pycom13g26940

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr13
OG0000158
Physical Location & Seq
Forward (+)
23396018 .. 23398593
2576 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom13g26940.15

Sequence Viewer

Length: 1650 bp
ATGAAACTCAAGCTTGCACTGATCGATCCCGTGCAACATCGTCACTTAATTTGCAAATCCATACTTAAATCATACATTTTGAAATATGTAAAACTAAGACATTCACCGCTATTTATACAAAATCATGCATCCCACAACCATCTTATTTGCATTAATAATTCCATATTTGTGCTAAATTGTCACATCCCACACGATATTGTCCGCTTTGGGCCCCGACCACGCCCTCACGGTCTTGTTTCTGGGAACTCACACGAGAACTTCCTAGTGGGTTACCCATCCTGGGATTGCTTTCTTGCGAACTCGCTTAACTTCAGAGTTCCTACGGAACCCGAAGCCAGTGAGCTCCCAAAAGGCCTCGTGCTAAGTAGGGATGAGAATATACATATAAAGATCACTCCCTTGGGCGATGTGGGATCTTACAATCCACCCCCCTTAGGGGCCCGACATCTTCGTCGGAGCACCACGGCTAGGCACGATATTGTTCGCTTTGGGCCCCAACCACGCCCTCACGGTTTTGTTTCTGGGAACTCACACGAGAACTTCCCAGTGGGTCACCCATCCTGGGATTGCTTTCTCGCGAACTCACTTAACTTCGGAGTTCCTACGGAACCCGAAGCCAGTGAGCTCCCAAAAGGCCTCGTGCTAGGTAGGGATGAGAATATACATATAAGGATCACTCCCCTGGGCGATGTGGGATCTTACATAAGTCCCCATGACCAAATGATTGCAAGTAAAAATATACACATACACCAAGTACTCATTCTAAAACTTAAACGTATTATTGTAATTCAAGTCATGAGAATAACACTTTATGCAAGTCCACTTAATGCTCAAAATTTTAGAACAACTCCCACTAAACTTTTAGAGTTTATACACTTACTGCAAATAATGCTTCATATTTTAGATATAATTAATAATAGACATCACAACCAACATAAAAATTTATCATACTTAATTTATAATGACGTCTCAAAAGACAAAAACAATCTGCCAGCAAAACTGTCTGTACGAGCATGGGTTTCTAGTAAATTTACCATAATTACACTACATGGAAAATTTACGAAAATTTGCAGACACATAGTGTCATTCACCCGATTTAAATCAAGACACGCAATCTGCCAGAAACAATTATGTGCTTCTATCATGAATTTATACATCCATAACAATTCAATTTCATATCATTTCAATTTTGATTTCAAATTGAAAAGATTTGCAAGCATAAGACTTAAAGAATACTTTGCATCAACAAGTCTCATGAAAAGACACAAAATACGTCATGATGCAACCGATTTTCATGCCTTAAAACCACAACCTATTATGGGGCTCATAGTGGGATTTTTAGTTCCTAGTATTGAATTATATGTCACAAGAGTTACCTTCATAAAAAACTTCAACACCTATGGGCAAGATGAAGTTTTCACAAACTCCTGTGAAATAAAACCCATACTATTAAGATGCAATGTTGATCGAAGTAACTTAAACCACAACATTGATCAACTCTCGCCTGAAATAATACAAACGTCACATGGATTAATTAGCTTCTTGCCAACAAATGGCCTTAATTTAATAATCTCCTTCATGACTCCCTTTGATATTCAATTAATCTTAAGAAACCTGACAACACACTTGAAAGAGATTAATCATATATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

550

Amino Acids

62.93

Weight (kDa)

9.73

Isoelectric Point (pI)

