pycom16g13630

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr16
OG0000158
Physical Location & Seq
Forward (+)
9748973 .. 9750244
1272 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom16g13630.3

Sequence Viewer

Length: 957 bp
ATGGAATCAATCATTGTCACATCCCGGCCCGAGGCGGATCACTTCCCGGGCCCGCTCCACCACCTTAGCACGATATTGTCCGCTTTGGGCTTACCATTCCCTCACGGTTTTGTTTTTGGGAACTCACGAGCAACTTCCCAGTGGGTCACCCATCATAGGATTGCTCTAGCCCCCTTCTCGCTTAACTTCGGAGTTCCTACGGAACCCGAAGCCAGTGAGCTCCCAAAAGGCCTCGTGCTAGGTAGGGATGAGAATATACATATAAGGATCACACCCCTGGGCAATGTGGGATGTCACAATCATCCTCTTTCTTCTCTCATCTTTCATGATTTTTACATAGCTTTCACAATTTTTTTACATATTCGTTCGGCAATACAGTATCAATTGCAAGCAATAATACAGTATCATGCATTTATATTTGCTCTATTATATTTTTGTGCGTATCAAAAGGGTAAACTGAAACTTAGTATTTGTTCCTTTTTTTTGTTTAGTATTTGTTCCTTTAATGGAGGTATATTATATCATATTTCTATTCTAATGTTATGCCATGAAGGTTCAGCATTTTTCTTCCTATACAATAGAAAGCATTTTTCTTCCTATACAATAGGTAGTTTATTTTTGTTTTGCAGTAGATTACATATGTTTTGTTGGTATAAAGTATTTTTCTTCCTATACAATAGTAGGTGGTTACTAGATAATATTTTAACAAAAATTAAAGAATTTAAATATTTTTATCTAAAAGGGCAAAATTGGTATAAAAATATCTTCTCCCAGAGCATGAAAATTTCCTGTAAGCCTAACATTTCAAGCAATCTTCCTCCTAAATATAAAACATACCATGTACCTTTCAGAGCAAGAAGATTTCATGTGACTACAAGTCATCCAGTTTGTCATTTTTCAAAAGGGACCATCGGATTCCCTCCCCTTGTTGAAAAGTCCACATTAGGATACAGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

319

Amino Acids

36.75

Weight (kDa)

9.51

Isoelectric Point (pI)

