pycom17g21170

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr17
OG0000158
Physical Location & Seq
Forward (+)
19672739 .. 19674549
1811 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom17g21170.7

Sequence Viewer

Length: 1380 bp
ATGCTACTTCTATTCATTGTTATAATATATTGTCTTTGTCCTTTCGAGTTTGTTTCTTTTCTCTTTTGCTCTCTTTCATTGCACCTTCCCACGCGGCCGTATGTCGTTTCTCAAGTCCATATGCAAACATTATTATCTGGAAAAATTTATGTTTCTATATTTTTGATTAGAGAAATTGAAAGTTGTAATCAAGAAATTGCAGTTTACTCTGCTATAGGCATGAACACTTGTGAGACGATCAACAATCAATTGAAGTCAATTCCTTTCAACATAATTGTGACAGAACAACCAATCGATGTGATAAACTGTGAGGTAAAACACATCTTGCACCAGAACCCGGGCTCGCTCCACCATCGTAACATGATATTGTCCACTTTGGGTCCCGACTACGCCCTCACGGTTTTGTTTCTGGGAACTCACGAGCAACTTCCTAGTGGGTCACCCCATCATGGGATTGCTCTCGCACGAACTCGCTTAACTTCGGAGTTCCTACGGAACCCGAAGCCAATACATATAAGGCTCACTCCCCTGGGCGATGTGAGATGTCACAATCCACCCCCCTTAAGGGCCCGACATCCTCGTCAGCACACCATGGCCAGGCACTTCCTGGACCCGCTCCACCACCATAACACGATATTGTCCAGTTTGGGCCCTGACCACGCCCCACGATTTTGTTTCTGGGAACTCACGATCAACTTTCCAATGGATCACCCATCATGGGATTGCTCTCGCACGAACTCGCTTAACTTCGGAGTTCCTACGGAACCCGAAGCTAGTGAGCTCTCAAAAGACCTCGTGCTAGGTAGAGATGAGAATATACATATAAGGCTCACTCCCCTGGGCGATGTGGGATGTTACACCCACACTGTTCCTTTATTTTATCTGACTCACGAACGTCCTTCAATTGGAATTACTCCAAAATGTATCCACTCGATCACGTTTTGCTCAAGAGGAAATCAAATGTACATTGAAAATATAAATCCAATGTATAAAATCGATTCATCAATATGCCTCCATGAAATTCCTAAGAATTATATTAGAGCACCACTTAATCGTTTCTACAACAATCTACTAGATTATGGTCCTAAGCTTGAATCTTGTAAATGTATCCTTTCATATTTTGGTCCATTCTCTAATCACTTTTGTTTGTTCTATGGTTGTCGTATTTTGCATAGAACGATATATCCGTTAGTTTCACTGTCTTCCATACTACAATACTACTTATCTCAATATAAGAAAAGAGAAGTAGGTTCATTAGGGCAACTCAGTATTAAGATATCATTTTGTCCTCCTTTCTTATATCGAGGATGTGCTATTCACGCACCCTTTTTACTTCTCACACATCATCTTAATTTTTGGCAGTTGGATCGAATGAATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

460

Amino Acids

52.72

Weight (kDa)

8.46

Isoelectric Point (pI)

