pycom05g24040

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr5
OG0000158
Physical Location & Seq
Forward (+)
25614964 .. 25616211
1248 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom05g24040.7

Sequence Viewer

Length: 894 bp
ATGATTTGGTGTTCAAATAATTTATTATTAAGAACCGTAAACCGGCAAGAACCGGATCGAAACTGGTGTAGACCGAACCGTAATGTTCTAGTAATAAATTTAAGTGGAACCGCACCGAATCGAACCGTTAATATATTTCGGTTCCGGTTTCAGTTTAGGGGTGGAACCGCACCAAACCGCACCGTGCCCACCCCTATGGATGTTTATTTTAACTATGAAGTGGTTAAAGAAGAGTACAAGAAACGTTCTGTTTATTCCTCCATAATAGATCGATCTGGAAGGCTGGCATATTATGGTAGATTGAATATGGTATTTCAAGTTTTAACCCTTTACTACTCGTTTGGATGTATTTTTAAAATAACTAAAAACACTTTTAGAGAAAAAAATTTTGAGTTCCAAAAGCACTTAAAGTGTTTTCTGCAAGAAACACCAATTATGTGCTTCTTCCAGGAAGCATTTAACATTTTAAAAGCACATCCAAACGAGCTATTAGCACTTGCCAAAACAATTAAACATGTAATATCACTTAGCATTTACATTTTTCATTTACAGTTGGTAGCCACAAATCAACTGACTCAACTTTATATCAATATTGGAGCCTTAAAAGTTTTATATATTCTGAAACTTAAGTATTACACAAACACACACATATATACATATCACTTCATGAACATAATACATGTAAATACAAAAAAAATTTACAATTTTTTGTATCTGGGCTGTATTGATGAAATATTTTTTTATCCTGTCATTAGTTTTTTTTTTCCAACAGAATTTTACAATCGGTTGAATTCTTTTCAAATATGCATAATTTCTTTGTGCGGTTTATCTTTTAGTTTCTTGGTCAAGCAAATTTATCTGTCTTTTTTCTCAGATTATTCTACTCGAGATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

298

Amino Acids

35.39

Weight (kDa)

9.54

Isoelectric Point (pI)