46.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000158)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g10163
malus_domestica MD04G1068000.v1.1 MD05G1130900.v1.1 MD06G1153600.v1.1 MD10G1255900.v1.1 MD10G1282000.v1.1 MD13G1075400.v1.1 MD13G1192400.v1.1
pyrus_communis pycom01g00130 pycom01g00390 pycom01g00700 pycom01g00720 pycom01g00750 pycom01g00850 pycom01g00870 pycom01g00910 pycom01g01250 pycom01g01560 pycom01g01680 pycom01g01860 pycom01g01900 pycom01g01910 pycom01g02200 pycom01g02260 pycom01g02270 pycom01g02280 pycom01g02330 pycom01g02480 pycom01g02720 pycom01g02730 pycom01g02750 pycom01g02770 pycom01g02780 pycom01g02860 pycom01g02910 pycom01g03540 pycom01g04090 pycom01g04100 pycom01g04150 pycom01g04250 pycom01g04430 pycom01g11810 pycom01g11860 pycom01g11940 pycom01g21380 pycom02g06650 pycom02g08490 pycom02g08600 pycom02g18230 pycom02g18450 pycom02g18800 pycom02g19150 pycom02g20740 pycom02g21340 pycom02g26210 pycom03g12060 pycom03g19060 pycom03g19100 pycom03g19120 pycom04g06890 pycom04g08960 pycom05g01790 pycom05g07910 pycom05g08080 pycom05g08100 pycom05g08570 pycom05g21500 pycom05g22400 pycom05g22510 pycom05g22620 pycom05g23020 pycom05g23720 pycom05g23890 pycom05g24040 pycom07g12080 pycom08g07930 pycom08g11940 pycom09g12120 pycom10g03890 pycom10g23360 pycom10g28250 pycom11g02850 pycom11g14370 pycom11g14400 pycom11g21840 pycom11g21860 pycom11g21980 pycom11g23580 pycom11g23650 pycom11g24050 pycom11g25610 pycom12424g00060 pycom1256g00130 pycom12661g00030 pycom12g09520 pycom12g09530 pycom12g09660 pycom12g09730 pycom12g11210 pycom12g16710 pycom12g16740 pycom12g16750 pycom13g08800 pycom13g18580 pycom13g18670 pycom13g18770 pycom13g22900 pycom13g23050 pycom13g23160 pycom13g23480 pycom13g23610 pycom13g23660 pycom13g23790 pycom13g23840 pycom13g24010 pycom13g24140 pycom13g24210 pycom13g24300 pycom13g24310 pycom13g24480 pycom13g24520 pycom13g24570 pycom13g24730 pycom13g24760 pycom13g24820 pycom13g25010 pycom13g25020 pycom13g25270 pycom13g25620 pycom13g25670 pycom13g25760 pycom13g25800 pycom13g25900 pycom13g26620 pycom13g26640 pycom13g26670 pycom13g26940 pycom13g27040 pycom13g27130 pycom13g27530 pycom13g27770 pycom13g27830 pycom13g27920 pycom13g27940 pycom13g28100 pycom13g28420 pycom13g28430 pycom13g28460 pycom13g28520 pycom13g29160 pycom14g05380 pycom15g03480 pycom15g04370 pycom15g27500 pycom16g13590 pycom16g13610 pycom16g13630 pycom16g14390 pycom16g18310 pycom17g01940 pycom17g04000 pycom17g16100 pycom17g16220 pycom17g16230 pycom17g16340 pycom17g16430 pycom17g16460 pycom17g16740 pycom17g16960 pycom17g17020 pycom17g17090 pycom17g17100 pycom17g17170 pycom17g17430 pycom17g17850 pycom17g18230 pycom17g18250 pycom17g18380 pycom17g21170 pycom17g21330 pycom520g00150 pycom520g00160 pycom808g00030 pycom808g00160 pycom808g00250 pycom808g00290
rosa_chinensis RchiOBHm_Chr5g0054451

