pycom13g28420

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr13
Physical Location & Seq
Forward (+)
24255361 .. 24255585
225 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom13g28420.1

Sequence Viewer

Length: 225 bp
ATGCTTAGGTATATTTTGAGGGGAAGTTATGTAACATCCCACATCAACCAATGGAAAGGGGGTGATGTGCGTTATATGTCAACCAATGGAAAGGTGGTGATGTGCCTTATATGTACATGCCCACCTCCATATAGCATGAGGCCTTTTGGGAGATCACTGGCTTCGGATTCCATCGGAACTCCGAAGTTAAGTGAGTTTGGGCAAGAGCATTCCCAGGATGGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

75

Amino Acids

8.26

Weight (kDa)

8.96

Isoelectric Point (pI)

58.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000158)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g10163
malus_domestica MD04G1068000.v1.1 MD05G1130900.v1.1 MD06G1153600.v1.1 MD10G1255900.v1.1 MD10G1282000.v1.1 MD13G1075400.v1.1 MD13G1192400.v1.1
pyrus_communis pycom01g00130 pycom01g00390 pycom01g00700 pycom01g00720 pycom01g00750 pycom01g00850 pycom01g00870 pycom01g00910 pycom01g01250 pycom01g01560 pycom01g01680 pycom01g01860 pycom01g01900 pycom01g01910 pycom01g02200 pycom01g02260 pycom01g02270 pycom01g02280 pycom01g02330 pycom01g02480 pycom01g02720 pycom01g02730 pycom01g02750 pycom01g02770 pycom01g02780 pycom01g02860 pycom01g02910 pycom01g03540 pycom01g04090 pycom01g04100 pycom01g04150 pycom01g04250 pycom01g04430 pycom01g11810 pycom01g11860 pycom01g11940 pycom01g21380 pycom02g06650 pycom02g08490 pycom02g08600 pycom02g18230 pycom02g18450 pycom02g18800 pycom02g19150 pycom02g20740 pycom02g21340 pycom02g26210 pycom03g12060 pycom03g19060 pycom03g19100 pycom03g19120 pycom04g06890 pycom04g08960 pycom05g01790 pycom05g07910 pycom05g08080 pycom05g08100 pycom05g08570 pycom05g21500 pycom05g22400 pycom05g22510 pycom05g22620 pycom05g23020 pycom05g23720 pycom05g23890 pycom05g24040 pycom07g12080 pycom08g07930 pycom08g11940 pycom09g12120 pycom10g03890 pycom10g23360 pycom10g28250 pycom11g02850 pycom11g14370 pycom11g14400 pycom11g21840 pycom11g21860 pycom11g21980 pycom11g23580 pycom11g23650 pycom11g24050 pycom11g25610 pycom12424g00060 pycom1256g00130 pycom12661g00030 pycom12g09520 pycom12g09530 pycom12g09660 pycom12g09730 pycom12g11210 pycom12g16710 pycom12g16740 pycom12g16750 pycom13g08800 pycom13g18580 pycom13g18670 pycom13g18770 pycom13g22900 pycom13g23050 pycom13g23160 pycom13g23480 pycom13g23610 pycom13g23660 pycom13g23790 pycom13g23840 pycom13g24010 pycom13g24140 pycom13g24210 pycom13g24300 pycom13g24310 pycom13g24480 pycom13g24520 pycom13g24570 pycom13g24730 pycom13g24760 pycom13g24820 pycom13g25010 pycom13g25020 pycom13g25270 pycom13g25620 pycom13g25670 pycom13g25760 pycom13g25800 pycom13g25900 pycom13g26620 pycom13g26640 pycom13g26670 pycom13g26940 pycom13g27040 pycom13g27130 pycom13g27530 pycom13g27770 pycom13g27830 pycom13g27920 pycom13g27940 pycom13g28100 pycom13g28420 pycom13g28430 pycom13g28460 pycom13g28520 pycom13g29160 pycom14g05380 pycom15g03480 pycom15g04370 pycom15g27500 pycom16g13590 pycom16g13610 pycom16g13630 pycom16g14390 pycom16g18310 pycom17g01940 pycom17g04000 pycom17g16100 pycom17g16220 pycom17g16230 pycom17g16340 pycom17g16430 pycom17g16460 pycom17g16740 pycom17g16960 pycom17g17020 pycom17g17090 pycom17g17100 pycom17g17170 pycom17g17430 pycom17g17850 pycom17g18230 pycom17g18250 pycom17g18380 pycom17g21170 pycom17g21330 pycom520g00150 pycom520g00160 pycom808g00030 pycom808g00160 pycom808g00250 pycom808g00290
rosa_chinensis RchiOBHm_Chr5g0054451