42.17

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000158)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g10163
malus_domestica MD04G1068000.v1.1 MD05G1130900.v1.1 MD06G1153600.v1.1 MD10G1255900.v1.1 MD10G1282000.v1.1 MD13G1075400.v1.1 MD13G1192400.v1.1
pyrus_communis pycom01g00130 pycom01g00390 pycom01g00700 pycom01g00720 pycom01g00750 pycom01g00850 pycom01g00870 pycom01g00910 pycom01g01250 pycom01g01560 pycom01g01680 pycom01g01860 pycom01g01900 pycom01g01910 pycom01g02200 pycom01g02260 pycom01g02270 pycom01g02280 pycom01g02330 pycom01g02480 pycom01g02720 pycom01g02730 pycom01g02750 pycom01g02770 pycom01g02780 pycom01g02860 pycom01g02910 pycom01g03540 pycom01g04090 pycom01g04100 pycom01g04150 pycom01g04250 pycom01g04430 pycom01g11810 pycom01g11860 pycom01g11940 pycom01g21380 pycom02g06650 pycom02g08490 pycom02g08600 pycom02g18230 pycom02g18450 pycom02g18800 pycom02g19150 pycom02g20740 pycom02g21340 pycom02g26210 pycom03g12060 pycom03g19060 pycom03g19100 pycom03g19120 pycom04g06890 pycom04g08960 pycom05g01790 pycom05g07910 pycom05g08080 pycom05g08100 pycom05g08570 pycom05g21500 pycom05g22400 pycom05g22510 pycom05g22620 pycom05g23020 pycom05g23720 pycom05g23890 pycom05g24040 pycom07g12080 pycom08g07930 pycom08g11940 pycom09g12120 pycom10g03890 pycom10g23360 pycom10g28250 pycom11g02850 pycom11g14370 pycom11g14400 pycom11g21840 pycom11g21860 pycom11g21980 pycom11g23580 pycom11g23650 pycom11g24050 pycom11g25610 pycom12424g00060 pycom1256g00130 pycom12661g00030 pycom12g09520 pycom12g09530 pycom12g09660 pycom12g09730 pycom12g11210 pycom12g16710 pycom12g16740 pycom12g16750 pycom13g08800 pycom13g18580 pycom13g18670 pycom13g18770 pycom13g22900 pycom13g23050 pycom13g23160 pycom13g23480 pycom13g23610 pycom13g23660 pycom13g23790 pycom13g23840 pycom13g24010 pycom13g24140 pycom13g24210 pycom13g24300 pycom13g24310 pycom13g24480 pycom13g24520 pycom13g24570 pycom13g24730 pycom13g24760 pycom13g24820 pycom13g25010 pycom13g25020 pycom13g25270 pycom13g25620 pycom13g25670 pycom13g25760 pycom13g25800 pycom13g25900 pycom13g26620 pycom13g26640 pycom13g26670 pycom13g26940 pycom13g27040 pycom13g27130 pycom13g27530 pycom13g27770 pycom13g27830 pycom13g27920 pycom13g27940 pycom13g28100 pycom13g28420 pycom13g28430 pycom13g28460 pycom13g28520 pycom13g29160 pycom14g05380 pycom15g03480 pycom15g04370 pycom15g27500 pycom16g13590 pycom16g13610 pycom16g13630 pycom16g14390 pycom16g18310 pycom17g01940 pycom17g04000 pycom17g16100 pycom17g16220 pycom17g16230 pycom17g16340 pycom17g16430 pycom17g16460 pycom17g16740 pycom17g16960 pycom17g17020 pycom17g17090 pycom17g17100 pycom17g17170 pycom17g17430 pycom17g17850 pycom17g18230 pycom17g18250 pycom17g18380 pycom17g21170 pycom17g21330 pycom520g00150 pycom520g00160 pycom808g00030 pycom808g00160 pycom808g00250 pycom808g00290
rosa_chinensis RchiOBHm_Chr5g0054451

