Rmu_sc0007977.1_g000016

disease resistance

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007977.1
OG0000070
Physical Location & Seq
Forward (+)
75508 .. 79149
3642 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007977.1_g000016.1.cds

Sequence Viewer

Length: 3642 bp
atggcagtgggagagatctttcttgcggcattccttcagttgctgctggacaggttaacgcctggggagatccttggctactttggaagcttgggaggagttggcaaagagctgcagaaatggaggggaacactgtccgcaattgcagcggtgctttccgatgcggaggagaagcagctgacgagcaaggcagtggatctgtggctgaatgacctcaaacacttggcttatgatatcgacgatctactcagcaccttttctaatgagatgttagcacgcaagcagctcaagcttcaccaaactggcacaagcaaggtacgaggcttctttaccaaagttcctcatagagtcaagttcagtttcaatatgaactccgaaatagacgaggttgctaaccgcttgcaagacatacttgaccggaaagagaaactcggtttgaaatatattgagcatacctctacttcagcgaaaaggacaccaggttcgcctgtgttggatggacctgtggttgggagagatgaagacgcaggaaagattgtcgaattgttgtccagagatgctgatccttcttctcccacaaattatcaagttgttgccattgttggtatgggaggactcggcaagacaacgcttgcgggacaagtcttcaatgatgtagctgcaatggaacagtttgatctcaaggtctgggtttcagtgtctgatgacttcaatcttgaaacggtgacgagagctatttctaagaaagtcacatctcggccaggtgatatggatgatttcagtcaacttcaagataatttgagcaaggcgatggatggtaaaaagtttttggttgttttagatgatgtctggagcacatgtgattatgattcatggacaaaactgcaagctccctttcgtaggggagctaagggaagtaaggtaatggtgacaacacgtgatgaaaaagttgcagcattgatgggagccccagccccagtcgctgaagtttattatttaaagactctatcagatgaatgttgtctacaagtatttgagcagcatgttagcaatgacaggccaccaaattttgacttgcttaagaagaaaattgttacgaactgcaatggattgccattggctgcaaaaactcttggtggtgttttacgttgtaacaaaactgacaagtgggaggaaatactggatgacaaattatggagtatatcagatgggagtaatatactcccagtactgagattgagttatcatcatctcccttcaactttgaagaggtgcttttcctattgctcaatacttccaaatgactatgaattcaagaaaacccaattaatccttctgtggatggcagagggtttccttgagcaaccagaagggactaaagcaatggaagatatcggtgacgaatattttggggagctattgtctcggtcattatttcaaatctcgggcaaaaacagtttgtgctatgtaatgcatgaccttgttggtgatttggcacgatgggctgctggagacacattttgcagattggaggataaactgcatggtagatgttctgcaaatactcgtcatctaacttatgtttctggtaagttcgatggggtaaaaagatttgagacattttctgaagcaaaacgcttgcggactttcctaccacttccagtttccagtggttatgagaattatctaactcgttatgctacttctgatttattgccacaattgaagtacttgcgggtgctctccttcaatggctataaactgaccgagctgccagattctgtaggtaagttgagacatctacacaaggaagggctggatacattgcaattggaatggagtggcacaagtgagaaggagtcggaggtgctctgcagtttagaacctcagaaaaagcttgtaaagctcaccatcaagggctacaatggtttcgaattttcaaaatggattggacatccttcattctctgatatgacgcatgtgaagttagagaattgtaaaaattgtcgattcttacctcctcttggccaattaccttttctgaaaaaacttcagatacaaggactggccaatgttaaaagtgtgggtgctgagttttatggagagtgcagcttgccttttccagtgttggaagacctgaggttcaaggatatgcaaaattggaaggagtggcttccttgcaaaacgaatgaagaaattcgagttttcccttgcctgcgactggtttccatctctagatgcccgaaattgaagtgtttgctatccaagagcatggattcattatcaaagctgtatattgatgaatgtgaagagttggtggtttcaattgccaattataaacatatacataagttgaccatcaacggttgtaaaagggtggtgcacagaagaggagttaagtttgagttactggaggttatggggcttcgtgatatttcagagttcagactcgaaatagacgggttcatcagaggattgccaaagcttcaaactttgcggattactggttgtgaagagttgacatgtttatgggagaatgaggatagatggctgcagcgtcggatttctaatattattggaggcaacatatctgactccccctctcactttattcaagagctaagagcactcaagaaacttgtgctaactggatgctcaaatctaatttcttttccagaagctagttggccaccttgtgttgaatatgtaaagatggagtcgtgtaattctttgacatatttcgtagggtatcaagtaccgccaagcataagaacaattgtgatagaaaaatgtcaaaatttgaaactattagtgaaggatgctgacaaaggaggccgacggctcaaatatctttatttaagggactgtgaacgattggagtcaataataaaaactttccacgaggacacttgtcttgaagatcttaggatagagaggtgtgcaaatctcaaatccttaccagaggggctatgccatctctccgctcttcgcattttaattatacgcaaatgtggaagtctcgtttccttcccaagaggagggttgccatccaacctgatagactttcgtatcgacgattgtgatcaattggaagccctccccagaggcatggacaacctcagctctcttcagactttggtgttgagatactgtggaggtttggcatccattctagaagagggcttcccacccaacctaattgatctggaaattggccctctctcagagtgcgggcttcaccacttgggcagactcacctctcttgaaaccttttctatctactgtgaagatccagatctggtgtcctttccgccagaggaggtgctgctccctaaatctctcattaaactcgccattgcaggcttcccaaatctgaagcgcctgtcatcatcttttcaatcactcacctctcttgaatcccttgaaatttggaattgccggaagctggcatctattattccagaaaaagaggatcatctgcctctttcacttacacagcttcgcatctatcgtgactgtccgctgctcacaaagaaataccaaccaggtaaaggacgacactggcccaaagaaatagcccacatcccttacgtttattttggagacttgaaggacgaagccaaagccgaccgcgggatttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
NB-ARC

Protein Analysis

1213

Amino Acids

137.12

Weight (kDa)

7.42

Isoelectric Point (pI)

42.45

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000070)

Species Orthologous Gene IDs
fragaria_vesca FvH4_7g00360 FvH4_7g00850 FvH4_7g02400 FvH4_7g02430 FvH4_7g02450 FvH4_7g25671 FvH4_7g25680 FvH4_7g25683 FvH4_7g26980 FvH4_7g27330 FvH4_7g27355 FvH4_7g27610 FvH4_7g27642 FvH4_7g27890 FvH4_7g27891 FvH4_7g27891 FvH4_7g27891 FvH4_7g28110 FvH4_7g28390
malus_domestica MD00G1070800.v1.1 MD00G1168000.v1.1 MD00G1168300.v1.1 MD00G1168700.v1.1 MD02G1293100.v1.1 MD02G1293200.v1.1 MD02G1314300.v1.1 MD03G1009000.v1.1 MD03G1009400.v1.1 MD03G1042300.v1.1 MD03G1042400.v1.1 MD07G1033600.v1.1 MD07G1033700.v1.1 MD07G1033900.v1.1 MD11G1011400.v1.1 MD11G1011700.v1.1 MD11G1029800.v1.1 MD11G1029900.v1.1 MD11G1030300.v1.1 MD11G1030400.v1.1 MD11G1030500.v1.1 MD11G1031300.v1.1 MD11G1031600.v1.1 MD11G1032000.v1.1 MD11G1033200.v1.1 MD11G1033600.v1.1 MD11G1033800.v1.1 MD11G1033900.v1.1 MD11G1034100.v1.1 MD11G1034400.v1.1 MD11G1040600.v1.1 MD11G1041100.v1.1 MD11G1043100.v1.1 MD11G1043500.v1.1 MD11G1044500.v1.1 MD11G1045100.v1.1 MD11G1045600.v1.1
prunus_persica Prupe.2G022400_v2.0.a1 Prupe.2G022400_v2.0.a1 Prupe.2G022400_v2.0.a1 Prupe.2G022500_v2.0.a1 Prupe.2G022500_v2.0.a1 Prupe.2G022900_v2.0.a1 Prupe.2G023500_v2.0.a1 Prupe.2G023500_v2.0.a1 Prupe.2G023500_v2.0.a1 Prupe.2G023500_v2.0.a1 Prupe.2G023500_v2.0.a1 Prupe.2G023500_v2.0.a1 Prupe.2G023600_v2.0.a1 Prupe.2G028000_v2.0.a1 Prupe.2G030200_v2.0.a1 Prupe.2G067600_v2.0.a1 Prupe.8G117900_v2.0.a1
pyrus_communis pycom02g26350 pycom03g03270 pycom07g02370 pycom11g00750 pycom11g00790 pycom11g02340 pycom11g02370 pycom11g02380 pycom11g02390 pycom11g02410 pycom11g02460 pycom11g02470 pycom11g02500 pycom11g02510 pycom11g02520 pycom11g02530 pycom11g02580 pycom11g02590 pycom11g02680 pycom11g02710 pycom11g02720 pycom11g02730 pycom11g02750 pycom11g02760 pycom11g02770 pycom11g03690 pycom13g25120 pycom13g25130 pycom13g25140 pycom13g25170 pycom13g25180 pycom13g25190 pycom13g25210