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 55
AciI CCGC 3 cut(s) 35, 53, 81
AclWI GGATC 2 cut(s) 45, 275
AcsI RAATTY 2 cut(s) 719, 783
AfaI GTAC 1 cut(s) 843
AfiI CCNNNNNNNGG 2 cut(s) 31, 156
AgsI TTSAA 3 cut(s) 807, 900, 932
AhdI GACNNNNNGTC 1 cut(s) 876
AjnI CCWGG 1 cut(s) 276
AluBI AGCT 2 cut(s) 220, 341
AluI AGCT 2 cut(s) 220, 341
Alw21I GWGCWC 1 cut(s) 222
AlwI GGATC 2 cut(s) 45, 275
Ama87I CYCGRG 2 cut(s) 29, 46
AoxI GGCC 3 cut(s) 26, 49, 229
ApaI GGGCCC 1 cut(s) 53
ApoI RAATTY 2 cut(s) 719, 783
AspS9I GGNCC 4 cut(s) 27, 49, 50, 906
AsuC2I CCSGG 3 cut(s) 25, 47, 48
AsuHPI GGTGA 1 cut(s) 139
AvaI CYCGRG 2 cut(s) 29, 46
AvaII GGWCC 1 cut(s) 906
BaeGI GKGCMC 1 cut(s) 53
BanII GRGCYC 2 cut(s) 53, 222
BauI CACGAG 2 cut(s) 126, 233
Bbv12I GWGCWC 1 cut(s) 222
BccI CCATC 2 cut(s) 159, 917
BciT130I CCWGG 1 cut(s) 278
BciVI GTATCC 1 cut(s) 941
BcnI CCSGG 3 cut(s) 25, 47, 48
BfaI CTAG 3 cut(s) 167, 239, 692
BfuI GTATCC 1 cut(s) 941
Bme1390I CCNGG 4 cut(s) 25, 47, 48, 278
Bme18I GGWCC 1 cut(s) 906
BmeRI GACNNNNNGTC 1 cut(s) 876
BmeT110I CYCGRG 2 cut(s) 29, 46
BmgT120I GGNCC 4 cut(s) 27, 49, 50, 906
BmiI GGNNCC 3 cut(s) 51, 204, 907
BmrFI CCNGG 4 cut(s) 25, 47, 48, 278
BmrI ACTGGG 1 cut(s) 133
BmuI ACTGGG 1 cut(s) 133
Bpu10I CCTNAGC 1 cut(s) 65
BpuMI CCSGG 3 cut(s) 25, 47, 48
BsaJI CCNNGG 4 cut(s) 30, 46, 276, 277
Bsc4I CCNNNNNNNGG 2 cut(s) 31, 156
Bse1I ACTGG 3 cut(s) 139, 213, 884
Bse3DI GCAATG 1 cut(s) 289
BseBI CCWGG 1 cut(s) 278
BseDI CCNNGG 4 cut(s) 30, 46, 276, 277
BseGI GGATG 5 cut(s) 20, 253, 296, 301, 880
BseLI CCNNNNNNNGG 2 cut(s) 31, 156
BseMI GCAATG 1 cut(s) 289
BseNI ACTGG 3 cut(s) 139, 213, 884
BseSI GKGCMC 1 cut(s) 53
BshFI GGCC 3 cut(s) 28, 51, 231
BsiHKAI GWGCWC 1 cut(s) 222
BsiHKCI CYCGRG 2 cut(s) 29, 46
BsiSI CCGG 2 cut(s) 25, 47
BslFI GGGAC 1 cut(s) 919
BslI CCNNNNNNNGG 2 cut(s) 31, 156
BsmFI GGGAC 1 cut(s) 919
BsnI GGCC 3 cut(s) 28, 51, 231
BsoBI CYCGRG 2 cut(s) 29, 46
Bsp120I GGGCCC 1 cut(s) 49
Bsp1286I GDGCHC 2 cut(s) 53, 222
Bsp143I GATC 2 cut(s) 37, 267
BspACI CCGC 3 cut(s) 35, 53, 81
BspANI GGCC 3 cut(s) 28, 51, 231
BspHI TCATGA 1 cut(s) 325
BspLI GGNNCC 3 cut(s) 51, 204, 907
BspPI GGATC 2 cut(s) 45, 275
BsrBI CCGCTC 1 cut(s) 55
BsrDI GCAATG 1 cut(s) 289
BsrI ACTGG 3 cut(s) 139, 213, 884
BssECI CCNNGG 4 cut(s) 30, 46, 276, 277
BssMI GATC 2 cut(s) 37, 267
BssSI CACGAG 2 cut(s) 126, 233
