw7G017930 Rw7G019140 Rw7G037710

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 782
AasI GACNNNNNNGTC 1 cut(s) 3971
AccI GTMKAC 4 cut(s) 301, 353, 1377, 1873
AccII CGCG 3 cut(s) 4130, 4160, 4306
AccIII TCCGGA 2 cut(s) 3848, 4104
AciI CCGC 8 cut(s) 1527, 3526, 3600, 3796, 3938, 3999, 4130, 4220
AclI AACGTT 1 cut(s) 4182
AclWI GGATC 2 cut(s) 1686, 2598
AcoI YGGCCR 4 cut(s) 966, 2925, 3107, 3678
AcuI CTGAAG 5 cut(s) 468, 2280, 2343, 2483, 2921
AdeI CACNNNGTG 1 cut(s) 1247
AfiI CCNNNNNNNGG 6 cut(s) 433, 2587, 2956, 3072, 3877, 4130
AflII CTTAAG 1 cut(s) 3580
AjiI CACGTC 1 cut(s) 743
AjnI CCWGG 3 cut(s) 3546, 3980, 4241
AleI CACNNNNGTG 1 cut(s) 3044
Alw21I GWGCWC 6 cut(s) 219, 742, 1252, 1526, 4072, 4230
Alw26I GTCTC 8 cut(s) 1102, 1767, 2705, 3721, 3908, 4157, 4242, 4305
Alw44I GTGCAC 2 cut(s) 215, 1522
AlwI GGATC 2 cut(s) 1686, 2598
AlwNI CAGNNNCTG 1 cut(s) 2338
Aor13HI TCCGGA 2 cut(s) 3848, 4104
AoxI GGCC 8 cut(s) 465, 966, 1496, 1700, 2806, 2925, 3107, 3678
ApaLI GTGCAC 2 cut(s) 215, 1522
ApeKI GCWGC 2 cut(s) 1342, 3279
Asp700I GAANNNNTTC 4 cut(s) 672, 2328, 3917, 4114
AspS9I GGNCC 5 cut(s) 1700, 2227, 3299, 3310, 3441
AsuC2I CCSGG 1 cut(s) 3923
AsuHPI GGTGA 9 cut(s) 146, 155, 853, 983, 1625, 1911, 2107, 4156, 4297
AsuII TTCGAA 1 cut(s) 1296
AsuNHI GCTAGC 1 cut(s) 2090
AvaII GGWCC 4 cut(s) 2227, 3299, 3310, 3441
AxyI CCTNAGG 1 cut(s) 1730
BaeGI GKGCMC 2 cut(s) 219, 1526
BaeI ACNNNNGTAYC 4 cut(s) 2310, 2343, 2735, 2768
BalI TGGCCA 3 cut(s) 2927, 3109, 3680
BanII GRGCYC 1 cut(s) 778
BarI GAAGNNNNNNTAC 2 cut(s) 3391, 3423
BbsI GAAGAC 3 cut(s) 2268, 3765, 3969
Bbv12I GWGCWC 6 cut(s) 219, 742, 1252, 1526, 4072, 4230
BbvCI CCTCAGC 1 cut(s) 4002
BbvI GCAGC 2 cut(s) 1329, 3291
BccI CCATC 6 cut(s) 958, 1711, 2275, 2316, 2917, 3899
BcgI CGANNNNNNTGC 6 cut(s) 1320, 1354, 3825, 3859, 4059, 4093
BciT130I CCWGG 3 cut(s) 3548, 3982, 4243
BclI TGATCA 2 cut(s) 1615, 1822
BcnI CCSGG 1 cut(s) 3923
BcoDI GTCTC 8 cut(s) 1102, 1767, 2705, 3721, 3908, 4157, 4242, 4305
BfmI CTRYAG 3 cut(s) 119, 1115, 3941
BfrI CTTAAG 1 cut(s) 3580
BglI GCCNNNNNGGC 2 cut(s) 965, 3986
BisI GCNGC 2 cut(s) 1343, 3280
BlsI GCNGC 2 cut(s) 1344, 3281
BmcAI AGTACT 4 cut(s) 2290, 3409, 3659, 4027
Bme1390I CCNGG 4 cut(s) 3548, 3923, 3982, 4243
Bme18I GGWCC 4 cut(s) 2227, 3299, 3310, 3441
BmgBI CACGTC 1 cut(s) 743