30.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000158)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g10163
malus_domestica MD04G1068000.v1.1 MD05G1130900.v1.1 MD06G1153600.v1.1 MD10G1255900.v1.1 MD10G1282000.v1.1 MD13G1075400.v1.1 MD13G1192400.v1.1
pyrus_communis pycom01g00130 pycom01g00390 pycom01g00700 pycom01g00720 pycom01g00750 pycom01g00850 pycom01g00870 pycom01g00910 pycom01g01250 pycom01g01560 pycom01g01680 pycom01g01860 pycom01g01900 pycom01g01910 pycom01g02200 pycom01g02260 pycom01g02270 pycom01g02280 pycom01g02330 pycom01g02480 pycom01g02720 pycom01g02730 pycom01g02750 pycom01g02770 pycom01g02780 pycom01g02860 pycom01g02910 pycom01g03540 pycom01g04090 pycom01g04100 pycom01g04150 pycom01g04250 pycom01g04430 pycom01g11810 pycom01g11860 pycom01g11940 pycom01g21380 pycom02g06650 pycom02g08490 pycom02g08600 pycom02g18230 pycom02g18450 pycom02g18800 pycom02g19150 pycom02g20740 pycom02g21340 pycom02g26210 pycom03g12060 pycom03g19060 pycom03g19100 pycom03g19120 pycom04g06890 pycom04g08960 pycom05g01790 pycom05g07910 pycom05g08080 pycom05g08100 pycom05g08570 pycom05g21500 pycom05g22400 pycom05g22510 pycom05g22620 pycom05g23020 pycom05g23720 pycom05g23890 pycom05g24040 pycom07g12080 pycom08g07930 pycom08g11940 pycom09g12120 pycom10g03890 pycom10g23360 pycom10g28250 pycom11g02850 pycom11g14370 pycom11g14400 pycom11g21840 pycom11g21860 pycom11g21980 pycom11g23580 pycom11g23650 pycom11g24050 pycom11g25610 pycom12424g00060 pycom1256g00130 pycom12661g00030 pycom12g09520 pycom12g09530 pycom12g09660 pycom12g09730 pycom12g11210 pycom12g16710 pycom12g16740 pycom12g16750 pycom13g08800 pycom13g18580 pycom13g18670 pycom13g18770 pycom13g22900 pycom13g23050 pycom13g23160 pycom13g23480 pycom13g23610 pycom13g23660 pycom13g23790 pycom13g23840 pycom13g24010 pycom13g24140 pycom13g24210 pycom13g24300 pycom13g24310 pycom13g24480 pycom13g24520 pycom13g24570 pycom13g24730 pycom13g24760 pycom13g24820 pycom13g25010 pycom13g25020 pycom13g25270 pycom13g25620 pycom13g25670 pycom13g25760 pycom13g25800 pycom13g25900 pycom13g26620 pycom13g26640 pycom13g26670 pycom13g26940 pycom13g27040 pycom13g27130 pycom13g27530 pycom13g27770 pycom13g27830 pycom13g27920 pycom13g27940 pycom13g28100 pycom13g28420 pycom13g28430 pycom13g28460 pycom13g28520 pycom13g29160 pycom14g05380 pycom15g03480 pycom15g04370 pycom15g27500 pycom16g13590 pycom16g13610 pycom16g13630 pycom16g14390 pycom16g18310 pycom17g01940 pycom17g04000 pycom17g16100 pycom17g16220 pycom17g16230 pycom17g16340 pycom17g16430 pycom17g16460 pycom17g16740 pycom17g16960 pycom17g17020 pycom17g17090 pycom17g17100 pycom17g17170 pycom17g17430 pycom17g17850 pycom17g18230 pycom17g18250 pycom17g18380 pycom17g21170 pycom17g21330 pycom520g00150 pycom520g00160 pycom808g00030 pycom808g00160 pycom808g00250 pycom808g00290
rosa_chinensis RchiOBHm_Chr5g0054451

