Rmu_sc0002063.1_g000011

disease resistance

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002063.1
Physical Location & Seq
Forward (+)
35608 .. 41391
5784 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002063.1_g000011.1.cds

Sequence Viewer

Length: 2568 bp
atgggagaggctgttcttggggcattcctcccggtgctgcttgagaagttggcggatcgagaggtcctcgaatacttcggacgccttaagtgggtcgacagaaatgtgctgcggaaatggactgaaacgttgactgcaattaaagcggtgctgcgtgatgcggaggagaagcaacacacacaagaaggagtgaaactatggctagatgatctcagagatttggctttcgatgttcaagacatattggacatatttgatactaaaatgctgaagcgaaggatagaaagacaacaaggaagcacaagtgattcatgcatcagctgcctctctaaacctaaattcaattttagtgtgaactcagaaatcaagaagataagtgatcgactagaagagataactactcgagaaaagaggtttggtctgaaggaacttggagtgtctaccaagccatggaaaatgccacagactacttctcaactagatggacctgtgatcggaagggatgaagcaaaagcaaaaattcttgatgatctgctctcaaatggcgaacatatactctcataccaaaaagctatgggaaaggctgttcttggggcattcctcctggtgctgcttgagaagttggcggatcgagaggtcctcgaatacttcggacgccttaagtgggtcgacagaaatgtgctgcggaaatggactgaaacgttgactgcaattaaagcggtgctgcgtgatgcggaggagaagcaacacacacaagaaggagtgaaactatggctagatgatctcagagatttggcttacgatgttcaagacatattggacacatttgatactgaaatgctgaagcgaaggatagaaagacaacaaggaagcacaagtaattcatggatcagctacctctctaaacctaagttcaattttagtgtgaactcagaaatcaagaagataagtgatcgactagaagagataactactcgagaaaagcattttggaatgaagcaaaagaaaaaattcttgatgatctgctctcaaatggcgaaacatagtaccagcaattttcagaattttcatgtggtttccattgttggtacgggtggaataggaaagacaacactggctaaagatgtattcaacgacagtgcaactgaacaattttgcccaaagggatgggtgtgtgtgtccgatgacttcgaccttctaagggtgacaactgcagttcttgaatctgtcacgtcaggtgatgtgaaggaatccaaagagctcaattcagttcaggagaagctgagtaaggaattggctggcaaaaagtttttaattgttctagatgatgtctggaatacatgcaactacgatcaatggacaacattgcagtccgcctttcgtgttggagcagtaggaagcaagatcattgtgacgacgcgtgatgcgaatgttgcaaagatgatgggagacagtagccctcataacttggagtcgatgtcagaagatgattgttggaaaatctttgtccaccatgcactcttaaacaatacgccccaagatgttgcgttactgaaggagaaaattgtagtaaaatgcaatggattgccgttggctgcaaagactcttggtggtcttttacgttgtaaaacagtagacgaacgggaagaaatattagaccacaagatgtggaatctatccaaccagatgggcgtccttccagcattacagttgagctatcattatctccccacgaatttgaaacggtgcttcacctattgtgcaattcttccaaatgattacgaatttggggagatgcaattgatccttctgtggatggcagagggtttgattccgcaggaagccgaagagaataaacaaatggaagatttgggccgtcactattttcgagagttggtgtctaggtcattatttcaaaaatcaagcaaaggaaactcgcgatacataatgcatgacctcattacagatttggcacgttgggctgcaggaaattcatgttctagattggaggatatgcagaattatgactcatcgcgacgtagattggttcgtcattcgtcttacattcctggtatgtatgatgggattaaaaagtttggggtctattctgaagctatatgcctgcggacattcttaccactatcaccatcagattaccaccttgatcattatctggctcaaaaggttacttctgatttattgcccaaactccaatacttacgactgctctctttgaatggatatcaaatgaccgagctgccaaatgcaattggtaaattgaagcatctacggtatcttgatctttcacacaatcgagaaataagaagtttgccagactcaacaaccactctttacaacttacaaacattgatattggacaactgtcatcgattgaaggcactacccacaagcatgaggaatctagtaaatttgcgtcacctcatgaattcgtatacatatccattggaagaaatgcctcctcagcttggtcgattgactaatctccaaacattgcctaattttgttgttggcaaagctggtagtgttggttacagtagtacacaatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

855

Amino Acids

97.9

Weight (kDa)

8.3

Isoelectric Point (pI)

46.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000070)

Species Orthologous Gene IDs
fragaria_vesca FvH4_7g00360 FvH4_7g00850 FvH4_7g02400 FvH4_7g02430 FvH4_7g02450 FvH4_7g25671 FvH4_7g25680 FvH4_7g25683 FvH4_7g26980 FvH4_7g27330 FvH4_7g27355 FvH4_7g27610 FvH4_7g27642 FvH4_7g27890 FvH4_7g27891 FvH4_7g27891 FvH4_7g27891 FvH4_7g28110 FvH4_7g28390
malus_domestica MD00G1070800.v1.1 MD00G1168000.v1.1 MD00G1168300.v1.1 MD00G1168700.v1.1 MD02G1293100.v1.1 MD02G1293200.v1.1 MD02G1314300.v1.1 MD03G1009000.v1.1 MD03G1009400.v1.1 MD03G1042300.v1.1 MD03G1042400.v1.1 MD07G1033600.v1.1 MD07G1033700.v1.1 MD07G1033900.v1.1 MD11G1011400.v1.1 MD11G1011700.v1.1 MD11G1029800.v1.1 MD11G1029900.v1.1 MD11G1030300.v1.1 MD11G1030400.v1.1 MD11G1030500.v1.1 MD11G1031300.v1.1 MD11G1031600.v1.1 MD11G1032000.v1.1 MD11G1033200.v1.1 MD11G1033600.v1.1 MD11G1033800.v1.1 MD11G1033900.v1.1 MD11G1034100.v1.1 MD11G1034400.v1.1 MD11G1040600.v1.1 MD11G1041100.v1.1 MD11G1043100.v1.1 MD11G1043500.v1.1 MD11G1044500.v1.1 MD11G1045100.v1.1 MD11G1045600.v1.1
prunus_persica Prupe.2G022400_v2.0.a1 Prupe.2G022400_v2.0.a1 Prupe.2G022400_v2.0.a1 Prupe.2G022500_v2.0.a1 Prupe.2G022500_v2.0.a1 Prupe.2G022900_v2.0.a1 Prupe.2G023500_v2.0.a1 Prupe.2G023500_v2.0.a1 Prupe.2G023500_v2.0.a1 Prupe.2G023500_v2.0.a1 Prupe.2G023500_v2.0.a1 Prupe.2G023500_v2.0.a1 Prupe.2G023600_v2.0.a1 Prupe.2G028000_v2.0.a1 Prupe.2G030200_v2.0.a1 Prupe.2G067600_v2.0.a1 Prupe.8G117900_v2.0.a1
pyrus_communis pycom02g26350 pycom03g03270 pycom07g02370 pycom11g00750 pycom11g00790 pycom11g02340 pycom11g02370 pycom11g02380 pycom11g02390 pycom11g02410 pycom11g02460 pycom11g02470 pycom11g02500 pycom11g02510 pycom11g02520 pycom11g02530 pycom11g02580 pycom11g02590 pycom11g02680 pycom11g02710 pycom11g02720 pycom11g02730 pycom11g02750 pycom11g02760 pycom11g02770 pycom11g03690 pycom13g25120 pycom13g25130 pycom13g25140 pycom13g25170 pycom13g25180 pycom13g25190 pycom13g25210