BmgT120I GGNCC 5 cut(s) 1700, 2227, 3299, 3310, 3441
BmiI GGNNCC 8 cut(s) 107, 1727, 2229, 3003, 3442, 3443, 4051, 4240
BmrFI CCNGG 4 cut(s) 3548, 3923, 3982, 4243
BmrI ACTGGG 3 cut(s) 1778, 2050, 4261
BmtI GCTAGC 1 cut(s) 2094
BmuI ACTGGG 3 cut(s) 1778, 2050, 4261
BoxI GACNNNNGTC 1 cut(s) 2232
BpiI GAAGAC 3 cut(s) 2268, 3765, 3969
BplI GAGNNNNNCTC 6 cut(s) 2702, 2734, 3143, 3175, 3494, 3526
BpmI CTGGAG 3 cut(s) 735, 1184, 4084
Bpu10I CCTNAGC 1 cut(s) 4002
Bpu14I TTCGAA 1 cut(s) 1296
BpuEI CTTGAG 5 cut(s) 95, 1184, 1767, 3289, 3912
BpuMI CCSGG 1 cut(s) 3923
Bsa29I ATCGAT 1 cut(s) 4172
BsaAI YACGTR 1 cut(s) 925
BsaI GGTCTC 2 cut(s) 2705, 4157
BsaJI CCNNGG 4 cut(s) 3675, 3876, 3981, 4242
BsaWI WCCGGW 4 cut(s) 1434, 3307, 3848, 4104
BsaXI ACNNNNNCTCC 2 cut(s) 2184, 2214
Bsc4I CCNNNNNNNGG 6 cut(s) 433, 2587, 2956, 3072, 3877, 4130
Bse118I RCCGGY 2 cut(s) 968, 2949
Bse21I CCTNAGG 1 cut(s) 1730
Bse3DI GCAATG 4 cut(s) 708, 1331, 2985, 3858
BseAI TCCGGA 2 cut(s) 3848, 4104
BseBI CCWGG 3 cut(s) 3548, 3982, 4243
BseCI ATCGAT 1 cut(s) 4172
BseDI CCNNGG 4 cut(s) 3675, 3876, 3981, 4242
BseGI GGATG 9 cut(s) 511, 796, 2182, 2516, 3143, 3528, 3596, 4012, 4151
BseLI CCNNNNNNNGG 6 cut(s) 433, 2587, 2956, 3072, 3877, 4130
BseMI GCAATG 4 cut(s) 708, 1331, 2985, 3858
BseMII CTCAG 3 cut(s) 503, 3153, 3993
BseRI GAGGAG 2 cut(s) 1205, 3971
BseSI GKGCMC 2 cut(s) 219, 1526
BseXI GCAGC 2 cut(s) 1329, 3291
BseYI CCCAGC 1 cut(s) 3871
Bsh1236I CGCG 3 cut(s) 4130, 4160, 4306
Bsh1285I CGRYCG 1 cut(s) 4270
BshFI GGCC 8 cut(s) 467, 968, 1498, 1702, 2808, 2927, 3109, 3680
BshVI ATCGAT 1 cut(s) 4172
BsiEI CGRYCG 1 cut(s) 4270
BsiHKAI GWGCWC 6 cut(s) 219, 742, 1252, 1526, 4072, 4230
BsiSI CCGG 7 cut(s) 969, 1435, 2950, 3308, 3849, 3923, 4105
BslFI GGGAC 4 cut(s) 840, 2038, 3454, 4268
BslI CCNNNNNNNGG 6 cut(s) 433, 2587, 2956, 3072, 3877, 4130
BsmAI GTCTC 8 cut(s) 1102, 1767, 2705, 3721, 3908, 4157, 4242, 4305
BsmBI CGTCTC 2 cut(s) 1102, 3908
BsmFI GGGAC 4 cut(s) 840, 2038, 3454, 4268
BsmI GAATGC 4 cut(s) 1336, 1410, 1583, 2094
BsnI GGCC 8 cut(s) 467, 968, 1498, 1702, 2808, 2927, 3109, 3680
Bso31I GGTCTC 2 cut(s) 2705, 4157
Bsp119I TTCGAA 1 cut(s) 1296
Bsp1286I GDGCHC 7 cut(s) 219, 742, 778, 1252, 1526, 4072, 4230
Bsp13I TCCGGA 2 cut(s) 3848, 4104
Bsp143I GATC 9 cut(s) 243, 291, 1411, 1450, 1615, 1678, 1822, 2590, 3593