rosa_chinensis RchiOBHm_Chr1g0315001 RchiOBHm_Chr1g0315411 RchiOBHm_Chr1g0317951 RchiOBHm_Chr1g0319741 RchiOBHm_Chr1g0319841 RchiOBHm_Chr1g0319911 RchiOBHm_Chr1g0319991 RchiOBHm_Chr1g0320001 RchiOBHm_Chr1g0320021 RchiOBHm_Chr1g0320081 RchiOBHm_Chr1g0320111 RchiOBHm_Chr1g0320131 RchiOBHm_Chr1g0320161 RchiOBHm_Chr1g0320171 RchiOBHm_Chr1g0320241 RchiOBHm_Chr1g0320281 RchiOBHm_Chr1g0320411 RchiOBHm_Chr1g0320461 RchiOBHm_Chr1g0320551 RchiOBHm_Chr1g0320581 RchiOBHm_Chr1g0320661 RchiOBHm_Chr1g0320891 RchiOBHm_Chr1g0320971 RchiOBHm_Chr1g0321021 RchiOBHm_Chr1g0321031 RchiOBHm_Chr1g0321091 RchiOBHm_Chr1g0321351 RchiOBHm_Chr1g0321481 RchiOBHm_Chr1g0321491 RchiOBHm_Chr1g0327521 RchiOBHm_Chr1g0328061 RchiOBHm_Chr1g0334991 RchiOBHm_Chr1g0373781 RchiOBHm_Chr1g0373891 RchiOBHm_Chr1g0374841 RchiOBHm_Chr2g0131111 RchiOBHm_Chr2g0131121 RchiOBHm_Chr4g0408901 RchiOBHm_Chr5g0041691 RchiOBHm_Chr7g0237021
rosa_laevigata RLG00000019168 RLG00000030456 RLG00000030460 RLG00000030571
rosa_multiflora Rmu_co7963468.1_g000001 Rmu_co7991248.1_g000001 Rmu_co8195256.1_g000001 Rmu_co8312199.1_g000001 Rmu_co8349215.1_g000001 Rmu_co8351041.1_g000001 Rmu_co8422719.1_g000001 Rmu_co8450711.1_g000001 Rmu_co8465555.1_g000001 Rmu_co8489965.1_g000001 Rmu_sc0000087.1_g000014 Rmu_sc0000272.1_g000015 Rmu_sc0000724.1_g000006 Rmu_sc0000724.1_g000021 Rmu_sc0000724.1_g000022 Rmu_sc0000861.1_g000024 Rmu_sc0001049.1_g000006 Rmu_sc0001049.1_g000007 Rmu_sc0001512.1_g000001 Rmu_sc0002022.1_g000004 Rmu_sc0002063.1_g000011 Rmu_sc0002131.1_g000024 Rmu_sc0002337.1_g000012 Rmu_sc0002341.1_g000005 Rmu_sc0002539.1_g000117 Rmu_sc0002745.1_g000005 Rmu_sc0002745.1_g000006 Rmu_sc0003145.1_g000002 Rmu_sc0003199.1_g000007 Rmu_sc0003270.1_g000039 Rmu_sc0003270.1_g000040 Rmu_sc0003423.1_g000001 Rmu_sc0003423.1_g000002 Rmu_sc0003629.1_g000067 Rmu_sc0004039.1_g000002 Rmu_sc0004555.1_g000001 Rmu_sc0004555.1_g000005 Rmu_sc0004555.1_g000006 Rmu_sc0004947.1_g000025 Rmu_sc0004947.1_g000026 Rmu_sc0005255.1_g000025 Rmu_sc0007977.1_g000016 Rmu_sc0008752.1_g000005 Rmu_sc0009236.1_g000004 Rmu_sc0009236.1_g000008 Rmu_sc0009236.1_g000009 Rmu_sc0009236.1_g000010 Rmu_sc0011424.1_g000036 Rmu_sc0013413.1_g000001 Rmu_sc0013735.1_g000002 Rmu_sc0015304.1_g000002 Rmu_sc0015304.1_g000003 Rmu_sc0015585.1_g000001 Rmu_sc0018410.1_g000001 Rmu_sc0022723.1_g000001 Rmu_sc0022723.1_g000002 Rmu_sc0022724.1_g000001 Rmu_sc0023430.1_g000001 Rmu_sc0026053.1_g000001 Rmu_sc0026429.1_g000002 Rmu_sc0026647.1_g000001 Rmu_sc0031359.1_g000001 Rmu_ssc0000042.1_g000040 Rmu_ssc0000081.1_g000001 Rmu_ssc0000300.1_g000011
rosa_roxburghii Rroxscaffold_160G00433620 Rroxscaffold_160G00433990 Rroxscaffold_1G00038820 Rroxscaffold_2G00113190 Rroxscaffold_4G00283240 Rroxscaffold_4G00283930 Rroxscaffold_4G00284010 Rroxscaffold_4G00322600 Rroxscaffold_4G00327710 Rroxscaffold_4G00328100 Rroxscaffold_4G00328130 Rroxscaffold_4G00331590 Rroxscaffold_5G00353280
