pycom08g07930

Mitogen-activated protein kinase kinase kinase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr8
OG0000158
Physical Location & Seq
Forward (+)
6393824 .. 6394431
608 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom08g07930.1

Sequence Viewer

Length: 258 bp
ATGTCACAATCCACCCCCTTTAGGGGCCCGACGTCCTCGTCGGCACACACGCGACCAGGGTTAGGCTCTGATACCAATTACCAAATTGTCACATCCCAGCCTGGGGCGGATCACTTCCCGGGCCCGCTCCACCACCGTAGCACGATATTGTCCGCTTTGGGCTTACCATTCCCTCACGGTTTTGTTTTTTGGGAACTCACGAGCAACTTCCCAGTGGGTCACCCATCATGGGATTGCTCTAGCCCCCCTCTCGCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Pkinase

Protein Analysis

86

Amino Acids

9.11

Weight (kDa)

6.56

Isoelectric Point (pI)

53.12

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000158)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g10163
malus_domestica MD04G1068000.v1.1 MD05G1130900.v1.1 MD06G1153600.v1.1 MD10G1255900.v1.1 MD10G1282000.v1.1 MD13G1075400.v1.1 MD13G1192400.v1.1
pyrus_communis pycom01g00130 pycom01g00390 pycom01g00700 pycom01g00720 pycom01g00750 pycom01g00850 pycom01g00870 pycom01g00910 pycom01g01250 pycom01g01560 pycom01g01680 pycom01g01860 pycom01g01900 pycom01g01910 pycom01g02200 pycom01g02260 pycom01g02270 pycom01g02280 pycom01g02330 pycom01g02480 pycom01g02720 pycom01g02730 pycom01g02750 pycom01g02770 pycom01g02780 pycom01g02860 pycom01g02910 pycom01g03540 pycom01g04090 pycom01g04100 pycom01g04150 pycom01g04250 pycom01g04430 pycom01g11810 pycom01g11860 pycom01g11940 pycom01g21380 pycom02g06650 pycom02g08490 pycom02g08600 pycom02g18230 pycom02g18450 pycom02g18800 pycom02g19150 pycom02g20740 pycom02g21340 pycom02g26210 pycom03g12060 pycom03g19060 pycom03g19100 pycom03g19120 pycom04g06890 pycom04g08960 pycom05g01790 pycom05g07910 pycom05g08080 pycom05g08100 pycom05g08570 pycom05g21500 pycom05g22400 pycom05g22510 pycom05g22620 pycom05g23020 pycom05g23720 pycom05g23890 pycom05g24040 pycom07g12080 pycom08g07930 pycom08g11940 pycom09g12120 pycom10g03890 pycom10g23360 pycom10g28250 pycom11g02850 pycom11g14370 pycom11g14400 pycom11g21840 pycom11g21860 pycom11g21980 pycom11g23580 pycom11g23650 pycom11g24050 pycom11g25610 pycom12424g00060 pycom1256g00130 pycom12661g00030 pycom12g09520 pycom12g09530 pycom12g09660 pycom12g09730 pycom12g11210 pycom12g16710 pycom12g16740 pycom12g16750 pycom13g08800 pycom13g18580 pycom13g18670 pycom13g18770 pycom13g22900 pycom13g23050 pycom13g23160 pycom13g23480 pycom13g23610 pycom13g23660 pycom13g23790 pycom13g23840 pycom13g24010 pycom13g24140 pycom13g24210 pycom13g24300 pycom13g24310 pycom13g24480 pycom13g24520 pycom13g24570 pycom13g24730 pycom13g24760 pycom13g24820 pycom13g25010 pycom13g25020 pycom13g25270 pycom13g25620 pycom13g25670 pycom13g25760 pycom13g25800 pycom13g25900 pycom13g26620 pycom13g26640 pycom13g26670 pycom13g26940 pycom13g27040 pycom13g27130 pycom13g27530 pycom13g27770 pycom13g27830 pycom13g27920 pycom13g27940 pycom13g28100 pycom13g28420 pycom13g28430 pycom13g28460 pycom13g28520 pycom13g29160 pycom14g05380 pycom15g03480 pycom15g04370 pycom15g27500 pycom16g13590 pycom16g13610 pycom16g13630 pycom16g14390 pycom16g18310 pycom17g01940 pycom17g04000 pycom17g16100 pycom17g16220 pycom17g16230 pycom17g16340 pycom17g16430 pycom17g16460 pycom17g16740 pycom17g16960 pycom17g17020 pycom17g17090 pycom17g17100 pycom17g17170 pycom17g17430 pycom17g17850 pycom17g18230 pycom17g18250 pycom17g18380 pycom17g21170 pycom17g21330 pycom520g00150 pycom520g00160 pycom808g00030 pycom808g00160 pycom808g00250 pycom808g00290
rosa_chinensis RchiOBHm_Chr5g0054451