Bsp68I TCGCGA 1 cut(s) 4306
BspACI CCGC 8 cut(s) 1527, 3526, 3600, 3796, 3938, 3999, 4130, 4220
BspANI GGCC 8 cut(s) 467, 968, 1498, 1702, 2808, 2927, 3109, 3680
BspCNI CTCAG 3 cut(s) 504, 3154, 3994
BspDI ATCGAT 1 cut(s) 4172
BspEI TCCGGA 2 cut(s) 3848, 4104
BspFNI CGCG 3 cut(s) 4130, 4160, 4306
BspHI TCATGA 2 cut(s) 1618, 2004
BspLI GGNNCC 8 cut(s) 107, 1727, 2229, 3003, 3442, 3443, 4051, 4240
BspOI GCTAGC 1 cut(s) 2094
BspPI GGATC 2 cut(s) 1686, 2598
BspQI GCTCTTC 2 cut(s) 730, 2638
BspT104I TTCGAA 1 cut(s) 1296
BspTI CTTAAG 1 cut(s) 3580
BspTNI GGTCTC 2 cut(s) 2705, 4157
BsrDI GCAATG 4 cut(s) 708, 1331, 2985, 3858
BsrFI RCCGGY 2 cut(s) 968, 2949
BssAI RCCGGY 2 cut(s) 968, 2949
BssECI CCNNGG 4 cut(s) 3675, 3876, 3981, 4242
BssMI GATC 9 cut(s) 243, 291, 1411, 1450, 1615, 1678, 1822, 2590, 3593
BssT1I CCWWGG 1 cut(s) 3876
Bst2UI CCWGG 3 cut(s) 3548, 3982, 4243
BstAFI CTTAAG 1 cut(s) 3580
BstAPI GCANNNNNTGC 2 cut(s) 1328, 1342
BstBAI YACGTR 1 cut(s) 925
BstBI TTCGAA 1 cut(s) 1296
BstC8I GCNNGC 8 cut(s) 597, 2029, 2092, 2582, 3096, 3111, 4230, 4304
BstDSI CCRYGG 1 cut(s) 3675
BstF5I GGATG 9 cut(s) 511, 796, 2182, 2516, 3143, 3528, 3596, 4012, 4151
BstFNI CGCG 3 cut(s) 4130, 4160, 4306
BstKTI GATC 9 cut(s) 246, 294, 1414, 1453, 1618, 1681, 1825, 2593, 3596
BstMAI GTCTC 8 cut(s) 1102, 1767, 2705, 3721, 3908, 4157, 4242, 4305
BstMBI GATC 9 cut(s) 243, 291, 1411, 1450, 1615, 1678, 1822, 2590, 3593
BstMCI CGRYCG 1 cut(s) 4270
BstNI CCWGG 3 cut(s) 3548, 3982, 4243
BstNSI RCATGY 1 cut(s) 3098
BstPAI GACNNNNGTC 1 cut(s) 2232
BstSCI CCNGG 4 cut(s) 3546, 3921, 3980, 4241
BstSFI CTRYAG 3 cut(s) 119, 1115, 3941
BstSLI GKGCMC 2 cut(s) 219, 1526
BstUI CGCG 3 cut(s) 4130, 4160, 4306
BstV1I GCAGC 2 cut(s) 1329, 3291
BstV2I GAAGAC 3 cut(s) 2268, 3765, 3969
BstX2I RGATCY 2 cut(s) 1678, 2590
BstXI CCANNNNNNTGG 1 cut(s) 2125
BstYI RGATCY 2 cut(s) 1678, 2590
Bsu15I ATCGAT 1 cut(s) 4172
Bsu36I CCTNAGG 1 cut(s) 1730
BsuRI GGCC 8 cut(s) 467, 968, 1498, 1702, 2808, 2927, 3109, 3680
BsuTUI ATCGAT 1 cut(s) 4172
BtgI CCRYGG 1 cut(s) 3675
BtrI CACGTC 1 cut(s) 743
BtsCI GGATG 9 cut(s) 511, 796, 2182, 2516, 3143, 3528, 3596, 4012, 4151
BtsI GCAGTG 3 cut(s) 2224, 2430, 3435
BtsIMutI CAGTG 9 cut(s) 24, 1053, 1387, 2224, 2368, 2430, 2701, 3435, 4221
BtuMI TCGCGA 1 cut(s) 4306
Cac8I GCNNGC 8 cut(s) 597, 2029, 2092, 2582, 3096, 3111, 4230, 4304