rosa_rugosa Rorug01G0004200 Rorug01G0018800 Rorug01G0018900 Rorug01G0029900 Rorug01G0030000 Rorug01G0030000 Rorug01G0030000 Rorug01G0030200 Rorug01G0030300 Rorug01G0030800 Rorug01G0032400 Rorug01G0032900 Rorug01G0055800 Rorug01G0067600 Rorug01G0067700 Rorug01G0067800 Rorug01G0067900 Rorug01G0068000 Rorug01G0379500 Rorug01G0379600 Rorug01G0379600 Rorug01G0385200 Rorug01G0385300 Rorug02G0295100 Rorug04G0088500 Rorug04G0088600 Rorug05G0194900 Rorug07G0301400
rosa_samantha Rh1AG014800 Rh1AG015200 Rh1AG030500 Rh1AG041800 Rh1AG042300 Rh1AG042700 Rh1AG042800 Rh1AG042900 Rh1AG045000 Rh1AG085100 Rh1AG085200 Rh1AG388600 Rh1AG396700 Rh1AG396900 Rh1BG007300 Rh1BG039200 Rh1BG039600 Rh1BG042800 Rh1BG067300 Rh1BG109700 Rh1BG109900 Rh1BG354000 Rh1CG043800 Rh1CG044400 Rh1DG008600 Rh1DG022900 Rh1DG023400 Rh1DG023600 Rh1DG023900 Rh1DG024100 Rh1DG024400 Rh1DG024500 Rh1DG025500 Rh1DG025700 Rh1DG026500 Rh1DG026800 Rh1DG038900 Rh1DG048800 Rh1DG049300 Rh1DG051700 Rh1DG052000 Rh1DG146200 Rh1DG383500 Rh2BG354900 Rh2CG333600 Rh4BG149600 Rh4BG149700 Rh4CG160600
rosa_wichuraiana Rw0G001100 Rw0G001130 Rw0G001180 Rw0G012580 Rw1G003480 Rw1G003540 Rw1G003600 Rw1G003640 Rw1G003670 Rw1G003750 Rw1G003940 Rw1G006650 Rw1G034550 Rw1G034560 Rw1G034650 Rw1G034660 Rw1G035170 Rw1G035190 Rw1G037060 Rw2G028210 Rw4G012540 Rw5G026370 Rw7G037900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 2337
AccBSI CCGCTC 1 cut(s) 2984
AccI GTMKAC 1 cut(s) 1024
AccII CGCG 1 cut(s) 3633
AclWI GGATC 5 cut(s) 64, 204, 557, 3284, 3480
AcoI YGGCCR 4 cut(s) 758, 2026, 2067, 2687
AcsI RAATTY 6 cut(s) 1066, 1310, 1934, 2196, 2797, 3426
AcuI CTGAAG 7 cut(s) 20, 447, 1005, 1647, 2036, 3113, 3395
AcvI CACGTG 1 cut(s) 938
AdeI CACNNNGTG 1 cut(s) 2696
AfaI GTAC 4 cut(s) 318, 1230, 1730, 2757
AfiI CCNNNNNNNGG 8 cut(s) 509, 900, 2024, 2221, 3038, 3445, 3551, 3633
AflII CTTAAG 1 cut(s) 1079
AflIII ACRYGT 3 cut(s) 857, 935, 2522
AjnI CCWGG 4 cut(s) 61, 478, 760, 3544
AjuI GAANNNNNNNTTGG 4 cut(s) 1317, 1349, 2022, 2054
AloI GAACNNNNNNTCC 2 cut(s) 466, 498
Alw21I GWGCWC 5 cut(s) 857, 1743, 1872, 2385, 2629
Alw26I GTCTC 6 cut(s) 1428, 1506, 1610, 1789, 3023, 3597
Alw44I GTGCAC 1 cut(s) 2381
AlwI GGATC 5 cut(s) 64, 204, 557, 3284, 3480
AlwNI CAGNNNCTG 4 cut(s) 43, 701, 983, 1781
Ama87I CYCGRG 1 cut(s) 1444
AoxI GGCC 8 cut(s) 758, 1058, 2026, 2067, 2687, 2833, 3214, 3563
ApaLI GTGCAC 1 cut(s) 2381
ApoI RAATTY 6 cut(s) 1066, 1310, 1934, 2196, 2797, 3426
ArsI GACNNNNNNTTYG 4 cut(s) 466, 498, 1391, 1423
AseI ATTAAT 1 cut(s) 1328
Asp700I GAANNNNTTC 1 cut(s) 2196
AspLEI GCGC 1 cut(s) 3381
AspS9I GGNCC 3 cut(s) 500, 3215, 3564
AsuII TTCGAA 1 cut(s) 1932
AvaI CYCGRG 1 cut(s) 1444
AvaII GGWCC 1 cut(s) 500
AxyI CCTNAGG 1 cut(s) 2138
BaeGI GKGCMC 1 cut(s) 2385
BaeI ACNNNNGTAYC 2 cut(s) 3052, 3085
BalI TGGCCA 3 cut(s) 2028, 2069, 2689