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 37
AatII GACGTC 1 cut(s) 35
AccBSI CCGCTC 1 cut(s) 127
AccII CGCG 1 cut(s) 52
AciI CCGC 3 cut(s) 107, 125, 153
AclWI GGATC 1 cut(s) 117
AcyI GRCGYC 1 cut(s) 32
AfiI CCNNNNNNNGG 7 cut(s) 21, 22, 23, 62, 102, 103, 229
AjnI CCWGG 2 cut(s) 55, 100
AlwI GGATC 1 cut(s) 117
Ama87I CYCGRG 1 cut(s) 118
AoxI GGCC 2 cut(s) 25, 121
ApaI GGGCCC 2 cut(s) 29, 125
AspS9I GGNCC 4 cut(s) 25, 26, 121, 122
AsuC2I CCSGG 2 cut(s) 119, 120
AsuHPI GGTGA 1 cut(s) 212
AvaI CYCGRG 1 cut(s) 118
BaeGI GKGCMC 2 cut(s) 29, 125
BanII GRGCYC 2 cut(s) 29, 125
BauI CACGAG 1 cut(s) 199
BccI CCATC 1 cut(s) 232
BciT130I CCWGG 2 cut(s) 57, 102
BcnI CCSGG 2 cut(s) 119, 120
BfaI CTAG 1 cut(s) 240
Bme1390I CCNGG 4 cut(s) 57, 102, 119, 120
BmeT110I CYCGRG 1 cut(s) 118
BmgT120I GGNCC 4 cut(s) 25, 26, 121, 122
BmiI GGNNCC 3 cut(s) 26, 27, 123
BmrFI CCNGG 4 cut(s) 57, 102, 119, 120
BmrI ACTGGG 1 cut(s) 206
BmuI ACTGGG 1 cut(s) 206
BpuMI CCSGG 2 cut(s) 119, 120
BsaHI GRCGYC 1 cut(s) 32
BsaJI CCNNGG 3 cut(s) 56, 101, 118
Bsc4I CCNNNNNNNGG 7 cut(s) 21, 22, 23, 62, 102, 103, 229
Bse1I ACTGG 1 cut(s) 212
BseBI CCWGG 2 cut(s) 57, 102
BseDI CCNNGG 3 cut(s) 56, 101, 118
BseGI GGATG 1 cut(s) 92
BseLI CCNNNNNNNGG 7 cut(s) 21, 22, 23, 62, 102, 103, 229
BseNI ACTGG 1 cut(s) 212
BseSI GKGCMC 2 cut(s) 29, 125
BseYI CCCAGC 1 cut(s) 96
Bsh1236I CGCG 1 cut(s) 52
BshFI GGCC 2 cut(s) 27, 123
BsiHKCI CYCGRG 1 cut(s) 118
BsiSI CCGG 1 cut(s) 119
BslI CCNNNNNNNGG 7 cut(s) 21, 22, 23, 62, 102, 103, 229
BsnI GGCC 2 cut(s) 27, 123
BsoBI CYCGRG 1 cut(s) 118
Bsp120I GGGCCC 2 cut(s) 25, 121
Bsp1286I GDGCHC 2 cut(s) 29, 125
Bsp143I GATC 1 cut(s) 109
BspACI CCGC 3 cut(s) 107, 125, 153
BspANI GGCC 2 cut(s) 27, 123
BspFNI CGCG 1 cut(s) 52
BspLI GGNNCC 3 cut(s) 26, 27, 123
BspPI GGATC 1 cut(s) 117
BsrBI CCGCTC 1 cut(s) 127
BsrI ACTGG 1 cut(s) 212
BssECI CCNNGG 3 cut(s) 56, 101, 118
BssMI GATC 1 cut(s) 109
BssNI GRCGYC 1 cut(s) 32
BssSI CACGAG 1 cut(s) 199
Bst2BI CACGAG 1 cut(s) 199
Bst2UI CCWGG 2 cut(s) 57, 102
Bst4CI ACNGT 2 cut(s) 137, 179
BstACI GRCGYC 1 cut(s) 32
BstC8I GCNNGC 1 cut(s) 125
BstEII GGTNACC 1 cut(s) 218
BstF5I GGATG 1 cut(s) 92
BstFNI CGCG 1 cut(s) 52
BstKTI GATC 1 cut(s) 112
BstMBI GATC 1 cut(s) 109
BstNI CCWGG 2 cut(s) 57, 102
BstPI GGTNACC 1 cut(s) 218
BstSCI CCNGG 4 cut(s) 55, 100, 117, 118
BstSLI GKGCMC 2 cut(s) 29, 125
BstUI CGCG 1 cut(s) 52
BsuRI GGCC 2 cut(s) 27, 123
BtsCI GGATG 1 cut(s) 92
BtsIMutI CAGTG 1 cut(s) 219
Cac8I GCNNGC 1 cut(s) 125
Cfr13I GGNCC 4 cut(s) 25, 26, 121, 122
Cfr9I CCCGGG 1 cut(s) 118
CviAII CATG 1 cut(s) 228