rosa_chinensis RchiOBHm_Chr1g0315001 RchiOBHm_Chr1g0315411 RchiOBHm_Chr1g0317951 RchiOBHm_Chr1g0319741 RchiOBHm_Chr1g0319841 RchiOBHm_Chr1g0319911 RchiOBHm_Chr1g0319991 RchiOBHm_Chr1g0320001 RchiOBHm_Chr1g0320021 RchiOBHm_Chr1g0320081 RchiOBHm_Chr1g0320111 RchiOBHm_Chr1g0320131 RchiOBHm_Chr1g0320161 RchiOBHm_Chr1g0320171 RchiOBHm_Chr1g0320241 RchiOBHm_Chr1g0320281 RchiOBHm_Chr1g0320411 RchiOBHm_Chr1g0320461 RchiOBHm_Chr1g0320551 RchiOBHm_Chr1g0320581 RchiOBHm_Chr1g0320661 RchiOBHm_Chr1g0320891 RchiOBHm_Chr1g0320971 RchiOBHm_Chr1g0321021 RchiOBHm_Chr1g0321031 RchiOBHm_Chr1g0321091 RchiOBHm_Chr1g0321351 RchiOBHm_Chr1g0321481 RchiOBHm_Chr1g0321491 RchiOBHm_Chr1g0327521 RchiOBHm_Chr1g0328061 RchiOBHm_Chr1g0334991 RchiOBHm_Chr1g0373781 RchiOBHm_Chr1g0373891 RchiOBHm_Chr1g0374841 RchiOBHm_Chr2g0131111 RchiOBHm_Chr2g0131121 RchiOBHm_Chr4g0408901 RchiOBHm_Chr5g0041691 RchiOBHm_Chr7g0237021
rosa_laevigata RLG00000019168 RLG00000030456 RLG00000030460 RLG00000030571
rosa_multiflora Rmu_co7963468.1_g000001 Rmu_co7991248.1_g000001 Rmu_co8195256.1_g000001 Rmu_co8312199.1_g000001 Rmu_co8349215.1_g000001 Rmu_co8351041.1_g000001 Rmu_co8422719.1_g000001 Rmu_co8450711.1_g000001 Rmu_co8465555.1_g000001 Rmu_co8489965.1_g000001 Rmu_sc0000087.1_g000014 Rmu_sc0000272.1_g000015 Rmu_sc0000724.1_g000006 Rmu_sc0000724.1_g000021 Rmu_sc0000724.1_g000022 Rmu_sc0000861.1_g000024 Rmu_sc0001049.1_g000006 Rmu_sc0001049.1_g000007 Rmu_sc0001512.1_g000001 Rmu_sc0002022.1_g000004 Rmu_sc0002063.1_g000011 Rmu_sc0002131.1_g000024 Rmu_sc0002337.1_g000012 Rmu_sc0002341.1_g000005 Rmu_sc0002539.1_g000117 Rmu_sc0002745.1_g000005 Rmu_sc0002745.1_g000006 Rmu_sc0003145.1_g000002 Rmu_sc0003199.1_g000007 Rmu_sc0003270.1_g000039 Rmu_sc0003270.1_g000040 Rmu_sc0003423.1_g000001 Rmu_sc0003423.1_g000002 Rmu_sc0003629.1_g000067 Rmu_sc0004039.1_g000002 Rmu_sc0004555.1_g000001 Rmu_sc0004555.1_g000005 Rmu_sc0004555.1_g000006 Rmu_sc0004947.1_g000025 Rmu_sc0004947.1_g000026 Rmu_sc0005255.1_g000025 Rmu_sc0007977.1_g000016 Rmu_sc0008752.1_g000005 Rmu_sc0009236.1_g000004 Rmu_sc0009236.1_g000008 Rmu_sc0009236.1_g000009 Rmu_sc0009236.1_g000010 Rmu_sc0011424.1_g000036 Rmu_sc0013413.1_g000001 Rmu_sc0013735.1_g000002 Rmu_sc0015304.1_g000002 Rmu_sc0015304.1_g000003 Rmu_sc0015585.1_g000001 Rmu_sc0018410.1_g000001 Rmu_sc0022723.1_g000001 Rmu_sc0022723.1_g000002 Rmu_sc0022724.1_g000001 Rmu_sc0023430.1_g000001 Rmu_sc0026053.1_g000001 Rmu_sc0026429.1_g000002 Rmu_sc0026647.1_g000001 Rmu_sc0031359.1_g000001 Rmu_ssc0000042.1_g000040 Rmu_ssc0000081.1_g000001 Rmu_ssc0000300.1_g000011