CaiI CAGNNNCTG 1 cut(s) 2338
CciI TCATGA 2 cut(s) 1618, 2004
Cfr10I RCCGGY 2 cut(s) 968, 2949
Cfr13I GGNCC 5 cut(s) 1700, 2227, 3299, 3310, 3441
ClaI ATCGAT 1 cut(s) 4172
CseI GACGC 1 cut(s) 2907
DpnI GATC 9 cut(s) 245, 293, 1413, 1452, 1617, 1680, 1824, 2592, 3595
DpnII GATC 9 cut(s) 243, 291, 1411, 1450, 1615, 1678, 1822, 2590, 3593
DraI TTTAAA 2 cut(s) 324, 1071
DraIII CACNNNGTG 1 cut(s) 1247
DrdI GACNNNNNNGTC 1 cut(s) 3971
DseDI GACNNNNNNGTC 1 cut(s) 3971
EaeI YGGCCR 4 cut(s) 966, 2925, 3107, 3678
Eco130I CCWWGG 1 cut(s) 3876
Eco147I AGGCCT 1 cut(s) 467
Eco24I GRGCYC 1 cut(s) 778
Eco31I GGTCTC 2 cut(s) 2705, 4157
Eco32I GATATC 5 cut(s) 447, 1390, 1917, 2505, 4038
Eco47I GGWCC 4 cut(s) 2227, 3299, 3310, 3441
Eco57I CTGAAG 5 cut(s) 468, 2280, 2343, 2483, 2921
Eco81I CCTNAGG 1 cut(s) 1730
EcoO109I RGGNCCY 1 cut(s) 3441
EcoRI GAATTC 2 cut(s) 672, 2727
EcoRII CCWGG 3 cut(s) 3546, 3980, 4241
EcoRV GATATC 5 cut(s) 447, 1390, 1917, 2505, 4038
EcoT14I CCWWGG 1 cut(s) 3876
EcoT22I ATGCAT 5 cut(s) 900, 1093, 1333, 3096, 3495
EcoT38I GRGCYC 1 cut(s) 778
ErhI CCWWGG 1 cut(s) 3876
Esp3I CGTCTC 2 cut(s) 1102, 3908
FalI AAGNNNNNCTT 4 cut(s) 1067, 1099, 4102, 4134
FaqI GGGAC 4 cut(s) 840, 2038, 3454, 4268
FauI CCCGC 2 cut(s) 3533, 4123
FbaI TGATCA 2 cut(s) 1615, 1822
FblI GTMKAC 4 cut(s) 301, 353, 1377, 1873
Fnu4HI GCNGC 2 cut(s) 1343, 3280
FokI GGATG 9 cut(s) 518, 803, 2189, 2523, 3150, 3515, 3583, 4019, 4158
FriOI GRGCYC 1 cut(s) 778
Fsp4HI GCNGC 2 cut(s) 1343, 3280
GluI GCNGC 2 cut(s) 1343, 3280
GsaI CCCAGC 1 cut(s) 3875
GsuI CTGGAG 3 cut(s) 735, 1184, 4084
HaeIII GGCC 8 cut(s) 467, 968, 1498, 1702, 2808, 2927, 3109, 3680
HapII CCGG 7 cut(s) 969, 1435, 2950, 3308, 3849, 3923, 4105
HgaI GACGC 1 cut(s) 2907
HincII GTYRAC 2 cut(s) 861, 2061
HindII GTYRAC 2 cut(s) 861, 2061
HindIII AAGCTT 2 cut(s) 326, 3175
HpaI GTTAAC 1 cut(s) 2061
HpaII CCGG 7 cut(s) 969, 1435, 2950, 3308, 3849, 3923, 4105
HphI GGTGA 9 cut(s) 146, 155, 853, 983, 1625, 1911, 2107, 4156, 4297
Hpy188I TCNGA 6 cut(s) 523, 661, 1743, 2502, 3163, 3621
Hpy99I CGWCG 4 cut(s) 747, 2923, 2999, 3642
HpyCH4IV ACGT 5 cut(s) 742, 924, 2379, 3637, 4182
HpySE526I ACGT 5 cut(s) 742, 924, 2379, 3637, 4182
KflI GGGWCCC 1 cut(s) 3441
Kpn2I TCCGGA 2 cut(s) 3848, 4104
Ksp22I TGATCA 2 cut(s) 1615, 1822
KspAI GTTAAC 1 cut(s) 2061
