FvH4_2g10163

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb2
OG0000158
Physical Location & Seq
Forward (+)
9023791 .. 9024113
323 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_2g10163.t1

Sequence Viewer

Length: 249 bp
ATGGTAGGGACTGAGCTATTACAGATGGTATCAGAGCCTATCCCCGGCCGGAAGTGTGCCGACGCGGACGTCGGGCCCCTAAGGGGGGTGGATTGTGGTGACCTAATTGGGCGGGTGCTAAGAAGAGCTAGCACCTTACCTTACATTGAAGCGCGTTTTAGGGTGAAATCTCAAGAACAAAACCGTGAGGGCCGGTGGGCCCAAGGCGGACAATATTTCAATGGTAGGGACTTGGCTGTTGCACATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

83

Amino Acids

9.08

Weight (kDa)

8.8

Isoelectric Point (pI)

41.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000158)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g10163
malus_domestica MD04G1068000.v1.1 MD05G1130900.v1.1 MD06G1153600.v1.1 MD10G1255900.v1.1 MD10G1282000.v1.1 MD13G1075400.v1.1 MD13G1192400.v1.1
pyrus_communis pycom01g00130 pycom01g00390 pycom01g00700 pycom01g00720 pycom01g00750 pycom01g00850 pycom01g00870 pycom01g00910 pycom01g01250 pycom01g01560 pycom01g01680 pycom01g01860 pycom01g01900 pycom01g01910 pycom01g02200 pycom01g02260 pycom01g02270 pycom01g02280 pycom01g02330 pycom01g02480 pycom01g02720 pycom01g02730 pycom01g02750 pycom01g02770 pycom01g02780 pycom01g02860 pycom01g02910 pycom01g03540 pycom01g04090 pycom01g04100 pycom01g04150 pycom01g04250 pycom01g04430 pycom01g11810 pycom01g11860 pycom01g11940 pycom01g21380 pycom02g06650 pycom02g08490 pycom02g08600 pycom02g18230 pycom02g18450 pycom02g18800 pycom02g19150 pycom02g20740 pycom02g21340 pycom02g26210 pycom03g12060 pycom03g19060 pycom03g19100 pycom03g19120 pycom04g06890 pycom04g08960 pycom05g01790 pycom05g07910 pycom05g08080 pycom05g08100 pycom05g08570 pycom05g21500 pycom05g22400 pycom05g22510 pycom05g22620 pycom05g23020 pycom05g23720 pycom05g23890 pycom05g24040 pycom07g12080 pycom08g07930 pycom08g11940 pycom09g12120 pycom10g03890 pycom10g23360 pycom10g28250 pycom11g02850 pycom11g14370 pycom11g14400 pycom11g21840 pycom11g21860 pycom11g21980 pycom11g23580 pycom11g23650 pycom11g24050 pycom11g25610 pycom12424g00060 pycom1256g00130 pycom12661g00030 pycom12g09520 pycom12g09530 pycom12g09660 pycom12g09730 pycom12g11210 pycom12g16710 pycom12g16740 pycom12g16750 pycom13g08800 pycom13g18580 pycom13g18670 pycom13g18770 pycom13g22900 pycom13g23050 pycom13g23160 pycom13g23480 pycom13g23610 pycom13g23660 pycom13g23790 pycom13g23840 pycom13g24010 pycom13g24140 pycom13g24210 pycom13g24300 pycom13g24310 pycom13g24480 pycom13g24520 pycom13g24570 pycom13g24730 pycom13g24760 pycom13g24820 pycom13g25010 pycom13g25020 pycom13g25270 pycom13g25620 pycom13g25670 pycom13g25760 pycom13g25800 pycom13g25900 pycom13g26620 pycom13g26640 pycom13g26670 pycom13g26940 pycom13g27040 pycom13g27130 pycom13g27530 pycom13g27770 pycom13g27830 pycom13g27920 pycom13g27940 pycom13g28100 pycom13g28420 pycom13g28430 pycom13g28460 pycom13g28520 pycom13g29160 pycom14g05380 pycom15g03480 pycom15g04370 pycom15g27500 pycom16g13590 pycom16g13610 pycom16g13630 pycom16g14390 pycom16g18310 pycom17g01940 pycom17g04000 pycom17g16100 pycom17g16220 pycom17g16230 pycom17g16340 pycom17g16430 pycom17g16460 pycom17g16740 pycom17g16960 pycom17g17020 pycom17g17090 pycom17g17100 pycom17g17170 pycom17g17430 pycom17g17850 pycom17g18230 pycom17g18250 pycom17g18380 pycom17g21170 pycom17g21330 pycom520g00150 pycom520g00160 pycom808g00030 pycom808g00160 pycom808g00250 pycom808g00290
rosa_chinensis RchiOBHm_Chr5g0054451