rosa_roxburghii Rroxscaffold_160G00433620 Rroxscaffold_160G00433990 Rroxscaffold_1G00038820 Rroxscaffold_2G00113190 Rroxscaffold_4G00283240 Rroxscaffold_4G00283930 Rroxscaffold_4G00284010 Rroxscaffold_4G00322600 Rroxscaffold_4G00327710 Rroxscaffold_4G00328100 Rroxscaffold_4G00328130 Rroxscaffold_4G00331590 Rroxscaffold_5G00353280
rosa_rugosa Rorug01G0004200 Rorug01G0018800 Rorug01G0018900 Rorug01G0029900 Rorug01G0030000 Rorug01G0030000 Rorug01G0030000 Rorug01G0030200 Rorug01G0030300 Rorug01G0030800 Rorug01G0032400 Rorug01G0032900 Rorug01G0055800 Rorug01G0067600 Rorug01G0067700 Rorug01G0067800 Rorug01G0067900 Rorug01G0068000 Rorug01G0379500 Rorug01G0379600 Rorug01G0379600 Rorug01G0385200 Rorug01G0385300 Rorug02G0295100 Rorug04G0088500 Rorug04G0088600 Rorug05G0194900 Rorug07G0301400
rosa_samantha Rh1AG014800 Rh1AG015200 Rh1AG030500 Rh1AG041800 Rh1AG042300 Rh1AG042700 Rh1AG042800 Rh1AG042900 Rh1AG045000 Rh1AG085100 Rh1AG085200 Rh1AG388600 Rh1AG396700 Rh1AG396900 Rh1BG007300 Rh1BG039200 Rh1BG039600 Rh1BG042800 Rh1BG067300 Rh1BG109700 Rh1BG109900 Rh1BG354000 Rh1CG043800 Rh1CG044400 Rh1DG008600 Rh1DG022900 Rh1DG023400 Rh1DG023600 Rh1DG023900 Rh1DG024100 Rh1DG024400 Rh1DG024500 Rh1DG025500 Rh1DG025700 Rh1DG026500 Rh1DG026800 Rh1DG038900 Rh1DG048800 Rh1DG049300 Rh1DG051700 Rh1DG052000 Rh1DG146200 Rh1DG383500 Rh2BG354900 Rh2CG333600 Rh4BG149600 Rh4BG149700 Rh4CG160600
rosa_wichuraiana Rw0G001100 Rw0G001130 Rw0G001180 Rw0G012580 Rw1G003480 Rw1G003540 Rw1G003600 Rw1G003640 Rw1G003670 Rw1G003750 Rw1G003940 Rw1G006650 Rw1G034550 Rw1G034560 Rw1G034650 Rw1G034660 Rw1G035170 Rw1G035190 Rw1G037060 Rw2G028210 Rw4G012540 Rw5G026370 Rw7G037900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 450
AccI GTMKAC 5 cut(s) 96, 440, 669, 1635, 2453
AccII CGCG 3 cut(s) 1420, 1939, 2035
AclI AACGTT 2 cut(s) 128, 701
AclWI GGATC 4 cut(s) 63, 636, 896, 1798
AcsI RAATTY 9 cut(s) 338, 519, 1010, 1063, 1735, 1784, 1990, 2428, 2446
AcuI CTGAAG 5 cut(s) 290, 443, 863, 1574, 2130
AcyI GRCGYC 3 cut(s) 82, 655, 1692
AfaI GTAC 3 cut(s) 1048, 1090, 2560
AfiI CCNNNNNNNGG 6 cut(s) 91, 450, 494, 664, 1201, 2486
AflII CTTAAG 2 cut(s) 86, 659
AflIII ACRYGT 1 cut(s) 1418