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 70
AciI CCGC 4 cut(s) 111, 168, 178, 822
AclI AACGTT 1 cut(s) 244
AclWI GGATC 1 cut(s) 63
AcsI RAATTY 6 cut(s) 97, 385, 696, 773, 790, 852
AfaI GTAC 1 cut(s) 236
AfiI CCNNNNNNNGG 1 cut(s) 42
AflII CTTAAG 1 cut(s) 626
AflIII ACRYGT 2 cut(s) 514, 679
AgsI TTSAA 5 cut(s) 15, 304, 317, 790, 800
AjnI CCWGG 1 cut(s) 447
AluBI AGCT 1 cut(s) 487
AluI AGCT 1 cut(s) 487
AlwI GGATC 1 cut(s) 63
Ama87I CYCGRG 1 cut(s) 885
ApoI RAATTY 6 cut(s) 97, 385, 696, 773, 790, 852
AvaI CYCGRG 1 cut(s) 885
BaeGI GKGCMC 1 cut(s) 189
BciT130I CCWGG 1 cut(s) 449
BfaI CTAG 1 cut(s) 89
BfrI CTTAAG 1 cut(s) 626
Bme1390I CCNGG 1 cut(s) 449
BmeT110I CYCGRG 1 cut(s) 885
BmiI GGNNCC 4 cut(s) 109, 143, 166, 598
BmrFI CCNGG 1 cut(s) 449
Bsa29I ATCGAT 1 cut(s) 271
BsaWI WCCGGW 2 cut(s) 52, 144
Bsc4I CCNNNNNNNGG 1 cut(s) 42
Bse118I RCCGGY 1 cut(s) 42
Bse1I ACTGG 1 cut(s) 68
BseBI CCWGG 1 cut(s) 449
BseCI ATCGAT 1 cut(s) 271
BseGI GGATG 3 cut(s) 205, 350, 475
BseLI CCNNNNNNNGG 1 cut(s) 42
BseMII CTCAG 1 cut(s) 885
BseNI ACTGG 1 cut(s) 68
BseSI GKGCMC 1 cut(s) 189
BshVI ATCGAT 1 cut(s) 271
BsiHKCI CYCGRG 1 cut(s) 885
BsiSI CCGG 3 cut(s) 43, 53, 145
BslI CCNNNNNNNGG 1 cut(s) 42
BsoBI CYCGRG 1 cut(s) 885
Bsp1286I GDGCHC 1 cut(s) 189
Bsp143I GATC 3 cut(s) 55, 268, 272
BspACI CCGC 4 cut(s) 111, 168, 178, 822
BspCNI CTCAG 1 cut(s) 884
BspDI ATCGAT 1 cut(s) 271
BspHI TCATGA 1 cut(s) 666
BspLI GGNNCC 4 cut(s) 109, 143, 166, 598
BspPI GGATC 1 cut(s) 63
BspTI CTTAAG 1 cut(s) 626
BsrFI RCCGGY 1 cut(s) 42
BsrI ACTGG 1 cut(s) 68
BssAI RCCGGY 1 cut(s) 42
BssMI GATC 3 cut(s) 55, 268, 272
Bst2UI CCWGG 1 cut(s) 449
Bst4CI ACNGT 5 cut(s) 37, 80, 127, 184, 552
Bst6I CTCTTC 1 cut(s) 225
BstAFI CTTAAG 1 cut(s) 626
BstC8I GCNNGC 1 cut(s) 285
BstDEI CTNAG 2 cut(s) 527, 871
BstF5I GGATG 3 cut(s) 205, 350, 475
BstKTI GATC 3 cut(s) 58, 271, 275
BstMBI GATC 3 cut(s) 55, 268, 272
BstNI CCWGG 1 cut(s) 449
BstNSI RCATGY 2 cut(s) 518, 683
BstSCI CCNGG 1 cut(s) 447
BstSLI GKGCMC 1 cut(s) 189
BstXI CCANNNNNNTGG 1 cut(s) 196
Bsu15I ATCGAT 1 cut(s) 271
BsuTUI ATCGAT 1 cut(s) 271
BtsCI GGATG 3 cut(s) 205, 350, 475
Cac8I GCNNGC 1 cut(s) 285
CciI TCATGA 1 cut(s) 666
Cfr10I RCCGGY 1 cut(s) 42
ClaI ATCGAT 1 cut(s) 271
Csp6I GTAC 1 cut(s) 235
CviAII CATG 3 cut(s) 515, 667, 680
CviJI RGCY 5 cut(s) 283, 487, 560, 599, 720
CviKI_1 RGCY 5 cut(s) 283, 487, 560, 599, 720
CviQI GTAC 1 cut(s) 235
DdeI CTNAG 2 cut(s) 527, 871
DpnI GATC 3 cut(s) 57, 270, 274
DpnII GATC 3 cut(s) 55, 268, 272
DraI TTTAAA 2 cut(s) 355, 468
Eam1104I CTCTTC 1 cut(s) 225
EarI CTCTTC 1 cut(s) 225
Eco88I CYCGRG 1 cut(s) 885