Bst2BI CACGAG 2 cut(s) 126, 233
Bst2UI CCWGG 1 cut(s) 278
Bst4CI ACNGT 4 cut(s) 107, 378, 402, 953
BstC8I GCNNGC 2 cut(s) 53, 390
BstDEI CTNAG 2 cut(s) 65, 464
BstEII GGTNACC 1 cut(s) 145
BstF5I GGATG 5 cut(s) 20, 253, 296, 301, 880
BstKTI GATC 2 cut(s) 40, 270
BstMBI GATC 2 cut(s) 37, 267
BstNI CCWGG 1 cut(s) 278
BstPI GGTNACC 1 cut(s) 145
BstSCI CCNGG 4 cut(s) 23, 45, 46, 276
BstSLI GKGCMC 1 cut(s) 53
BsuI GTATCC 1 cut(s) 941
BsuRI GGCC 3 cut(s) 28, 51, 231
BtsCI GGATG 5 cut(s) 20, 253, 296, 301, 880
BtsIMutI CAGTG 2 cut(s) 146, 220
Cac8I GCNNGC 2 cut(s) 53, 390
CciI TCATGA 1 cut(s) 325
Cfr13I GGNCC 4 cut(s) 27, 49, 50, 906
Cfr9I CCCGGG 1 cut(s) 46
Csp6I GTAC 1 cut(s) 842
CviAII CATG 6 cut(s) 326, 407, 548, 778, 839, 866
CviJI RGCY 9 cut(s) 28, 51, 90, 170, 212, 220, 231, 341, 796
CviKI_1 RGCY 9 cut(s) 28, 51, 90, 170, 212, 220, 231, 341, 796
CviQI GTAC 1 cut(s) 842
DdeI CTNAG 2 cut(s) 65, 464
DpnI GATC 2 cut(s) 39, 269
DpnII GATC 2 cut(s) 37, 267
DraI TTTAAA 1 cut(s) 724
DriI GACNNNNNGTC 1 cut(s) 876
Eam1105I GACNNNNNGTC 1 cut(s) 876
EciI GGCGGA 1 cut(s) 50
Ecl136II GAGCTC 1 cut(s) 220
Eco147I AGGCCT 1 cut(s) 231
Eco24I GRGCYC 2 cut(s) 53, 222
Eco47I GGWCC 1 cut(s) 906
Eco53kI GAGCTC 1 cut(s) 220
Eco88I CYCGRG 2 cut(s) 29, 46
Eco91I GGTNACC 1 cut(s) 145
EcoICRI GAGCTC 1 cut(s) 220
EcoO65I GGTNACC 1 cut(s) 145
EcoRII CCWGG 1 cut(s) 276
EcoT22I ATGCAT 1 cut(s) 412
EcoT38I GRGCYC 2 cut(s) 53, 222
FaeI CATG 6 cut(s) 329, 410, 551, 781, 842, 869
FaqI GGGAC 1 cut(s) 919
FatI CATG 6 cut(s) 325, 406, 547, 777, 838, 865
FauI CCCGC 1 cut(s) 60
FauNDI CATATG 1 cut(s) 639
FokI GGATG 5 cut(s) 7, 260, 288, 303, 867
FriOI GRGCYC 2 cut(s) 53, 222
FspBI CTAG 3 cut(s) 167, 239, 692
HaeIII GGCC 3 cut(s) 28, 51, 231
HapII CCGG 2 cut(s) 25, 47
Hin1II CATG 6 cut(s) 329, 410, 551, 781, 842, 869
HinfI GANTC 2 cut(s) 5, 915
HpaII CCGG 2 cut(s) 25, 47
HphI GGTGA 1 cut(s) 139
Hpy166II GTNNAC 2 cut(s) 455, 939
Hpy188I TCNGA 3 cut(s) 191, 851, 914
Hpy188III TCNNGA 2 cut(s) 126, 326
Hpy8I GTNNAC 2 cut(s) 455, 939
HpyAV CCTTC 2 cut(s) 184, 545
HpyCH4III ACNGT 4 cut(s) 107, 378, 402, 953
HpyCH4V TGCA 3 cut(s) 388, 410, 627
HpyF3I CTNAG 2 cut(s) 65, 464
Hsp92II CATG 6 cut(s) 329, 410, 551, 781, 842, 869
Kzo9I GATC 2 cut(s) 37, 267
LmnI GCTCC 2 cut(s) 60, 225
LpnPI CCDG 9 cut(s) 38, 60, 152, 226, 263, 290, 785, 802, 897
MaeI CTAG 3 cut(s) 167, 239, 692