BanII GRGCYC 1 cut(s) 970
BauI CACGAG 1 cut(s) 2900
BbrPI CACGTG 1 cut(s) 938
BbsI GAAGAC 3 cut(s) 528, 637, 2139
Bbv12I GWGCWC 5 cut(s) 857, 1743, 1872, 2385, 2629
BbvCI CCTCAGC 1 cut(s) 3119
BceAI ACGGC 1 cut(s) 2855
BciT130I CCWGG 4 cut(s) 63, 480, 762, 3546
BciVI GTATCC 1 cut(s) 1813
BclI TGATCA 1 cut(s) 3082
BcoDI GTCTC 6 cut(s) 1428, 1506, 1610, 1789, 3023, 3597
BfaI CTAG 3 cut(s) 2235, 2682, 3173
BfmI CTRYAG 4 cut(s) 113, 1782, 1873, 2552
BfoI RGCGCY 1 cut(s) 3382
BfrI CTTAAG 1 cut(s) 1079
BfuI GTATCC 1 cut(s) 1813
BglII AGATCT 3 cut(s) 15, 2920, 3295
BmcAI AGTACT 2 cut(s) 1230, 1730
Bme1390I CCNGG 4 cut(s) 63, 480, 762, 3546
Bme18I GGWCC 1 cut(s) 500
BmeT110I CYCGRG 1 cut(s) 1444
BmgT120I GGNCC 3 cut(s) 500, 3215, 3564
BmiI GGNNCC 1 cut(s) 967
BmrFI CCNGG 4 cut(s) 63, 480, 762, 3546
BmrI ACTGGG 2 cut(s) 971, 1220
BmsI GCATC 8 cut(s) 151, 547, 2228, 2642, 2809, 3173, 3458, 3513
BmuI ACTGGG 2 cut(s) 971, 1220
BoxI GACNNNNGTC 1 cut(s) 2910
BpiI GAAGAC 3 cut(s) 528, 637, 2139
BplI GAGNNNNNCTC 2 cut(s) 440, 472
BpmI CTGGAG 3 cut(s) 871, 1530, 2432
Bpu10I CCTNAGC 2 cut(s) 909, 3119
Bpu14I TTCGAA 1 cut(s) 1932
BpuEI CTTGAG 4 cut(s) 272, 665, 1379, 2615
BsaAI YACGTR 1 cut(s) 938
BsaBI GATNNNNATC 3 cut(s) 561, 3081, 3294
BsaJI CCNNGG 3 cut(s) 62, 73, 3631
BsaWI WCCGGW 1 cut(s) 417
BsaXI ACNNNNNCTCC 4 cut(s) 844, 874, 1406, 1436
Bsc4I CCNNNNNNNGG 8 cut(s) 509, 900, 2024, 2221, 3038, 3445, 3551, 3633
Bse21I CCTNAGG 1 cut(s) 2138
Bse3DI GCAATG 6 cut(s) 669, 1057, 1111, 1389, 1823, 3354
Bse8I GATNNNNATC 3 cut(s) 561, 3081, 3294
BseBI CCWGG 4 cut(s) 63, 480, 762, 3546
BseDI CCNNGG 3 cut(s) 62, 73, 3631
BseJI GATNNNNATC 3 cut(s) 561, 3081, 3294
BseLI CCNNNNNNNGG 8 cut(s) 509, 900, 2024, 2221, 3038, 3445, 3551, 3633
BseMI GCAATG 6 cut(s) 669, 1057, 1111, 1389, 1823, 3354
BseMII CTCAG 7 cut(s) 262, 1223, 1901, 2082, 2129, 3133, 3237
BseRI GAGGAG 6 cut(s) 111, 182, 2010, 2406, 3051, 3332
BseSI GKGCMC 1 cut(s) 2385
BseYI CCCAGC 1 cut(s) 970
BsgI GTGCAG 1 cut(s) 2128
Bsh1236I CGCG 1 cut(s) 3633
Bsh1285I CGRYCG 1 cut(s) 3631
BshFI GGCC 8 cut(s) 760, 1060, 2028, 2069, 2689, 2835, 3216, 3565
BsiEI CGRYCG 1 cut(s) 3631
BsiHKAI GWGCWC 5 cut(s) 857, 1743, 1872, 2385, 2629
BsiHKCI CYCGRG 1 cut(s) 1444
BsiSI CCGG 2 cut(s) 418, 3439
BslFI GGGAC 3 cut(s) 651, 1387, 2876
BslI CCNNNNNNNGG 8 cut(s) 509, 900, 2024, 2221, 3038, 3445, 3551, 3633
BsmAI GTCTC 6 cut(s) 1428, 1506, 1610, 1789, 3023, 3597
BsmFI GGGAC 3 cut(s) 651, 1387, 2876
BsmI GAATGC 1 cut(s) 29
BsnI GGCC 8 cut(s) 760, 1060, 2028, 2069, 2689, 2835, 3216, 3565
BsoBI CYCGRG 1 cut(s) 1444
Bsp119I TTCGAA 1 cut(s) 1932
Bsp1286I GDGCHC 6 cut(s) 857, 970, 1743, 1872, 2385, 2629
BspANI GGCC 8 cut(s) 760, 1060, 2028, 2069, 2689, 2835, 3216, 3565
BspCNI CTCAG 7 cut(s) 261, 1224, 1900, 2083, 2130, 3132, 3236
BspFNI CGCG 1 cut(s) 3633
BspLI GGNNCC 1 cut(s) 967
BspMAI CTGCAG 3 cut(s) 117, 1877, 2556
BspPI GGATC 5 cut(s) 64, 204, 557, 3284, 3480