EcoRI GAATTC 1 cut(s) 790
EcoRII CCWGG 1 cut(s) 447
EcoT22I ATGCAT 1 cut(s) 809
FaeI CATG 3 cut(s) 518, 670, 683
FatI CATG 3 cut(s) 514, 666, 679
FblI GTMKAC 1 cut(s) 70
FokI GGATG 3 cut(s) 212, 357, 462
FspBI CTAG 1 cut(s) 89
HapII CCGG 3 cut(s) 43, 53, 145
Hin1II CATG 3 cut(s) 518, 670, 683
HinfI GANTC 2 cut(s) 118, 574
HpaII CCGG 3 cut(s) 43, 53, 145
Hpy166II GTNNAC 2 cut(s) 40, 71
Hpy188I TCNGA 2 cut(s) 621, 874
Hpy188III TCNNGA 3 cut(s) 276, 667, 887
Hpy8I GTNNAC 2 cut(s) 40, 71
HpyAV CCTTC 1 cut(s) 273
HpyCH4III ACNGT 5 cut(s) 37, 80, 127, 184, 552
HpyCH4IV ACGT 1 cut(s) 244
HpyCH4V TGCA 2 cut(s) 421, 807
HpyF3I CTNAG 2 cut(s) 527, 871
HpySE526I ACGT 1 cut(s) 244
Hsp92II CATG 3 cut(s) 518, 670, 683
Kzo9I GATC 3 cut(s) 55, 268, 272
LmnI GCTCC 1 cut(s) 596
MaeI CTAG 1 cut(s) 89
MaeII ACGT 1 cut(s) 244
MalI GATC 3 cut(s) 57, 270, 274
MboI GATC 3 cut(s) 55, 268, 272
MboII GAAGA 2 cut(s) 242, 436
MhlI GDGCHC 1 cut(s) 189
MlyI GAGTC 1 cut(s) 568
MmeI TCCRAC 1 cut(s) 791
MnlI CCTC 1 cut(s) 268
Mph1103I ATGCAT 1 cut(s) 809
MslI CAYNNNNRTG 1 cut(s) 194
MspCI CTTAAG 1 cut(s) 626
MspI CCGG 3 cut(s) 43, 53, 145
MspR9I CCNGG 1 cut(s) 449
MvaI CCWGG 1 cut(s) 449
NdeII GATC 3 cut(s) 55, 268, 272
NlaIII CATG 3 cut(s) 518, 670, 683
NlaIV GGNNCC 4 cut(s) 109, 143, 166, 598
NsiI ATGCAT 1 cut(s) 809
NspI RCATGY 2 cut(s) 518, 683
PaeR7I CTCGAG 1 cut(s) 885
PagI TCATGA 1 cut(s) 666
PciI ACATGT 2 cut(s) 514, 679
PfeI GAWTC 1 cut(s) 118
PfoI TCCNGGA 1 cut(s) 447
PleI GAGTC 1 cut(s) 568
PpsI GAGTC 1 cut(s) 568
PscI ACATGT 2 cut(s) 514, 679
Psp1406I AACGTT 1 cut(s) 244
Psp6I CCWGG 1 cut(s) 447
PspGI CCWGG 1 cut(s) 447
PspN4I GGNNCC 4 cut(s) 109, 143, 166, 598
RsaI GTAC 1 cut(s) 236
RsaNI GTAC 1 cut(s) 235
RseI CAYNNNNRTG 1 cut(s) 194
Sau3AI GATC 3 cut(s) 55, 268, 272
SchI GAGTC 1 cut(s) 568
ScrFI CCNGG 1 cut(s) 449
SduI GDGCHC 1 cut(s) 189
SetI ASST 2 cut(s) 247, 489
Sfr274I CTCGAG 1 cut(s) 885
SlaI CTCGAG 1 cut(s) 885
SmiMI CAYNNNNRTG 1 cut(s) 194
SmlI CTYRAG 2 cut(s) 626, 885
SmoI CTYRAG 2 cut(s) 626, 885
SsiI CCGC 4 cut(s) 111, 168, 178, 822
SspI AATATT 2 cut(s) 592, 735
SspMI CTAG 1 cut(s) 89
StyD4I CCNGG 1 cut(s) 447
TaaI ACNGT 5 cut(s) 37, 80, 127, 184, 552
TaiI ACGT 1 cut(s) 247
TaqI TCGA 4 cut(s) 58, 121, 271, 886
TaqII GACCGA 1 cut(s) 88
TatI WGTACW 1 cut(s) 234
TfiI GAWTC 1 cut(s) 118
TspDTI ATGAA 5 cut(s) 231, 533, 655, 683, 744
Vha464I CTTAAG 1 cut(s) 626
XapI RAATTY 6 cut(s) 97, 385, 696, 773, 790, 852
XceI RCATGY 2 cut(s) 518, 683
XhoI CTCGAG 1 cut(s) 885
XmiI GTMKAC 1 cut(s) 70
XspI CTAG 1 cut(s) 89
Zsp2I ATGCAT 1 cut(s) 809
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.