Kzo9I GATC 9 cut(s) 243, 291, 1411, 1450, 1615, 1678, 1822, 2590, 3593
LguI GCTCTTC 2 cut(s) 730, 2638
LmnI GCTCC 7 cut(s) 924, 1255, 1904, 2205, 3851, 4055, 4244
Lsp1109I GCAGC 2 cut(s) 1329, 3291
MaeII ACGT 5 cut(s) 742, 924, 2379, 3637, 4182
MaeIII GTNAC 8 cut(s) 134, 841, 1051, 1172, 2067, 3037, 4080, 4210
MalI GATC 9 cut(s) 245, 293, 1413, 1452, 1617, 1680, 1824, 2592, 3595
MboI GATC 9 cut(s) 243, 291, 1411, 1450, 1615, 1678, 1822, 2590, 3593
MfeI CAATTG 5 cut(s) 18, 1793, 1862, 2538, 3234
MflI RGATCY 2 cut(s) 1678, 2590
MhlI GDGCHC 7 cut(s) 219, 742, 778, 1252, 1526, 4072, 4230
MlsI TGGCCA 3 cut(s) 2927, 3109, 3680
MluNI TGGCCA 3 cut(s) 2927, 3109, 3680
MlyI GAGTC 6 cut(s) 133, 1861, 2010, 2711, 2879, 3773
MmeI TCCRAC 5 cut(s) 16, 1656, 2106, 2227, 3115
Mox20I TGGCCA 3 cut(s) 2927, 3109, 3680
Mph1103I ATGCAT 5 cut(s) 900, 1093, 1333, 3096, 3495
MroI TCCGGA 2 cut(s) 3848, 4104
MroXI GAANNNNTTC 4 cut(s) 672, 2328, 3917, 4114
MscI TGGCCA 3 cut(s) 2927, 3109, 3680
MslI CAYNNNNRTG 2 cut(s) 1479, 3044
Msp20I TGGCCA 3 cut(s) 2927, 3109, 3680
MspA1I CMGCKG 1 cut(s) 4001
MspCI CTTAAG 1 cut(s) 3580
MspI CCGG 7 cut(s) 969, 1435, 2950, 3308, 3849, 3923, 4105
MspR9I CCNGG 4 cut(s) 3548, 3923, 3982, 4243
MunI CAATTG 5 cut(s) 18, 1793, 1862, 2538, 3234
Mva1269I GAATGC 4 cut(s) 1336, 1410, 1583, 2094
MvaI CCWGG 3 cut(s) 3548, 3982, 4243
MvnI CGCG 3 cut(s) 4130, 4160, 4306
NciI CCSGG 1 cut(s) 3923
NdeII GATC 9 cut(s) 243, 291, 1411, 1450, 1615, 1678, 1822, 2590, 3593
NheI GCTAGC 1 cut(s) 2090
NlaIV GGNNCC 8 cut(s) 107, 1727, 2229, 3003, 3442, 3443, 4051, 4240
NmeAIII GCCGAG 3 cut(s) 73, 3391, 4298
NmuCI GTSAC 5 cut(s) 134, 841, 1051, 3037, 4080
NruI TCGCGA 1 cut(s) 4306
NsiI ATGCAT 5 cut(s) 900, 1093, 1333, 3096, 3495
NspI RCATGY 1 cut(s) 3098
NspV TTCGAA 1 cut(s) 1296
OliI CACNNNNGTG 1 cut(s) 3044
PaeI GCATGC 1 cut(s) 3098
PagI TCATGA 2 cut(s) 1618, 2004
PceI AGGCCT 1 cut(s) 467
PciSI GCTCTTC 2 cut(s) 730, 2638
PcsI WCGNNNNNNNCGW 1 cut(s) 930
PctI GAATGC 4 cut(s) 1336, 1410, 1583, 2094
PdmI GAANNNNTTC 4 cut(s) 672, 2328, 3917, 4114
PkrI GCNGC 2 cut(s) 1344, 3281
PleI GAGTC 6 cut(s) 132, 1861, 2009, 2711, 2879, 3772
PpsI GAGTC 6 cut(s) 132, 1861, 2009, 2711, 2879, 3772
Ppu21I YACGTR 1 cut(s) 925
PpuMI RGGWCCY 1 cut(s) 3441
PshAI GACNNNNGTC 1 cut(s) 2232
PsiI TTATAA 1 cut(s) 782