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 68
AatII GACGTC 1 cut(s) 72
AccII CGCG 2 cut(s) 65, 154
AciI CCGC 3 cut(s) 65, 112, 207
AcoI YGGCCR 1 cut(s) 46
AcyI GRCGYC 1 cut(s) 69
AfiI CCNNNNNNNGG 4 cut(s) 44, 83, 84, 85
AgsI TTSAA 2 cut(s) 149, 220
AluBI AGCT 2 cut(s) 16, 128
AluI AGCT 2 cut(s) 16, 128
AoxI GGCC 4 cut(s) 46, 74, 190, 198
ApaI GGGCCC 2 cut(s) 78, 202
AspLEI GCGC 1 cut(s) 154
AspS9I GGNCC 5 cut(s) 74, 75, 190, 198, 199
AsuC2I CCSGG 1 cut(s) 45
AsuHPI GGTGA 2 cut(s) 110, 175
AsuNHI GCTAGC 1 cut(s) 128
AxyI CCTNAGG 1 cut(s) 80
BaeGI GKGCMC 2 cut(s) 78, 202
BanII GRGCYC 2 cut(s) 78, 202
BccI CCATC 1 cut(s) 19
BcnI CCSGG 1 cut(s) 45
BfaI CTAG 1 cut(s) 129
Bme1390I CCNGG 1 cut(s) 45
BmgT120I GGNCC 5 cut(s) 74, 75, 190, 198, 199
BmiI GGNNCC 3 cut(s) 76, 77, 200
BmrFI CCNGG 1 cut(s) 45
BmtI GCTAGC 1 cut(s) 132
BpuEI CTTGAG 1 cut(s) 156
BpuMI CCSGG 1 cut(s) 45
BsaHI GRCGYC 1 cut(s) 69
BsaJI CCNNGG 2 cut(s) 43, 202
Bsc4I CCNNNNNNNGG 4 cut(s) 44, 83, 84, 85
Bse118I RCCGGY 1 cut(s) 192
Bse21I CCTNAGG 1 cut(s) 80
BseDI CCNNGG 2 cut(s) 43, 202
BseLI CCNNNNNNNGG 4 cut(s) 44, 83, 84, 85
BseSI GKGCMC 2 cut(s) 78, 202
BseX3I CGGCCG 1 cut(s) 46
Bsh1236I CGCG 2 cut(s) 65, 154
Bsh1285I CGRYCG 1 cut(s) 49
BshFI GGCC 4 cut(s) 48, 76, 192, 200
BsiEI CGRYCG 1 cut(s) 49
BsiSI CCGG 3 cut(s) 45, 49, 193
BslFI GGGAC 2 cut(s) 22, 242
BslI CCNNNNNNNGG 4 cut(s) 44, 83, 84, 85
BsmFI GGGAC 2 cut(s) 22, 242
BsnI GGCC 4 cut(s) 48, 76, 192, 200
Bsp120I GGGCCC 2 cut(s) 74, 198
Bsp1286I GDGCHC 2 cut(s) 78, 202
BspACI CCGC 3 cut(s) 65, 112, 207
BspANI GGCC 4 cut(s) 48, 76, 192, 200
BspCNI CTCAG 1 cut(s) 4
BspFNI CGCG 2 cut(s) 65, 154
BspLI GGNNCC 3 cut(s) 76, 77, 200
BspOI GCTAGC 1 cut(s) 132
BspQI GCTCTTC 1 cut(s) 118
BsrFI RCCGGY 1 cut(s) 192
BssAI RCCGGY 1 cut(s) 192
BssECI CCNNGG 2 cut(s) 43, 202
BssNI GRCGYC 1 cut(s) 69
BssT1I CCWWGG 1 cut(s) 202
Bst4CI ACNGT 1 cut(s) 185
Bst6I CTCTTC 1 cut(s) 118
BstACI GRCGYC 1 cut(s) 69
BstC8I GCNNGC 1 cut(s) 130
BstDEI CTNAG 3 cut(s) 12, 80, 119
BstEII GGTNACC 1 cut(s) 98
BstFNI CGCG 2 cut(s) 65, 154
BstHHI GCGC 1 cut(s) 154
BstMCI CGRYCG 1 cut(s) 49
BstPI GGTNACC 1 cut(s) 98
BstSCI CCNGG 1 cut(s) 43
BstSLI GKGCMC 2 cut(s) 78, 202
BstUI CGCG 2 cut(s) 65, 154
BstZI CGGCCG 1 cut(s) 46
Bsu36I CCTNAGG 1 cut(s) 80
BsuRI GGCC 4 cut(s) 48, 76, 192, 200
Cac8I GCNNGC 1 cut(s) 130
CfoI GCGC 1 cut(s) 154
Cfr10I RCCGGY 1 cut(s) 192
Cfr13I GGNCC 5 cut(s) 74, 75, 190, 198, 199
CseI GACGC 1 cut(s) 71