BspQI GCTCTTC 1 cut(s) 2991
BspT104I TTCGAA 1 cut(s) 1932
BspTI CTTAAG 1 cut(s) 1079
BsrBI CCGCTC 1 cut(s) 2984
BsrDI GCAATG 6 cut(s) 669, 1057, 1111, 1389, 1823, 3354
BssECI CCNNGG 3 cut(s) 62, 73, 3631
BssSI CACGAG 1 cut(s) 2900
BssT1I CCWWGG 1 cut(s) 73
Bst2BI CACGAG 1 cut(s) 2900
Bst2UI CCWGG 4 cut(s) 63, 480, 762, 3546
Bst4CI ACNGT 9 cut(s) 135, 672, 724, 1457, 2366, 2867, 3152, 3284, 3518
Bst6I CTCTTC 7 cut(s) 1262, 2304, 2383, 2508, 2991, 3132, 3171
BstAFI CTTAAG 1 cut(s) 1079
BstBAI YACGTR 1 cut(s) 938
BstBI TTCGAA 1 cut(s) 1932
BstDSI CCRYGG 1 cut(s) 3631
BstENI CCTNNNNNAGG 1 cut(s) 898
BstFNI CGCG 1 cut(s) 3633
BstH2I RGCGCY 1 cut(s) 3382
BstHHI GCGC 1 cut(s) 3381
BstMAI GTCTC 6 cut(s) 1428, 1506, 1610, 1789, 3023, 3597
BstMCI CGRYCG 1 cut(s) 3631
BstMWI GCNNNNNNNGC 5 cut(s) 146, 289, 980, 1502, 1903
BstNI CCWGG 4 cut(s) 63, 480, 762, 3546
BstNSI RCATGY 4 cut(s) 861, 1046, 1982, 2526
BstPAI GACNNNNGTC 1 cut(s) 2910
BstSCI CCNGG 4 cut(s) 61, 478, 760, 3544
BstSFI CTRYAG 4 cut(s) 113, 1782, 1873, 2552
BstSLI GKGCMC 1 cut(s) 2385
BstUI CGCG 1 cut(s) 3633
BstV2I GAAGAC 3 cut(s) 528, 637, 2139
BstX2I RGATCY 6 cut(s) 15, 69, 196, 2920, 3289, 3295
BstXI CCANNNNNNTGG 2 cut(s) 2272, 3109
BstYI RGATCY 6 cut(s) 15, 69, 196, 2920, 3289, 3295
Bsu36I CCTNAGG 1 cut(s) 2138
BsuI GTATCC 1 cut(s) 1813
BsuRI GGCC 8 cut(s) 760, 1060, 2028, 2069, 2689, 2835, 3216, 3565
BtgI CCRYGG 1 cut(s) 3631
BtgZI GCGATG 1 cut(s) 824
BtsI GCAGTG 2 cut(s) 12, 198
BtsIMutI CAGTG 7 cut(s) 12, 131, 198, 702, 1675, 2130, 3559
CaiI CAGNNNCTG 4 cut(s) 43, 701, 983, 1781
CfoI GCGC 1 cut(s) 3381
Cfr13I GGNCC 3 cut(s) 500, 3215, 3564
Cfr42I CCGCGG 1 cut(s) 3634
CseI GACGC 3 cut(s) 533, 1984, 2546
CsiI ACCWGGT 2 cut(s) 478, 3544
Csp6I GTAC 4 cut(s) 317, 1229, 1729, 2756
CviAII CATG 9 cut(s) 858, 873, 1043, 1475, 1544, 1979, 2272, 2523, 3109
CviQI GTAC 4 cut(s) 317, 1229, 1729, 2756
DraI TTTAAA 1 cut(s) 999
DraIII CACNNNGTG 1 cut(s) 2696
EaeI YGGCCR 4 cut(s) 758, 2026, 2067, 2687
Eam1104I CTCTTC 7 cut(s) 1262, 2304, 2383, 2508, 2991, 3132, 3171
EarI CTCTTC 7 cut(s) 1262, 2304, 2383, 2508, 2991, 3132, 3171
EciI GGCGGA 1 cut(s) 3300
Eco130I CCWWGG 1 cut(s) 73
Eco24I GRGCYC 1 cut(s) 970
Eco32I GATATC 2 cut(s) 235, 1393
Eco47I GGWCC 1 cut(s) 500
Eco57I CTGAAG 7 cut(s) 20, 447, 1005, 1647, 2036, 3113, 3395
Eco72I CACGTG 1 cut(s) 938
Eco81I CCTNAGG 1 cut(s) 2138
Eco88I CYCGRG 1 cut(s) 1444
EcoNI CCTNNNNNAGG 1 cut(s) 898
EcoRI GAATTC 1 cut(s) 1310
EcoRII CCWGG 4 cut(s) 61, 478, 760, 3544
EcoRV GATATC 2 cut(s) 235, 1393
EcoT14I CCWWGG 1 cut(s) 73
EcoT22I ATGCAT 1 cut(s) 1476
EcoT38I GRGCYC 1 cut(s) 970
ErhI CCWWGG 1 cut(s) 73
FaeI CATG 9 cut(s) 861, 876, 1046, 1478, 1547, 1982, 2275, 2526, 3112
FalI AAGNNNNNCTT 4 cut(s) 396, 428, 1259, 1291
FaqI GGGAC 3 cut(s) 651, 1387, 2876
FatI CATG 9 cut(s) 857, 872, 1042, 1474, 1543, 1978, 2271, 2522, 3108
FauI CCCGC 4 cut(s) 628, 1728, 3224, 3626
FbaI TGATCA 1 cut(s) 3082