AjiI CACGTC 1 cut(s) 1233
AjnI CCWGG 2 cut(s) 603, 2068
AjuI GAANNNNNNNTTGG 4 cut(s) 399, 431, 972, 1004
AloI GAACNNNNNNTCC 3 cut(s) 29, 570, 602
Alw21I GWGCWC 1 cut(s) 1263
Alw26I GTCTC 1 cut(s) 1443
AlwI GGATC 4 cut(s) 63, 636, 896, 1798
Ama87I CYCGRG 2 cut(s) 402, 975
AoxI GGCC 1 cut(s) 1873
ApoI RAATTY 9 cut(s) 338, 519, 1010, 1063, 1735, 1784, 1990, 2428, 2446
Asp700I GAANNNNTTC 1 cut(s) 1010
AspS9I GGNCC 4 cut(s) 64, 485, 637, 1873
AsuC2I CCSGG 1 cut(s) 32
AsuHPI GGTGA 5 cut(s) 1216, 1250, 1744, 2136, 2429
AvaI CYCGRG 2 cut(s) 402, 975
AvaII GGWCC 3 cut(s) 64, 485, 637
BanII GRGCYC 1 cut(s) 1263
Bbv12I GWGCWC 1 cut(s) 1263
BbvCI CCTCAGC 1 cut(s) 2481
BccI CCATC 7 cut(s) 476, 1161, 1438, 1681, 1810, 2075, 2155
BceAI ACGGC 2 cut(s) 1573, 1860
BciT130I CCWGG 2 cut(s) 605, 2070
BclI TGATCA 1 cut(s) 2164
BcnI CCSGG 1 cut(s) 32
BcoDI GTCTC 1 cut(s) 1443
BfaI CTAG 9 cut(s) 203, 386, 479, 776, 959, 1322, 1902, 2001, 2423
BfmI CTRYAG 2 cut(s) 1212, 1983
BfrI CTTAAG 2 cut(s) 86, 659
Bme1390I CCNGG 3 cut(s) 32, 605, 2070
Bme18I GGWCC 3 cut(s) 64, 485, 637
BmeT110I CYCGRG 2 cut(s) 402, 975
BmgBI CACGTC 1 cut(s) 1233
BmgT120I GGNCC 4 cut(s) 64, 485, 637, 1873
BmrFI CCNGG 3 cut(s) 32, 605, 2070
BmsI GCATC 6 cut(s) 148, 324, 721, 1414, 1785, 2293
BoxI GACNNNNGTC 1 cut(s) 2382
BplI GAGNNNNNCTC 4 cut(s) 51, 83, 624, 656
Bpu10I CCTNAGC 1 cut(s) 2481
BpuEI CTTGAG 2 cut(s) 62, 635
BpuMI CCSGG 1 cut(s) 32
Bsa29I ATCGAT 1 cut(s) 2389
BsaBI GATNNNNATC 1 cut(s) 2169
BsaHI GRCGYC 3 cut(s) 82, 655, 1692
BsaJI CCNNGG 1 cut(s) 449
BsaXI ACNNNNNCTCC 3 cut(s) 27, 1463, 1493
Bsc4I CCNNNNNNNGG 6 cut(s) 91, 450, 494, 664, 1201, 2486
Bse1I ACTGG 1 cut(s) 1119
Bse3DI GCAATG 3 cut(s) 1364, 1585, 2510
Bse8I GATNNNNATC 1 cut(s) 2169
BseBI CCWGG 2 cut(s) 605, 2070
BseCI ATCGAT 1 cut(s) 2389
BseDI CCNNGG 1 cut(s) 449
BseGI GGATG 3 cut(s) 508, 1172, 1821
BseJI GATNNNNATC 1 cut(s) 2169
BseLI CCNNNNNNNGG 6 cut(s) 91, 450, 494, 664, 1201, 2486
BseMI GCAATG 3 cut(s) 1364, 1585, 2510
BseMII CTCAG 6 cut(s) 226, 372, 799, 945, 1274, 2495
BseNI ACTGG 1 cut(s) 1119
BseRI GAGGAG 3 cut(s) 179, 752, 2469
Bsh1236I CGCG 3 cut(s) 1420, 1939, 2035
BshFI GGCC 1 cut(s) 1875
BshVI ATCGAT 1 cut(s) 2389
BsiHKAI GWGCWC 1 cut(s) 1263
BsiHKCI CYCGRG 2 cut(s) 402, 975
BsiSI CCGG 1 cut(s) 32
BslI CCNNNNNNNGG 6 cut(s) 91, 450, 494, 664, 1201, 2486
BsmAI GTCTC 1 cut(s) 1443
BsmI GAATGC 2 cut(s) 23, 596