CviJI RGCY 8 cut(s) 16, 37, 48, 76, 128, 192, 200, 236
CviKI_1 RGCY 8 cut(s) 16, 37, 48, 76, 128, 192, 200, 236
DdeI CTNAG 3 cut(s) 12, 80, 119
DrdI GACNNNNNNGTC 1 cut(s) 68
DseDI GACNNNNNNGTC 1 cut(s) 68
EaeI YGGCCR 1 cut(s) 46
EagI CGGCCG 1 cut(s) 46
Eam1104I CTCTTC 1 cut(s) 118
EarI CTCTTC 1 cut(s) 118
EciI GGCGGA 1 cut(s) 222
EclXI CGGCCG 1 cut(s) 46
Eco130I CCWWGG 1 cut(s) 202
Eco24I GRGCYC 2 cut(s) 78, 202
Eco52I CGGCCG 1 cut(s) 46
Eco81I CCTNAGG 1 cut(s) 80
Eco91I GGTNACC 1 cut(s) 98
EcoO109I RGGNCCY 1 cut(s) 75
EcoO65I GGTNACC 1 cut(s) 98
EcoT14I CCWWGG 1 cut(s) 202
EcoT38I GRGCYC 2 cut(s) 78, 202
ErhI CCWWGG 1 cut(s) 202
FaqI GGGAC 2 cut(s) 22, 242
FauI CCCGC 1 cut(s) 105
FriOI GRGCYC 2 cut(s) 78, 202
FspBI CTAG 1 cut(s) 129
GlaI GCGC 1 cut(s) 153
HaeIII GGCC 4 cut(s) 48, 76, 192, 200
HapII CCGG 3 cut(s) 45, 49, 193
HgaI GACGC 1 cut(s) 71
HhaI GCGC 1 cut(s) 154
Hin1I GRCGYC 1 cut(s) 69
Hin6I GCGC 1 cut(s) 152
HinP1I GCGC 1 cut(s) 152
HpaII CCGG 3 cut(s) 45, 49, 193
HphI GGTGA 2 cut(s) 110, 175
Hpy188I TCNGA 1 cut(s) 34
Hpy188III TCNNGA 1 cut(s) 173
Hpy99I CGWCG 2 cut(s) 65, 74
HpyCH4III ACNGT 1 cut(s) 185
HpyCH4IV ACGT 1 cut(s) 69
HpyCH4V TGCA 1 cut(s) 242
HpyF3I CTNAG 3 cut(s) 12, 80, 119
HpySE526I ACGT 1 cut(s) 69
Hsp92I GRCGYC 1 cut(s) 69
HspAI GCGC 1 cut(s) 152
LguI GCTCTTC 1 cut(s) 118
LpnPI CCDG 3 cut(s) 58, 62, 206
MaeI CTAG 1 cut(s) 129
MaeII ACGT 1 cut(s) 69
MaeIII GTNAC 1 cut(s) 98
MboII GAAGA 1 cut(s) 135
MhlI GDGCHC 2 cut(s) 78, 202
MluCI AATT 1 cut(s) 105
MnlI CCTC 1 cut(s) 181
MspI CCGG 3 cut(s) 45, 49, 193
MspR9I CCNGG 1 cut(s) 45
MvnI CGCG 2 cut(s) 65, 154
NciI CCSGG 1 cut(s) 45
NheI GCTAGC 1 cut(s) 128
NlaIV GGNNCC 3 cut(s) 76, 77, 200
NmuCI GTSAC 1 cut(s) 98
PciSI GCTCTTC 1 cut(s) 118
PspEI GGTNACC 1 cut(s) 98
PspN4I GGNNCC 3 cut(s) 76, 77, 200
PspOMI GGGCCC 2 cut(s) 74, 198
PspPI GGNCC 5 cut(s) 74, 75, 190, 198, 199
SapI GCTCTTC 1 cut(s) 118
Sau96I GGNCC 5 cut(s) 74, 75, 190, 198, 199
ScrFI CCNGG 1 cut(s) 45
SduI GDGCHC 2 cut(s) 78, 202
SetI ASST 6 cut(s) 18, 72, 105, 130, 137, 142
SmlI CTYRAG 1 cut(s) 171
SmoI CTYRAG 1 cut(s) 171
Sse9I AATT 1 cut(s) 105
SsiI CCGC 3 cut(s) 65, 112, 207
SspI AATATT 1 cut(s) 215
SspMI CTAG 1 cut(s) 129
StyD4I CCNGG 1 cut(s) 43
StyI CCWWGG 1 cut(s) 202
TaaI ACNGT 1 cut(s) 185
TaiI ACGT 1 cut(s) 72
TasI AATT 1 cut(s) 105
TseFI GTSAC 1 cut(s) 98
Tsp45I GTSAC 1 cut(s) 98
XspI CTAG 1 cut(s) 129
ZraI GACGTC 1 cut(s) 70
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.