FblI GTMKAC 1 cut(s) 1024
FriOI GRGCYC 1 cut(s) 970
FspBI CTAG 3 cut(s) 2235, 2682, 3173
GlaI GCGC 1 cut(s) 3380
GsaI CCCAGC 1 cut(s) 974
GsuI CTGGAG 3 cut(s) 871, 1530, 2432
HaeII RGCGCY 1 cut(s) 3382
HaeIII GGCC 8 cut(s) 760, 1060, 2028, 2069, 2689, 2835, 3216, 3565
HapII CCGG 2 cut(s) 418, 3439
HgaI GACGC 3 cut(s) 533, 1984, 2546
HhaI GCGC 1 cut(s) 3381
Hin1II CATG 9 cut(s) 861, 876, 1046, 1478, 1547, 1982, 2275, 2526, 3112
Hin6I GCGC 1 cut(s) 3379
HinP1I GCGC 1 cut(s) 3379
HincII GTYRAC 4 cut(s) 57, 785, 2355, 2520
HindII GTYRAC 4 cut(s) 57, 785, 2355, 2520
HindIII AAGCTT 4 cut(s) 88, 290, 1895, 2483
HpaI GTTAAC 1 cut(s) 57
HpaII CCGG 2 cut(s) 418, 3439
Hpy166II GTNNAC 7 cut(s) 57, 785, 1025, 2355, 2383, 2520, 2870
Hpy8I GTNNAC 7 cut(s) 57, 785, 1025, 2355, 2383, 2520, 2870
Hpy99I CGWCG 4 cut(s) 242, 2562, 2841, 3077
HpyCH4III ACNGT 9 cut(s) 135, 672, 724, 1457, 2366, 2867, 3152, 3284, 3518
HpyCH4IV ACGT 3 cut(s) 937, 1147, 3591
HpyF10VI GCNNNNNNNGC 5 cut(s) 146, 289, 980, 1502, 1903
HpySE526I ACGT 3 cut(s) 937, 1147, 3591
Hsp92II CATG 9 cut(s) 861, 876, 1046, 1478, 1547, 1982, 2275, 2526, 3112
HspAI GCGC 1 cut(s) 3379
Ksp22I TGATCA 1 cut(s) 3082
KspAI GTTAAC 1 cut(s) 57
KspI CCGCGG 1 cut(s) 3634
LguI GCTCTTC 1 cut(s) 2991
LmnI GCTCC 6 cut(s) 852, 895, 905, 965, 1414, 3333
LweI GCATC 8 cut(s) 151, 547, 2228, 2642, 2809, 3173, 3458, 3513
MabI ACCWGGT 2 cut(s) 478, 3544
MaeI CTAG 3 cut(s) 2235, 2682, 3173
MaeII ACGT 3 cut(s) 937, 1147, 3591
MaeIII GTNAC 8 cut(s) 724, 748, 928, 1093, 1151, 1397, 2406, 3512
MbiI CCGCTC 1 cut(s) 2984
MfeI CAATTG 6 cut(s) 141, 1721, 1829, 2325, 2775, 3086
MflI RGATCY 6 cut(s) 15, 69, 196, 2920, 3289, 3295
MhlI GDGCHC 6 cut(s) 857, 970, 1743, 1872, 2385, 2629
MlsI TGGCCA 3 cut(s) 2028, 2069, 2689
MluNI TGGCCA 3 cut(s) 2028, 2069, 2689
MlyI GAGTC 9 cut(s) 357, 609, 997, 1868, 2442, 2588, 2726, 2888, 3246
MmeI TCCRAC 5 cut(s) 474, 1842, 2109, 2540, 3075
Mox20I TGGCCA 3 cut(s) 2028, 2069, 2689
Mph1103I ATGCAT 1 cut(s) 1476
MroXI GAANNNNTTC 1 cut(s) 2196
MscI TGGCCA 3 cut(s) 2028, 2069, 2689
MseI TTAA 9 cut(s) 56, 998, 1080, 1328, 2076, 2397, 2858, 2996, 3345
MslI CAYNNNNRTG 1 cut(s) 2527
Msp20I TGGCCA 3 cut(s) 2028, 2069, 2689
MspA1I CMGCKG 4 cut(s) 149, 178, 3523, 3633
MspCI CTTAAG 1 cut(s) 1079
MspI CCGG 2 cut(s) 418, 3439
MspR9I CCNGG 4 cut(s) 63, 480, 762, 3546
MunI CAATTG 6 cut(s) 141, 1721, 1829, 2325, 2775, 3086
Mva1269I GAATGC 1 cut(s) 29
MvaI CCWGG 4 cut(s) 63, 480, 762, 3546
MvnI CGCG 1 cut(s) 3633
MwoI GCNNNNNNNGC 5 cut(s) 146, 289, 980, 1502, 1903
NlaIII CATG 9 cut(s) 861, 876, 1046, 1478, 1547, 1982, 2275, 2526, 3112
NlaIV GGNNCC 1 cut(s) 967
NmeAIII GCCGAG 2 cut(s) 597, 736
NmuCI GTSAC 5 cut(s) 724, 748, 928, 1397, 3512
NsiI ATGCAT 1 cut(s) 1476
NspI RCATGY 4 cut(s) 861, 1046, 1982, 2526
NspV TTCGAA 1 cut(s) 1932
PciI ACATGT 2 cut(s) 857, 2522
PciSI GCTCTTC 1 cut(s) 2991
PcsI WCGNNNNNNNCGW 1 cut(s) 3508
PctI GAATGC 1 cut(s) 29