MaeIII GTNAC 5 cut(s) 16, 145, 293, 687, 868
MalI GATC 2 cut(s) 39, 269
MbiI CCGCTC 1 cut(s) 55
MboI GATC 2 cut(s) 37, 267
MboII GAAGA 7 cut(s) 303, 559, 585, 658, 757, 806, 870
MfeI CAATTG 1 cut(s) 383
MhlI GDGCHC 2 cut(s) 53, 222
MluCI AATT 6 cut(s) 348, 383, 711, 719, 748, 783
MnlI CCTC 7 cut(s) 25, 111, 242, 315, 503, 828, 930
Mph1103I ATGCAT 1 cut(s) 412
MseI TTAA 5 cut(s) 183, 504, 704, 714, 723
MspI CCGG 2 cut(s) 25, 47
MspR9I CCNGG 4 cut(s) 25, 47, 48, 278
MunI CAATTG 1 cut(s) 383
MvaI CCWGG 1 cut(s) 278
NciI CCSGG 3 cut(s) 25, 47, 48
NdeI CATATG 1 cut(s) 639
NdeII GATC 2 cut(s) 37, 267
NlaIII CATG 6 cut(s) 329, 410, 551, 781, 842, 869
NlaIV GGNNCC 3 cut(s) 51, 204, 907
NmuCI GTSAC 4 cut(s) 16, 145, 293, 868
NsiI ATGCAT 1 cut(s) 412
PagI TCATGA 1 cut(s) 325
PasI CCCWGGG 1 cut(s) 277
PceI AGGCCT 1 cut(s) 231
PfeI GAWTC 2 cut(s) 5, 915
Psp124BI GAGCTC 1 cut(s) 222
Psp6I CCWGG 1 cut(s) 276
PspEI GGTNACC 1 cut(s) 145
PspGI CCWGG 1 cut(s) 276
PspN4I GGNNCC 3 cut(s) 51, 204, 907
PspOMI GGGCCC 1 cut(s) 49
PspPI GGNCC 4 cut(s) 27, 49, 50, 906
RsaI GTAC 1 cut(s) 843
RsaNI GTAC 1 cut(s) 842
SacI GAGCTC 1 cut(s) 222
SaqAI TTAA 5 cut(s) 183, 504, 704, 714, 723
Sau3AI GATC 2 cut(s) 37, 267
Sau96I GGNCC 4 cut(s) 27, 49, 50, 906
ScrFI CCNGG 4 cut(s) 25, 47, 48, 278
SduI GDGCHC 2 cut(s) 53, 222
SetI ASST 9 cut(s) 66, 222, 244, 343, 514, 556, 610, 686, 847
SinI GGWCC 1 cut(s) 906
SmaI CCCGGG 1 cut(s) 48
SmiI ATTTAAAT 1 cut(s) 724
Sse9I AATT 6 cut(s) 348, 383, 711, 719, 748, 783
SseBI AGGCCT 1 cut(s) 231
SsiI CCGC 3 cut(s) 35, 53, 81
SspI AATATT 2 cut(s) 700, 728
SspMI CTAG 3 cut(s) 167, 239, 692
SstI GAGCTC 1 cut(s) 222
StuI AGGCCT 1 cut(s) 231
StyD4I CCNGG 4 cut(s) 23, 45, 46, 276
SwaI ATTTAAAT 1 cut(s) 724
TaaI ACNGT 4 cut(s) 107, 378, 402, 953
TasI AATT 6 cut(s) 348, 383, 711, 719, 748, 783
TfiI GAWTC 2 cut(s) 5, 915
Tru1I TTAA 5 cut(s) 183, 504, 704, 714, 723
Tru9I TTAA 5 cut(s) 183, 504, 704, 714, 723
TscAI CASTG 2 cut(s) 146, 220
TseFI GTSAC 4 cut(s) 16, 145, 293, 868
Tsp45I GTSAC 4 cut(s) 16, 145, 293, 868
TspDTI ATGAA 4 cut(s) 314, 564, 794, 854
TspGWI ACGGA 1 cut(s) 215
TspMI CCCGGG 1 cut(s) 46
TspRI CASTG 2 cut(s) 146, 220
VpaK11BI GGWCC 1 cut(s) 906
XapI RAATTY 2 cut(s) 719, 783
XmaI CCCGGG 1 cut(s) 46
XspI CTAG 3 cut(s) 167, 239, 692
Zsp2I ATGCAT 1 cut(s) 412
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.