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 960
AasI GACNNNNNNGTC 1 cut(s) 450
AatII GACGTC 1 cut(s) 969
AccB7I CCANNNNNTGG 1 cut(s) 1553
AccII CGCG 1 cut(s) 578
AciI CCGC 2 cut(s) 107, 202
AclWI GGATC 4 cut(s) 20, 421, 680, 703
AcsI RAATTY 6 cut(s) 835, 940, 1028, 1055, 1065, 1147
AcuI CTGAAG 1 cut(s) 295
AcyI GRCGYC 1 cut(s) 966
AdeI CACNNNGTG 1 cut(s) 1081
AfaI GTAC 2 cut(s) 756, 1008
AfiI CCNNNNNNNGG 8 cut(s) 280, 434, 435, 436, 468, 562, 1319, 1553
AflII CTTAAG 1 cut(s) 1606
AjnI CCWGG 3 cut(s) 278, 560, 681
AjuI GAANNNNNNNTTGG 2 cut(s) 744, 776
AloI GAACNNNNNNTCC 2 cut(s) 1326, 1358
AluBI AGCT 4 cut(s) 13, 343, 625, 1539
AluI AGCT 4 cut(s) 13, 343, 625, 1539
Alw21I GWGCWC 3 cut(s) 345, 461, 627
Alw26I GTCTC 2 cut(s) 973, 1256
AlwI GGATC 4 cut(s) 20, 421, 680, 703
AoxI GGCC 6 cut(s) 209, 352, 438, 491, 634, 1555
ApaI GGGCCC 3 cut(s) 213, 442, 495
ApoI RAATTY 6 cut(s) 835, 940, 1028, 1055, 1065, 1147
AseI ATTAAT 5 cut(s) 153, 912, 1532, 1601, 1638
AspS9I GGNCC 6 cut(s) 209, 210, 438, 439, 491, 492
AsuHPI GGTGA 3 cut(s) 96, 545, 1081
AxyI CCTNAGG 1 cut(s) 433
BaeGI GKGCMC 3 cut(s) 213, 442, 495
BanII GRGCYC 6 cut(s) 213, 345, 442, 495, 627, 1326
BauI CACGAG 4 cut(s) 251, 356, 533, 638
Bbv12I GWGCWC 3 cut(s) 345, 461, 627
BccI CCATC 3 cut(s) 147, 283, 565
BceAI ACGGC 1 cut(s) 480
BcgI CGANNNNNNTGC 2 cut(s) 1277, 1311
BciT130I CCWGG 3 cut(s) 280, 562, 683
BclI TGATCA 1 cut(s) 1492
BcoDI GTCTC 2 cut(s) 973, 1256
BfaI CTAG 5 cut(s) 263, 468, 644, 1023, 1347
BfrI CTTAAG 1 cut(s) 1606
BmcAI AGTACT 1 cut(s) 756
Bme1390I CCNGG 3 cut(s) 280, 562, 683
BmgT120I GGNCC 6 cut(s) 209, 210, 438, 439, 491, 492
BmiI GGNNCC 8 cut(s) 211, 212, 327, 439, 440, 493, 494, 609
BmrFI CCNGG 3 cut(s) 280, 562, 683
BmrI ACTGGG 1 cut(s) 539
BmsI GCATC 4 cut(s) 137, 1250, 1270, 1445
BmuI ACTGGG 1 cut(s) 539
Bsa29I ATCGAT 1 cut(s) 24
BsaBI GATNNNNATC 1 cut(s) 1099
BsaHI GRCGYC 1 cut(s) 966
BsaJI CCNNGG 6 cut(s) 279, 399, 462, 561, 681, 682
Bsc4I CCNNNNNNNGG 8 cut(s) 280, 434, 435, 436, 468, 562, 1319, 1553
Bse1I ACTGG 3 cut(s) 336, 545, 618
Bse21I CCTNAGG 1 cut(s) 433
Bse3DI GCAATG 1 cut(s) 1465
Bse8I GATNNNNATC 1 cut(s) 1099
BseBI CCWGG 3 cut(s) 280, 562, 683
BseCI ATCGAT 1 cut(s) 24
BseDI CCNNGG 6 cut(s) 279, 399, 462, 561, 681, 682
BseGI GGATG 7 cut(s) 128, 183, 275, 376, 557, 658, 1155
BseJI GATNNNNATC 1 cut(s) 1099
BseLI CCNNNNNNNGG 8 cut(s) 280, 434, 435, 436, 468, 562, 1319, 1553
BseMI GCAATG 1 cut(s) 1465