BsnI GGCC 1 cut(s) 1875
BsoBI CYCGRG 2 cut(s) 402, 975
Bsp1286I GDGCHC 1 cut(s) 1263
Bsp19I CCATGG 1 cut(s) 449
Bsp68I TCGCGA 2 cut(s) 1939, 2035
BspANI GGCC 1 cut(s) 1875
BspCNI CTCAG 6 cut(s) 225, 371, 798, 944, 1275, 2494
BspDI ATCGAT 1 cut(s) 2389
BspFNI CGCG 3 cut(s) 1420, 1939, 2035
BspHI TCATGA 1 cut(s) 2442
BspMAI CTGCAG 2 cut(s) 1216, 1987
BspPI GGATC 4 cut(s) 63, 636, 896, 1798
BspTI CTTAAG 2 cut(s) 86, 659
BsrDI GCAATG 3 cut(s) 1364, 1585, 2510
BsrI ACTGG 1 cut(s) 1119
BssECI CCNNGG 1 cut(s) 449
BssNAI GTATAC 1 cut(s) 2454
BssNI GRCGYC 3 cut(s) 82, 655, 1692
BssT1I CCWWGG 1 cut(s) 449
Bst1107I GTATAC 1 cut(s) 2454
Bst2UI CCWGG 2 cut(s) 605, 2070
Bst4CI ACNGT 8 cut(s) 1139, 1454, 1633, 1710, 1746, 2292, 2384, 2555
Bst6I CTCTTC 3 cut(s) 384, 957, 1842
BstACI GRCGYC 3 cut(s) 82, 655, 1692
BstAFI CTTAAG 2 cut(s) 86, 659
BstAPI GCANNNNNTGC 1 cut(s) 321
BstC8I GCNNGC 2 cut(s) 1300, 2123
BstDEI CTNAG 8 cut(s) 212, 358, 785, 909, 931, 1199, 1283, 2481
BstDSI CCRYGG 1 cut(s) 449
BstF5I GGATG 3 cut(s) 508, 1172, 1821
BstFNI CGCG 3 cut(s) 1420, 1939, 2035
BstMAI GTCTC 1 cut(s) 1443
BstMWI GCNNNNNNNGC 6 cut(s) 143, 321, 716, 1433, 1979, 2482
BstNI CCWGG 2 cut(s) 605, 2070
BstNSI RCATGY 1 cut(s) 1344
BstPAI GACNNNNGTC 1 cut(s) 2382
BstSCI CCNGG 3 cut(s) 30, 603, 2068
BstSFI CTRYAG 2 cut(s) 1212, 1983
BstUI CGCG 3 cut(s) 1420, 1939, 2035
BstXI CCANNNNNNTGG 2 cut(s) 1167, 1687
BstZ17I GTATAC 1 cut(s) 2454
Bsu15I ATCGAT 1 cut(s) 2389
BsuRI GGCC 1 cut(s) 1875
BsuTUI ATCGAT 1 cut(s) 2389
BtgI CCRYGG 1 cut(s) 449
BtgZI GCGATG 1 cut(s) 2016
BtrI CACGTC 1 cut(s) 1233
BtsCI GGATG 3 cut(s) 508, 1172, 1821
BtsIMutI CAGTG 2 cut(s) 1112, 1144
BtuMI TCGCGA 2 cut(s) 1939, 2035
Cac8I GCNNGC 2 cut(s) 1300, 2123
CciI TCATGA 1 cut(s) 2442
Cfr13I GGNCC 4 cut(s) 64, 485, 637, 1873
ClaI ATCGAT 1 cut(s) 2389
CseI GACGC 5 cut(s) 90, 663, 1426, 1681, 2423
Csp6I GTAC 3 cut(s) 1047, 1089, 2559
CviQI GTAC 3 cut(s) 1047, 1089, 2559
DdeI CTNAG 8 cut(s) 212, 358, 785, 909, 931, 1199, 1283, 2481
Eam1104I CTCTTC 3 cut(s) 384, 957, 1842
EarI CTCTTC 3 cut(s) 384, 957, 1842
EciI GGCGGA 3 cut(s) 68, 641, 1363
Ecl136II GAGCTC 1 cut(s) 1261
Eco130I CCWWGG 1 cut(s) 449
Eco24I GRGCYC 1 cut(s) 1263
Eco32I GATATC 1 cut(s) 2243
Eco47I GGWCC 3 cut(s) 64, 485, 637
Eco53kI GAGCTC 1 cut(s) 1261
Eco57I CTGAAG 5 cut(s) 290, 443, 863, 1574, 2130
Eco88I CYCGRG 2 cut(s) 402, 975
EcoICRI GAGCTC 1 cut(s) 1261