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 115
AfiI CCNNNNNNNGG 1 cut(s) 219
AjnI CCWGG 1 cut(s) 213
AoxI GGCC 1 cut(s) 140
AsuHPI GGTGA 2 cut(s) 74, 109
BccI CCATC 2 cut(s) 179, 212
BciT130I CCWGG 1 cut(s) 215
Bme1390I CCNGG 1 cut(s) 215
BmrFI CCNGG 1 cut(s) 215
Bpu10I CCTNAGC 1 cut(s) 5
BsaJI CCNNGG 1 cut(s) 213
Bsc4I CCNNNNNNNGG 1 cut(s) 219
Bse1I ACTGG 1 cut(s) 162
BseBI CCWGG 1 cut(s) 215
BseDI CCNNGG 1 cut(s) 213
BseGI GGATG 2 cut(s) 35, 223
BseLI CCNNNNNNNGG 1 cut(s) 219
BseNI ACTGG 1 cut(s) 162
BshFI GGCC 1 cut(s) 142
BslI CCNNNNNNNGG 1 cut(s) 219
BsmI GAATGC 1 cut(s) 208
BsnI GGCC 1 cut(s) 142
Bsp1407I TGTACA 1 cut(s) 113
Bsp143I GATC 1 cut(s) 152
BspANI GGCC 1 cut(s) 142
BsrGI TGTACA 1 cut(s) 113
BsrI ACTGG 1 cut(s) 162
BssECI CCNNGG 1 cut(s) 213
BssMI GATC 1 cut(s) 152
Bst2UI CCWGG 1 cut(s) 215
BstAUI TGTACA 1 cut(s) 113
BstDEI CTNAG 1 cut(s) 5
BstF5I GGATG 2 cut(s) 35, 223
BstKTI GATC 1 cut(s) 155
BstMBI GATC 1 cut(s) 152
BstNI CCWGG 1 cut(s) 215
BstNSI RCATGY 1 cut(s) 120
BstSCI CCNGG 1 cut(s) 213
BsuRI GGCC 1 cut(s) 142
BtsCI GGATG 2 cut(s) 35, 223
BtsIMutI CAGTG 1 cut(s) 155
Csp6I GTAC 1 cut(s) 114
CviAII CATG 2 cut(s) 117, 136
CviJI RGCY 2 cut(s) 142, 161
CviKI_1 RGCY 2 cut(s) 142, 161
CviQI GTAC 1 cut(s) 114
DdeI CTNAG 1 cut(s) 5
DpnI GATC 1 cut(s) 154
DpnII GATC 1 cut(s) 152
Eco147I AGGCCT 1 cut(s) 142
EcoRII CCWGG 1 cut(s) 213
FaeI CATG 2 cut(s) 120, 139
FatI CATG 2 cut(s) 116, 135
FokI GGATG 1 cut(s) 22
HaeIII GGCC 1 cut(s) 142
Hin1II CATG 2 cut(s) 120, 139
HincII GTYRAC 1 cut(s) 81
HindII GTYRAC 1 cut(s) 81
HinfI GANTC 1 cut(s) 167
HphI GGTGA 2 cut(s) 74, 109
Hpy166II GTNNAC 1 cut(s) 81
Hpy188I TCNGA 3 cut(s) 166, 176, 183
Hpy8I GTNNAC 1 cut(s) 81
HpyF3I CTNAG 1 cut(s) 5
Hsp92II CATG 2 cut(s) 120, 139
Kzo9I GATC 1 cut(s) 152
LpnPI CCDG 2 cut(s) 143, 200
MaeIII GTNAC 1 cut(s) 31
MalI GATC 1 cut(s) 154
MboI GATC 1 cut(s) 152
MnlI CCTC 3 cut(s) 12, 132, 135
MseI TTAA 1 cut(s) 188
MspR9I CCNGG 1 cut(s) 215
Mva1269I GAATGC 1 cut(s) 208
MvaI CCWGG 1 cut(s) 215
NdeII GATC 1 cut(s) 152
NlaIII CATG 2 cut(s) 120, 139
NspI RCATGY 1 cut(s) 120
PceI AGGCCT 1 cut(s) 142
PctI GAATGC 1 cut(s) 208
PfeI GAWTC 1 cut(s) 167
Psp6I CCWGG 1 cut(s) 213
PspGI CCWGG 1 cut(s) 213
RsaI GTAC 1 cut(s) 115
RsaNI GTAC 1 cut(s) 114
SaqAI TTAA 1 cut(s) 188
Sau3AI GATC 1 cut(s) 152
ScrFI CCNGG 1 cut(s) 215
SetI ASST 3 cut(s) 11, 96, 127
SgeI CNNG 4 cut(s) 129, 148, 170, 215
SseBI AGGCCT 1 cut(s) 142
StuI AGGCCT 1 cut(s) 142
StyD4I CCNGG 1 cut(s) 213
TatI WGTACW 1 cut(s) 113
TfiI GAWTC 1 cut(s) 167
Tru1I TTAA 1 cut(s) 188
Tru9I TTAA 1 cut(s) 188
TscAI CASTG 1 cut(s) 162
TspRI CASTG 1 cut(s) 162
XceI RCATGY 1 cut(s) 120
XcmI CCANNNNNNNNNTGG 1 cut(s) 91
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.