PdmI GAANNNNTTC 1 cut(s) 2196
PfeI GAWTC 5 cut(s) 869, 1778, 2010, 2276, 3416
PleI GAGTC 9 cut(s) 356, 609, 997, 1867, 2442, 2588, 2725, 2887, 3246
PmaCI CACGTG 1 cut(s) 938
PmlI CACGTG 1 cut(s) 938
PpsI GAGTC 9 cut(s) 356, 609, 997, 1867, 2442, 2588, 2725, 2887, 3246
Ppu21I YACGTR 1 cut(s) 938
PscI ACATGT 2 cut(s) 857, 2522
PshAI GACNNNNGTC 1 cut(s) 2910
PshBI ATTAAT 1 cut(s) 1328
PsiI TTATAA 1 cut(s) 2337
Psp6I CCWGG 4 cut(s) 61, 478, 760, 3544
PspCI CACGTG 1 cut(s) 938
PspFI CCCAGC 1 cut(s) 970
PspGI CCWGG 4 cut(s) 61, 478, 760, 3544
PspN4I GGNNCC 1 cut(s) 967
PspPI GGNCC 3 cut(s) 500, 3215, 3564
PstI CTGCAG 3 cut(s) 117, 1877, 2556
PstNI CAGNNNCTG 4 cut(s) 43, 701, 983, 1781
PsuI RGATCY 6 cut(s) 15, 69, 196, 2920, 3289, 3295
PvuII CAGCTG 1 cut(s) 178
RsaI GTAC 4 cut(s) 318, 1230, 1730, 2757
RsaNI GTAC 4 cut(s) 317, 1229, 1729, 2756
RseI CAYNNNNRTG 1 cut(s) 2527
SacII CCGCGG 1 cut(s) 3634
SapI GCTCTTC 1 cut(s) 2991
SaqAI TTAA 9 cut(s) 56, 998, 1080, 1328, 2076, 2397, 2858, 2996, 3345
Sau96I GGNCC 3 cut(s) 500, 3215, 3564
ScaI AGTACT 2 cut(s) 1230, 1730
SchI GAGTC 9 cut(s) 357, 609, 997, 1868, 2442, 2588, 2726, 2888, 3246
ScrFI CCNGG 4 cut(s) 63, 480, 762, 3546
SduI GDGCHC 6 cut(s) 857, 970, 1743, 1872, 2385, 2629
SexAI ACCWGGT 2 cut(s) 478, 3544
SfaNI GCATC 8 cut(s) 151, 547, 2228, 2642, 2809, 3173, 3458, 3513
SfcI CTRYAG 4 cut(s) 113, 1782, 1873, 2552
Sfr303I CCGCGG 1 cut(s) 3634
SfuI TTCGAA 1 cut(s) 1932
SgrBI CCGCGG 1 cut(s) 3634
SinI GGWCC 1 cut(s) 500
SmiMI CAYNNNNRTG 1 cut(s) 2527
SmlI CTYRAG 5 cut(s) 287, 680, 1079, 1358, 2630
SmoI CTYRAG 5 cut(s) 287, 680, 1079, 1358, 2630
SspI AATATT 2 cut(s) 1406, 2572
SspMI CTAG 3 cut(s) 2235, 2682, 3173
StyD4I CCNGG 4 cut(s) 61, 478, 760, 3544
StyI CCWWGG 1 cut(s) 73
TaaI ACNGT 9 cut(s) 135, 672, 724, 1457, 2366, 2867, 3152, 3284, 3518
TaiI ACGT 3 cut(s) 940, 1150, 3594
TaqI TCGA 8 cut(s) 237, 540, 1596, 1932, 2008, 2200, 2451, 3072
TaqII GACCGA 2 cut(s) 1416, 1781
TatI WGTACW 2 cut(s) 1228, 1728
TauI GCSGC 1 cut(s) 29
TfiI GAWTC 5 cut(s) 869, 1778, 2010, 2276, 3416
Tru1I TTAA 9 cut(s) 56, 998, 1080, 1328, 2076, 2397, 2858, 2996, 3345
Tru9I TTAA 9 cut(s) 56, 998, 1080, 1328, 2076, 2397, 2858, 2996, 3345
TscAI CASTG 7 cut(s) 12, 138, 198, 702, 1675, 2130, 3566
TseFI GTSAC 5 cut(s) 724, 748, 928, 1397, 3512
Tsp45I GTSAC 5 cut(s) 724, 748, 928, 1397, 3512
TspRI CASTG 7 cut(s) 12, 138, 198, 702, 1675, 2130, 3566
Vha464I CTTAAG 1 cut(s) 1079
VneI GTGCAC 1 cut(s) 2381
VpaK11BI GGWCC 1 cut(s) 500
VspI ATTAAT 1 cut(s) 1328
XagI CCTNNNNNAGG 1 cut(s) 898
XapI RAATTY 6 cut(s) 1066, 1310, 1934, 2196, 2797, 3426
XbaI TCTAGA 2 cut(s) 2234, 3172
XceI RCATGY 4 cut(s) 861, 1046, 1982, 2526
XcmI CCANNNNNNNNNTGG 2 cut(s) 604, 2682
XmiI GTMKAC 1 cut(s) 1024
XmnI GAANNNNTTC 1 cut(s) 2196
XspI CTAG 3 cut(s) 2235, 2682, 3173
ZrmI AGTACT 2 cut(s) 1230, 1730
Zsp2I ATGCAT 1 cut(s) 1476
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.