CviJI RGCY 6 cut(s) 27, 66, 100, 123, 162, 243
CviKI_1 RGCY 6 cut(s) 27, 66, 100, 123, 162, 243
DpnI GATC 1 cut(s) 111
DpnII GATC 1 cut(s) 109
DrdI GACNNNNNNGTC 1 cut(s) 37
DseDI GACNNNNNNGTC 1 cut(s) 37
EciI GGCGGA 1 cut(s) 122
Eco24I GRGCYC 2 cut(s) 29, 125
Eco88I CYCGRG 1 cut(s) 118
Eco91I GGTNACC 1 cut(s) 218
EcoO109I RGGNCCY 1 cut(s) 25
EcoO65I GGTNACC 1 cut(s) 218
EcoRII CCWGG 2 cut(s) 55, 100
EcoT38I GRGCYC 2 cut(s) 29, 125
FaeI CATG 1 cut(s) 231
FaiI YATR 1 cut(s) 229
FatI CATG 1 cut(s) 227
FauI CCCGC 1 cut(s) 132
FokI GGATG 1 cut(s) 79
FriOI GRGCYC 2 cut(s) 29, 125
FspBI CTAG 1 cut(s) 240
GsaI CCCAGC 1 cut(s) 100
HaeIII GGCC 2 cut(s) 27, 123
HapII CCGG 1 cut(s) 119
Hin1I GRCGYC 1 cut(s) 32
Hin1II CATG 1 cut(s) 231
HpaII CCGG 1 cut(s) 119
HphI GGTGA 1 cut(s) 212
Hpy188I TCNGA 1 cut(s) 70
Hpy188III TCNNGA 1 cut(s) 199
Hpy99I CGWCG 2 cut(s) 34, 43
HpyCH4III ACNGT 2 cut(s) 137, 179
HpyCH4IV ACGT 1 cut(s) 32
HpySE526I ACGT 1 cut(s) 32
Hsp92I GRCGYC 1 cut(s) 32
Hsp92II CATG 1 cut(s) 231
Kzo9I GATC 1 cut(s) 109
LmnI GCTCC 1 cut(s) 132
LpnPI CCDG 7 cut(s) 42, 69, 87, 110, 114, 132, 225
MaeI CTAG 1 cut(s) 240
MaeII ACGT 1 cut(s) 32
MaeIII GTNAC 3 cut(s) 3, 88, 218
MalI GATC 1 cut(s) 111
MbiI CCGCTC 1 cut(s) 127
MboI GATC 1 cut(s) 109
MhlI GDGCHC 2 cut(s) 29, 125
MluCI AATT 2 cut(s) 76, 84
MnlI CCTC 3 cut(s) 46, 183, 258
MseI TTAA 1 cut(s) 256
MspI CCGG 1 cut(s) 119
MspR9I CCNGG 4 cut(s) 57, 102, 119, 120
MvaI CCWGG 2 cut(s) 57, 102
MvnI CGCG 1 cut(s) 52
NciI CCSGG 2 cut(s) 119, 120
NdeII GATC 1 cut(s) 109
NlaIII CATG 1 cut(s) 231
NlaIV GGNNCC 3 cut(s) 26, 27, 123
NmuCI GTSAC 3 cut(s) 3, 88, 218
Psp6I CCWGG 2 cut(s) 55, 100
PspEI GGTNACC 1 cut(s) 218
PspFI CCCAGC 1 cut(s) 96
PspGI CCWGG 2 cut(s) 55, 100
PspN4I GGNNCC 3 cut(s) 26, 27, 123
PspOMI GGGCCC 2 cut(s) 25, 121
PspPI GGNCC 4 cut(s) 25, 26, 121, 122
SaqAI TTAA 1 cut(s) 256
Sau3AI GATC 1 cut(s) 109
Sau96I GGNCC 4 cut(s) 25, 26, 121, 122
ScrFI CCNGG 4 cut(s) 57, 102, 119, 120
SduI GDGCHC 2 cut(s) 29, 125
SetI ASST 1 cut(s) 35
SmaI CCCGGG 1 cut(s) 120
Sse9I AATT 2 cut(s) 76, 84
SsiI CCGC 3 cut(s) 107, 125, 153
SspMI CTAG 1 cut(s) 240
StyD4I CCNGG 4 cut(s) 55, 100, 117, 118
TaaI ACNGT 2 cut(s) 137, 179
TaiI ACGT 1 cut(s) 35
TasI AATT 2 cut(s) 76, 84
Tru1I TTAA 1 cut(s) 256
Tru9I TTAA 1 cut(s) 256
TscAI CASTG 1 cut(s) 219
TseFI GTSAC 3 cut(s) 3, 88, 218
Tsp45I GTSAC 3 cut(s) 3, 88, 218
TspMI CCCGGG 1 cut(s) 118
TspRI CASTG 1 cut(s) 219
XmaI CCCGGG 1 cut(s) 118
XspI CTAG 1 cut(s) 240
ZraI GACGTC 1 cut(s) 33
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.