BseNI ACTGG 3 cut(s) 336, 545, 618
BseSI GKGCMC 3 cut(s) 213, 442, 495
Bsh1236I CGCG 1 cut(s) 578
BshFI GGCC 6 cut(s) 211, 354, 440, 493, 636, 1557
BshVI ATCGAT 1 cut(s) 24
BsiHKAI GWGCWC 3 cut(s) 345, 461, 627
BslFI GGGAC 1 cut(s) 693
BslI CCNNNNNNNGG 8 cut(s) 280, 434, 435, 436, 468, 562, 1319, 1553
BsmAI GTCTC 2 cut(s) 973, 1256
BsmBI CGTCTC 1 cut(s) 973
BsmFI GGGAC 1 cut(s) 693
BsnI GGCC 6 cut(s) 211, 354, 440, 493, 636, 1557
Bsp120I GGGCCC 3 cut(s) 209, 438, 491
Bsp1286I GDGCHC 7 cut(s) 213, 345, 442, 461, 495, 627, 1326
Bsp143I GATC 8 cut(s) 21, 25, 390, 413, 672, 695, 1465, 1492
Bsp68I TCGCGA 1 cut(s) 578
BspACI CCGC 2 cut(s) 107, 202
BspANI GGCC 6 cut(s) 211, 354, 440, 493, 636, 1557
BspDI ATCGAT 1 cut(s) 24
BspFNI CGCG 1 cut(s) 578
BspHI TCATGA 5 cut(s) 795, 1143, 1254, 1276, 1578
BspLI GGNNCC 8 cut(s) 211, 212, 327, 439, 440, 493, 494, 609
BspPI GGATC 4 cut(s) 20, 421, 680, 703
BspTI CTTAAG 1 cut(s) 1606
BsrDI GCAATG 1 cut(s) 1465
BsrI ACTGG 3 cut(s) 336, 545, 618
BssECI CCNNGG 6 cut(s) 279, 399, 462, 561, 681, 682
BssMI GATC 8 cut(s) 21, 25, 390, 413, 672, 695, 1465, 1492
BssNI GRCGYC 1 cut(s) 966
BssSI CACGAG 4 cut(s) 251, 356, 533, 638
BssT1I CCWWGG 1 cut(s) 399
Bst2BI CACGAG 4 cut(s) 251, 356, 533, 638
Bst2UI CCWGG 3 cut(s) 280, 562, 683
Bst4CI ACNGT 3 cut(s) 230, 512, 1002
BstACI GRCGYC 1 cut(s) 966
BstAFI CTTAAG 1 cut(s) 1606
BstAPI GCANNNNNTGC 1 cut(s) 889
BstC8I GCNNGC 3 cut(s) 15, 993, 1216
BstDEI CTNAG 3 cut(s) 95, 362, 433
BstDSI CCRYGG 1 cut(s) 462
BstEII GGTNACC 2 cut(s) 269, 551
BstF5I GGATG 7 cut(s) 128, 183, 275, 376, 557, 658, 1155
BstFNI CGCG 1 cut(s) 578
BstKTI GATC 8 cut(s) 24, 28, 393, 416, 675, 698, 1468, 1495
BstMAI GTCTC 2 cut(s) 973, 1256
BstMBI GATC 8 cut(s) 21, 25, 390, 413, 672, 695, 1465, 1492
BstMWI GCNNNNNNNGC 1 cut(s) 889
BstNI CCWGG 3 cut(s) 280, 562, 683
BstPI GGTNACC 2 cut(s) 269, 551
BstSCI CCNGG 3 cut(s) 278, 560, 681
BstSLI GKGCMC 3 cut(s) 213, 442, 495
BstUI CGCG 1 cut(s) 578
BstX2I RGATCY 2 cut(s) 413, 695
BstYI RGATCY 2 cut(s) 413, 695
Bsu15I ATCGAT 1 cut(s) 24
Bsu36I CCTNAGG 1 cut(s) 433
BsuRI GGCC 6 cut(s) 211, 354, 440, 493, 636, 1557
BsuTUI ATCGAT 1 cut(s) 24
BtgI CCRYGG 1 cut(s) 462
BtgZI GCGATG 2 cut(s) 420, 702
BtsCI GGATG 7 cut(s) 128, 183, 275, 376, 557, 658, 1155
BtsIMutI CAGTG 4 cut(s) 17, 343, 552, 625
BtuMI TCGCGA 1 cut(s) 578
Cac8I GCNNGC 3 cut(s) 15, 993, 1216
CciI TCATGA 5 cut(s) 795, 1143, 1254, 1276, 1578
Cfr13I GGNCC 6 cut(s) 209, 210, 438, 439, 491, 492