EcoO109I RGGNCCY 2 cut(s) 64, 637
EcoRI GAATTC 1 cut(s) 2446
EcoRII CCWGG 2 cut(s) 603, 2068
EcoRV GATATC 1 cut(s) 2243
EcoT14I CCWWGG 1 cut(s) 449
EcoT22I ATGCAT 2 cut(s) 317, 1953
EcoT38I GRGCYC 1 cut(s) 1263
ErhI CCWWGG 1 cut(s) 449
FbaI TGATCA 1 cut(s) 2164
FblI GTMKAC 5 cut(s) 96, 440, 669, 1635, 2453
FokI GGATG 3 cut(s) 515, 1179, 1828
FriOI GRGCYC 1 cut(s) 1263
FspBI CTAG 9 cut(s) 203, 386, 479, 776, 959, 1322, 1902, 2001, 2423
HaeIII GGCC 1 cut(s) 1875
HapII CCGG 1 cut(s) 32
HgaI GACGC 5 cut(s) 90, 663, 1426, 1681, 2423
Hin1I GRCGYC 3 cut(s) 82, 655, 1692
HincII GTYRAC 4 cut(s) 97, 132, 670, 705
HindII GTYRAC 4 cut(s) 97, 132, 670, 705
HpaII CCGG 1 cut(s) 32
HphI GGTGA 5 cut(s) 1216, 1250, 1744, 2136, 2429
Hpy99I CGWCG 2 cut(s) 1420, 2040
HpyCH4III ACNGT 8 cut(s) 1139, 1454, 1633, 1710, 1746, 2292, 2384, 2555
HpyCH4IV ACGT 6 cut(s) 128, 701, 1232, 1621, 1975, 2038
HpyF10VI GCNNNNNNNGC 6 cut(s) 143, 321, 716, 1433, 1979, 2482
HpyF3I CTNAG 8 cut(s) 212, 358, 785, 909, 931, 1199, 1283, 2481
HpySE526I ACGT 6 cut(s) 128, 701, 1232, 1621, 1975, 2038
Hsp92I GRCGYC 3 cut(s) 82, 655, 1692
Ksp22I TGATCA 1 cut(s) 2164
LmnI GCTCC 1 cut(s) 1388
LweI GCATC 6 cut(s) 148, 324, 721, 1414, 1785, 2293
MaeI CTAG 9 cut(s) 203, 386, 479, 776, 959, 1322, 1902, 2001, 2423
MaeII ACGT 6 cut(s) 128, 701, 1232, 1621, 1975, 2038
MaeIII GTNAC 8 cut(s) 1204, 1228, 1411, 1548, 1877, 2185, 2435, 2549
MfeI CAATTG 2 cut(s) 1799, 2268
MhlI GDGCHC 1 cut(s) 1263
MluI ACGCGT 1 cut(s) 1418
MlyI GAGTC 4 cut(s) 1481, 1597, 2021, 2330
MmeI TCCRAC 3 cut(s) 1366, 1475, 1704
Mph1103I ATGCAT 2 cut(s) 317, 1953
MroXI GAANNNNTTC 1 cut(s) 1010
MseI TTAA 7 cut(s) 87, 141, 660, 714, 1313, 1523, 2088
MslI CAYNNNNRTG 1 cut(s) 2411
MspA1I CMGCKG 1 cut(s) 321
MspCI CTTAAG 2 cut(s) 86, 659
MspI CCGG 1 cut(s) 32
MspR9I CCNGG 3 cut(s) 32, 605, 2070
MunI CAATTG 2 cut(s) 1799, 2268
Mva1269I GAATGC 2 cut(s) 23, 596
MvaI CCWGG 2 cut(s) 605, 2070
MvnI CGCG 3 cut(s) 1420, 1939, 2035
MwoI GCNNNNNNNGC 6 cut(s) 143, 321, 716, 1433, 1979, 2482
NciI CCSGG 1 cut(s) 32
NcoI CCATGG 1 cut(s) 449
NmuCI GTSAC 5 cut(s) 1204, 1228, 1411, 1877, 2435
NruI TCGCGA 2 cut(s) 1939, 2035
NsiI ATGCAT 2 cut(s) 317, 1953
NspI RCATGY 1 cut(s) 1344
PaeR7I CTCGAG 2 cut(s) 402, 975
PagI TCATGA 1 cut(s) 2442
PcsI WCGNNNNNNNCGW 1 cut(s) 1424
PctI GAATGC 2 cut(s) 23, 596
PdmI GAANNNNTTC 1 cut(s) 1010
PfeI GAWTC 6 cut(s) 308, 1223, 1250, 1672, 1831, 2419