Psp1406I AACGTT 1 cut(s) 4182
Psp5II RGGWCCY 1 cut(s) 3441
Psp6I CCWGG 3 cut(s) 3546, 3980, 4241
PspFI CCCAGC 1 cut(s) 3871
PspGI CCWGG 3 cut(s) 3546, 3980, 4241
PspN4I GGNNCC 8 cut(s) 107, 1727, 2229, 3003, 3442, 3443, 4051, 4240
PspPI GGNCC 5 cut(s) 1700, 2227, 3299, 3310, 3441
PspPPI RGGWCCY 1 cut(s) 3441
PsrI GAACNNNNNNTAC 2 cut(s) 54, 86
PstNI CAGNNNCTG 1 cut(s) 2338
PsuI RGATCY 2 cut(s) 1678, 2590
RruI TCGCGA 1 cut(s) 4306
RseI CAYNNNNRTG 2 cut(s) 1479, 3044
SapI GCTCTTC 2 cut(s) 730, 2638
SatI GCNGC 2 cut(s) 1343, 3280
Sau3AI GATC 9 cut(s) 243, 291, 1411, 1450, 1615, 1678, 1822, 2590, 3593
Sau96I GGNCC 5 cut(s) 1700, 2227, 3299, 3310, 3441
ScaI AGTACT 4 cut(s) 2290, 3409, 3659, 4027
SchI GAGTC 6 cut(s) 133, 1861, 2010, 2711, 2879, 3773
ScrFI CCNGG 4 cut(s) 3548, 3923, 3982, 4243
SduI GDGCHC 7 cut(s) 219, 742, 778, 1252, 1526, 4072, 4230
SfcI CTRYAG 3 cut(s) 119, 1115, 3941
SfuI TTCGAA 1 cut(s) 1296
SinI GGWCC 4 cut(s) 2227, 3299, 3310, 3441
SmiMI CAYNNNNRTG 2 cut(s) 1479, 3044
SmlI CTYRAG 6 cut(s) 110, 1199, 1782, 3268, 3580, 3927
SmoI CTYRAG 6 cut(s) 110, 1199, 1782, 3268, 3580, 3927
SphI GCATGC 1 cut(s) 3098
SseBI AGGCCT 1 cut(s) 467
SsiI CCGC 8 cut(s) 1527, 3526, 3600, 3796, 3938, 3999, 4130, 4220
SspI AATATT 3 cut(s) 409, 855, 2302
StuI AGGCCT 1 cut(s) 467
StyD4I CCNGG 4 cut(s) 3546, 3921, 3980, 4241
StyI CCWWGG 1 cut(s) 3876
TaiI ACGT 5 cut(s) 745, 927, 2382, 3640, 4185
TaqI TCGA 5 cut(s) 1296, 2921, 3390, 3975, 4172
TaqII GACCGA 1 cut(s) 2729
TatI WGTACW 9 cut(s) 51, 2009, 2268, 2288, 2675, 2687, 3407, 3657, 4025
TscAI CASTG 9 cut(s) 31, 1060, 1387, 2224, 2368, 2430, 2701, 3435, 4221
TseFI GTSAC 5 cut(s) 134, 841, 1051, 3037, 4080
TseI GCWGC 2 cut(s) 1342, 3279
Tsp45I GTSAC 5 cut(s) 134, 841, 1051, 3037, 4080
TspGWI ACGGA 5 cut(s) 194, 263, 1242, 1491, 3664
TspRI CASTG 9 cut(s) 31, 1060, 1387, 2224, 2368, 2430, 2701, 3435, 4221
Vha464I CTTAAG 1 cut(s) 3580
VneI GTGCAC 2 cut(s) 215, 1522
VpaK11BI GGWCC 4 cut(s) 2227, 3299, 3310, 3441
XbaI TCTAGA 4 cut(s) 866, 2236, 2593, 2866
XceI RCATGY 1 cut(s) 3098
XcmI CCANNNNNNNNNTGG 1 cut(s) 2144
XmiI GTMKAC 4 cut(s) 301, 353, 1377, 1873
XmnI GAANNNNTTC 4 cut(s) 672, 2328, 3917, 4114
ZrmI AGTACT 4 cut(s) 2290, 3409, 3659, 4027
Zsp2I ATGCAT 5 cut(s) 900, 1093, 1333, 3096, 3495
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.