ClaI ATCGAT 1 cut(s) 24
Csp6I GTAC 2 cut(s) 755, 1007
CviQI GTAC 2 cut(s) 755, 1007
DdeI CTNAG 3 cut(s) 95, 362, 433
DpnI GATC 8 cut(s) 23, 27, 392, 415, 674, 697, 1467, 1494
DpnII GATC 8 cut(s) 21, 25, 390, 413, 672, 695, 1465, 1492
DraI TTTAAA 1 cut(s) 1099
DraIII CACNNNGTG 1 cut(s) 1081
DrdI GACNNNNNNGTC 1 cut(s) 450
DseDI GACNNNNNNGTC 1 cut(s) 450
Ecl136II GAGCTC 2 cut(s) 343, 625
Eco130I CCWWGG 1 cut(s) 399
Eco147I AGGCCT 2 cut(s) 354, 636
Eco24I GRGCYC 6 cut(s) 213, 345, 442, 495, 627, 1326
Eco53kI GAGCTC 2 cut(s) 343, 625
Eco57I CTGAAG 1 cut(s) 295
Eco81I CCTNAGG 1 cut(s) 433
Eco91I GGTNACC 2 cut(s) 269, 551
EcoICRI GAGCTC 2 cut(s) 343, 625
EcoO109I RGGNCCY 3 cut(s) 210, 438, 492
EcoO65I GGTNACC 2 cut(s) 269, 551
EcoRII CCWGG 3 cut(s) 278, 560, 681
EcoT14I CCWWGG 1 cut(s) 399
EcoT22I ATGCAT 1 cut(s) 130
EcoT38I GRGCYC 6 cut(s) 213, 345, 442, 495, 627, 1326
ErhI CCWWGG 1 cut(s) 399
Esp3I CGTCTC 1 cut(s) 973
FaqI GGGAC 1 cut(s) 693
FbaI TGATCA 1 cut(s) 1492
FokI GGATG 7 cut(s) 115, 170, 262, 383, 544, 665, 1142
FriOI GRGCYC 6 cut(s) 213, 345, 442, 495, 627, 1326
FspBI CTAG 5 cut(s) 263, 468, 644, 1023, 1347
HaeIII GGCC 6 cut(s) 211, 354, 440, 493, 636, 1557
Hin1I GRCGYC 1 cut(s) 966
HindIII AAGCTT 1 cut(s) 11
HinfI GANTC 1 cut(s) 1582
HphI GGTGA 3 cut(s) 96, 545, 1081
Hpy166II GTNNAC 1 cut(s) 821
Hpy188I TCNGA 3 cut(s) 314, 456, 596
Hpy188III TCNNGA 7 cut(s) 577, 796, 1104, 1144, 1255, 1277, 1579
Hpy8I GTNNAC 1 cut(s) 821
Hpy99I CGWCG 1 cut(s) 456
HpyAV CCTTC 2 cut(s) 1387, 1585
HpyCH4III ACNGT 3 cut(s) 230, 512, 1002
HpyCH4IV ACGT 4 cut(s) 775, 966, 1273, 1520
HpyF10VI GCNNNNNNNGC 1 cut(s) 889
HpyF3I CTNAG 3 cut(s) 95, 362, 433
HpySE526I ACGT 4 cut(s) 775, 966, 1273, 1520
Hsp92I GRCGYC 1 cut(s) 966
Ksp22I TGATCA 1 cut(s) 1492
Kzo9I GATC 8 cut(s) 21, 25, 390, 413, 672, 695, 1465, 1492
LmnI GCTCC 3 cut(s) 348, 456, 630
LweI GCATC 4 cut(s) 137, 1250, 1270, 1445
MaeI CTAG 5 cut(s) 263, 468, 644, 1023, 1347
MaeII ACGT 4 cut(s) 775, 966, 1273, 1520
MaeIII GTNAC 8 cut(s) 41, 179, 269, 551, 1363, 1372, 1472, 1521
MalI GATC 8 cut(s) 23, 27, 392, 415, 674, 697, 1467, 1494
MboI GATC 8 cut(s) 21, 25, 390, 413, 672, 695, 1465, 1492
MboII GAAGA 1 cut(s) 440
MflI RGATCY 2 cut(s) 413, 695
MhlI GDGCHC 7 cut(s) 213, 345, 442, 461, 495, 627, 1326
MlyI GAGTC 1 cut(s) 1576
MmeI TCCRAC 1 cut(s) 434
MnlI CCTC 4 cut(s) 234, 365, 516, 647
Mph1103I ATGCAT 1 cut(s) 130
MslI CAYNNNNRTG 1 cut(s) 167
MspCI CTTAAG 1 cut(s) 1606