PflMI CCANNNNNTGG 1 cut(s) 450
PleI GAGTC 4 cut(s) 1480, 1597, 2021, 2330
PpsI GAGTC 4 cut(s) 1480, 1597, 2021, 2330
PpuMI RGGWCCY 2 cut(s) 64, 637
PshAI GACNNNNGTC 1 cut(s) 2382
Psp124BI GAGCTC 1 cut(s) 1263
Psp1406I AACGTT 2 cut(s) 128, 701
Psp5II RGGWCCY 2 cut(s) 64, 637
Psp6I CCWGG 2 cut(s) 603, 2068
PspGI CCWGG 2 cut(s) 603, 2068
PspPI GGNCC 4 cut(s) 64, 485, 637, 1873
PspPPI RGGWCCY 2 cut(s) 64, 637
PstI CTGCAG 2 cut(s) 1216, 1987
PvuII CAGCTG 1 cut(s) 321
RruI TCGCGA 2 cut(s) 1939, 2035
RsaI GTAC 3 cut(s) 1048, 1090, 2560
RsaNI GTAC 3 cut(s) 1047, 1089, 2559
RseI CAYNNNNRTG 1 cut(s) 2411
SacI GAGCTC 1 cut(s) 1263
SalI GTCGAC 2 cut(s) 95, 668
SaqAI TTAA 7 cut(s) 87, 141, 660, 714, 1313, 1523, 2088
Sau96I GGNCC 4 cut(s) 64, 485, 637, 1873
SchI GAGTC 4 cut(s) 1481, 1597, 2021, 2330
ScrFI CCNGG 3 cut(s) 32, 605, 2070
SduI GDGCHC 1 cut(s) 1263
SfaNI GCATC 6 cut(s) 148, 324, 721, 1414, 1785, 2293
SfcI CTRYAG 2 cut(s) 1212, 1983
Sfr274I CTCGAG 2 cut(s) 402, 975
SinI GGWCC 3 cut(s) 64, 485, 637
SlaI CTCGAG 2 cut(s) 402, 975
SmiMI CAYNNNNRTG 1 cut(s) 2411
SmlI CTYRAG 6 cut(s) 41, 86, 402, 614, 659, 975
SmoI CTYRAG 6 cut(s) 41, 86, 402, 614, 659, 975
SspI AATATT 1 cut(s) 1653
SspMI CTAG 9 cut(s) 203, 386, 479, 776, 959, 1322, 1902, 2001, 2423
SstI GAGCTC 1 cut(s) 1263
StyD4I CCNGG 3 cut(s) 30, 603, 2068
StyI CCWWGG 1 cut(s) 449
TaaI ACNGT 8 cut(s) 1139, 1454, 1633, 1710, 1746, 2292, 2384, 2555
TaiI ACGT 6 cut(s) 131, 704, 1235, 1624, 1978, 2041
TaqII GACCGA 1 cut(s) 2267
TatI WGTACW 1 cut(s) 2558
TfiI GAWTC 6 cut(s) 308, 1223, 1250, 1672, 1831, 2419
Tru1I TTAA 7 cut(s) 87, 141, 660, 714, 1313, 1523, 2088
Tru9I TTAA 7 cut(s) 87, 141, 660, 714, 1313, 1523, 2088
TscAI CASTG 2 cut(s) 1119, 1144
TseFI GTSAC 5 cut(s) 1204, 1228, 1411, 1877, 2435
Tsp45I GTSAC 5 cut(s) 1204, 1228, 1411, 1877, 2435
TspDTI ATGAA 7 cut(s) 300, 519, 873, 1010, 1058, 1983, 2459
TspRI CASTG 2 cut(s) 1119, 1144
Van91I CCANNNNNTGG 1 cut(s) 450
Vha464I CTTAAG 2 cut(s) 86, 659
VpaK11BI GGWCC 3 cut(s) 64, 485, 637
XapI RAATTY 9 cut(s) 338, 519, 1010, 1063, 1735, 1784, 1990, 2428, 2446
XbaI TCTAGA 2 cut(s) 1321, 2000
XceI RCATGY 1 cut(s) 1344
XhoI CTCGAG 2 cut(s) 402, 975
XmiI GTMKAC 5 cut(s) 96, 440, 669, 1635, 2453
XmnI GAANNNNTTC 1 cut(s) 1010
XspI CTAG 9 cut(s) 203, 386, 479, 776, 959, 1322, 1902, 2001, 2423
Zsp2I ATGCAT 2 cut(s) 317, 1953
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.