MspR9I CCNGG 3 cut(s) 280, 562, 683
MvaI CCWGG 3 cut(s) 280, 562, 683
MvnI CGCG 1 cut(s) 578
MwoI GCNNNNNNNGC 1 cut(s) 889
NdeII GATC 8 cut(s) 21, 25, 390, 413, 672, 695, 1465, 1492
NlaIV GGNNCC 8 cut(s) 211, 212, 327, 439, 440, 493, 494, 609
NmuCI GTSAC 5 cut(s) 41, 179, 551, 1363, 1521
NruI TCGCGA 1 cut(s) 578
NsiI ATGCAT 1 cut(s) 130
PagI TCATGA 5 cut(s) 795, 1143, 1254, 1276, 1578
PasI CCCWGGG 1 cut(s) 682
PceI AGGCCT 2 cut(s) 354, 636
PflMI CCANNNNNTGG 1 cut(s) 1553
PleI GAGTC 1 cut(s) 1576
PpsI GAGTC 1 cut(s) 1576
PshBI ATTAAT 5 cut(s) 153, 912, 1532, 1601, 1638
PsiI TTATAA 1 cut(s) 960
Psp124BI GAGCTC 2 cut(s) 345, 627
Psp6I CCWGG 3 cut(s) 278, 560, 681
PspEI GGTNACC 2 cut(s) 269, 551
PspGI CCWGG 3 cut(s) 278, 560, 681
PspN4I GGNNCC 8 cut(s) 211, 212, 327, 439, 440, 493, 494, 609
PspOMI GGGCCC 3 cut(s) 209, 438, 491
PspPI GGNCC 6 cut(s) 209, 210, 438, 439, 491, 492
PsuI RGATCY 2 cut(s) 413, 695
RruI TCGCGA 1 cut(s) 578
RsaI GTAC 2 cut(s) 756, 1008
RsaNI GTAC 2 cut(s) 755, 1007
RseI CAYNNNNRTG 1 cut(s) 167
SacI GAGCTC 2 cut(s) 345, 627
Sau3AI GATC 8 cut(s) 21, 25, 390, 413, 672, 695, 1465, 1492
Sau96I GGNCC 6 cut(s) 209, 210, 438, 439, 491, 492
ScaI AGTACT 1 cut(s) 756
SchI GAGTC 1 cut(s) 1576
ScrFI CCNGG 3 cut(s) 280, 562, 683
SduI GDGCHC 7 cut(s) 213, 345, 442, 461, 495, 627, 1326
SfaNI GCATC 4 cut(s) 137, 1250, 1270, 1445
SmiI ATTTAAAT 1 cut(s) 1099
SmiMI CAYNNNNRTG 1 cut(s) 167
SmlI CTYRAG 2 cut(s) 8, 1606
SmoI CTYRAG 2 cut(s) 8, 1606
SseBI AGGCCT 2 cut(s) 354, 636
SsiI CCGC 2 cut(s) 107, 202
SspMI CTAG 5 cut(s) 263, 468, 644, 1023, 1347
SstI GAGCTC 2 cut(s) 345, 627
StuI AGGCCT 2 cut(s) 354, 636
StyD4I CCNGG 3 cut(s) 278, 560, 681
StyI CCWWGG 1 cut(s) 399
SwaI ATTTAAAT 1 cut(s) 1099
TaaI ACNGT 3 cut(s) 230, 512, 1002
TaiI ACGT 4 cut(s) 778, 969, 1276, 1523
TaqI TCGA 2 cut(s) 24, 1468
TatI WGTACW 1 cut(s) 754
TscAI CASTG 4 cut(s) 24, 343, 552, 625
TseFI GTSAC 5 cut(s) 41, 179, 551, 1363, 1521
Tsp45I GTSAC 5 cut(s) 41, 179, 551, 1363, 1521
TspDTI ATGAA 9 cut(s) 17, 884, 1160, 1164, 1271, 1283, 1369, 1425, 1567
TspGWI ACGGA 2 cut(s) 338, 620
TspRI CASTG 4 cut(s) 24, 343, 552, 625
Van91I CCANNNNNTGG 1 cut(s) 1553
Vha464I CTTAAG 1 cut(s) 1606
VspI ATTAAT 5 cut(s) 153, 912, 1532, 1601, 1638
XapI RAATTY 6 cut(s) 835, 940, 1028, 1055, 1065, 1147
XspI CTAG 5 cut(s) 263, 468, 644, 1023, 1347
ZraI GACGTC 1 cut(s) 967
ZrmI AGTACT 1 cut(s) 756
Zsp2I ATGCAT 1 cut(s) 130
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.