44.48

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000158)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g10163
malus_domestica MD04G1068000.v1.1 MD05G1130900.v1.1 MD06G1153600.v1.1 MD10G1255900.v1.1 MD10G1282000.v1.1 MD13G1075400.v1.1 MD13G1192400.v1.1
pyrus_communis pycom01g00130 pycom01g00390 pycom01g00700 pycom01g00720 pycom01g00750 pycom01g00850 pycom01g00870 pycom01g00910 pycom01g01250 pycom01g01560 pycom01g01680 pycom01g01860 pycom01g01900 pycom01g01910 pycom01g02200 pycom01g02260 pycom01g02270 pycom01g02280 pycom01g02330 pycom01g02480 pycom01g02720 pycom01g02730 pycom01g02750 pycom01g02770 pycom01g02780 pycom01g02860 pycom01g02910 pycom01g03540 pycom01g04090 pycom01g04100 pycom01g04150 pycom01g04250 pycom01g04430 pycom01g11810 pycom01g11860 pycom01g11940 pycom01g21380 pycom02g06650 pycom02g08490 pycom02g08600 pycom02g18230 pycom02g18450 pycom02g18800 pycom02g19150 pycom02g20740 pycom02g21340 pycom02g26210 pycom03g12060 pycom03g19060 pycom03g19100 pycom03g19120 pycom04g06890 pycom04g08960 pycom05g01790 pycom05g07910 pycom05g08080 pycom05g08100 pycom05g08570 pycom05g21500 pycom05g22400 pycom05g22510 pycom05g22620 pycom05g23020 pycom05g23720 pycom05g23890 pycom05g24040 pycom07g12080 pycom08g07930 pycom08g11940 pycom09g12120 pycom10g03890 pycom10g23360 pycom10g28250 pycom11g02850 pycom11g14370 pycom11g14400 pycom11g21840 pycom11g21860 pycom11g21980 pycom11g23580 pycom11g23650 pycom11g24050 pycom11g25610 pycom12424g00060 pycom1256g00130 pycom12661g00030 pycom12g09520 pycom12g09530 pycom12g09660 pycom12g09730 pycom12g11210 pycom12g16710 pycom12g16740 pycom12g16750 pycom13g08800 pycom13g18580 pycom13g18670 pycom13g18770 pycom13g22900 pycom13g23050 pycom13g23160 pycom13g23480 pycom13g23610 pycom13g23660 pycom13g23790 pycom13g23840 pycom13g24010 pycom13g24140 pycom13g24210 pycom13g24300 pycom13g24310 pycom13g24480 pycom13g24520 pycom13g24570 pycom13g24730 pycom13g24760 pycom13g24820 pycom13g25010 pycom13g25020 pycom13g25270 pycom13g25620 pycom13g25670 pycom13g25760 pycom13g25800 pycom13g25900 pycom13g26620 pycom13g26640 pycom13g26670 pycom13g26940 pycom13g27040 pycom13g27130 pycom13g27530 pycom13g27770 pycom13g27830 pycom13g27920 pycom13g27940 pycom13g28100 pycom13g28420 pycom13g28430 pycom13g28460 pycom13g28520 pycom13g29160 pycom14g05380 pycom15g03480 pycom15g04370 pycom15g27500 pycom16g13590 pycom16g13610 pycom16g13630 pycom16g14390 pycom16g18310 pycom17g01940 pycom17g04000 pycom17g16100 pycom17g16220 pycom17g16230 pycom17g16340 pycom17g16430 pycom17g16460 pycom17g16740 pycom17g16960 pycom17g17020 pycom17g17090 pycom17g17100 pycom17g17170 pycom17g17430 pycom17g17850 pycom17g18230 pycom17g18250 pycom17g18380 pycom17g21170 pycom17g21330 pycom520g00150 pycom520g00160 pycom808g00030 pycom808g00160 pycom808g00250 pycom808g00290
rosa_chinensis RchiOBHm_Chr5g0054451

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 23
AasI GACNNNNNNGTC 1 cut(s) 579
AccBSI CCGCTC 1 cut(s) 616
AccII CGCG 1 cut(s) 94
AciI CCGC 2 cut(s) 94, 614
AclWI GGATC 2 cut(s) 714, 1374
AcoI YGGCCR 2 cut(s) 95, 594
AcsI RAATTY 2 cut(s) 144, 1020
AfaI GTAC 1 cut(s) 965
AfiI CCNNNNNNNGG 8 cut(s) 337, 449, 450, 564, 565, 597, 718, 905
AflII CTTAAG 1 cut(s) 562
AgsI TTSAA 6 cut(s) 179, 253, 268, 903, 971, 1094
AjnI CCWGG 4 cut(s) 528, 596, 606, 837
AloI GAACNNNNNNTCC 2 cut(s) 1168, 1200
AluBI AGCT 3 cut(s) 773, 781, 1090
AluI AGCT 3 cut(s) 773, 781, 1090
Alw21I GWGCWC 2 cut(s) 783, 1045
Alw26I GTCTC 1 cut(s) 227
AlwI GGATC 2 cut(s) 714, 1374
Ama87I CYCGRG 1 cut(s) 337
AoxI GGCC 4 cut(s) 95, 567, 594, 649
ApaI GGGCCC 2 cut(s) 571, 653
ApoI RAATTY 2 cut(s) 144, 1020
AspS9I GGNCC 8 cut(s) 380, 567, 568, 610, 649, 650, 1082, 1124
AsuC2I CCSGG 2 cut(s) 338, 339
AsuHPI GGTGA 2 cut(s) 432, 701
AvaI CYCGRG 1 cut(s) 337
AvaII GGWCC 4 cut(s) 380, 610, 1082, 1124
BaeGI GKGCMC 2 cut(s) 571, 653
BalI TGGCCA 1 cut(s) 596
BanII GRGCYC 4 cut(s) 344, 571, 653, 783
BauI CACGAG 2 cut(s) 419, 794
BbsI GAAGAC 1 cut(s) 1194
Bbv12I GWGCWC 2 cut(s) 783, 1045
BccI CCATC 3 cut(s) 360, 453, 721
BceAI ACGGC 1 cut(s) 82
BcgI CGANNNNNNTGC 1 cut(s) 1349
BciT130I CCWGG 4 cut(s) 530, 598, 608, 839
BciVI GTATCC 2 cut(s) 935, 1118
BcnI CCSGG 2 cut(s) 338, 339
BcoDI GTCTC 1 cut(s) 227
BfaI CTAG 4 cut(s) 432, 774, 800, 1073
BfmI CTRYAG 1 cut(s) 213
BfrI CTTAAG 1 cut(s) 562
BfuI GTATCC 2 cut(s) 935, 1118
BisI GCNGC 1 cut(s) 95
BlsI GCNGC 1 cut(s) 96
Bme1390I CCNGG 6 cut(s) 338, 339, 530, 598, 608, 839
Bme18I GGWCC 4 cut(s) 380, 610, 1082, 1124
BmeT110I CYCGRG 1 cut(s) 337
BmgT120I GGNCC 8 cut(s) 380, 567, 568, 610, 649, 650, 1082, 1124
BmiI GGNNCC 7 cut(s) 381, 382, 497, 569, 612, 651, 765
BmrFI CCNGG 6 cut(s) 338, 339, 530, 598, 608, 839
BpiI GAAGAC 1 cut(s) 1194
Bpu10I CCTNAGC 1 cut(s) 1086
BpuEI CTTGAG 2 cut(s) 96, 931
BpuMI CCSGG 2 cut(s) 338, 339
Bsa29I ATCGAT 2 cut(s) 294, 996
BsaJI CCNNGG 6 cut(s) 337, 528, 529, 591, 837, 838
Bsc4I CCNNNNNNNGG 8 cut(s) 337, 449, 450, 564, 565, 597, 718, 905
Bse1I ACTGG 1 cut(s) 642
Bse3DI GCAATG 1 cut(s) 77
BseBI CCWGG 4 cut(s) 530, 598, 608, 839
BseCI ATCGAT 2 cut(s) 294, 996
BseDI CCNNGG 6 cut(s) 337, 528, 529, 591, 837, 838
BseGI GGATG 3 cut(s) 574, 857, 1313
BseLI CCNNNNNNNGG 8 cut(s) 337, 449, 450, 564, 565, 597, 718, 905
BseMI GCAATG 1 cut(s) 77
BseMII CTCAG 1 cut(s) 1279
BseNI ACTGG 1 cut(s) 642
BseSI GKGCMC 2 cut(s) 571, 653
BseX3I CGGCCG 1 cut(s) 95
Bsh1236I CGCG 1 cut(s) 94
Bsh1285I CGRYCG 1 cut(s) 98
BshFI GGCC 4 cut(s) 97, 569, 596, 651
BshVI ATCGAT 2 cut(s) 294, 996
BsiEI CGRYCG 1 cut(s) 98
BsiHKAI GWGCWC 2 cut(s) 783, 1045
BsiHKCI CYCGRG 1 cut(s) 337
BsiSI CCGG 1 cut(s) 338
BslFI GGGAC 1 cut(s) 366
BslI CCNNNNNNNGG 8 cut(s) 337, 449, 450, 564, 565, 597, 718, 905
BsmAI GTCTC 1 cut(s) 227
BsmBI CGTCTC 1 cut(s) 227
BsmFI GGGAC 1 cut(s) 366
BsnI GGCC 4 cut(s) 97, 569, 596, 651
BsoBI CYCGRG 1 cut(s) 337
Bsp120I GGGCCC 2 cut(s) 567, 649
Bsp1286I GDGCHC 5 cut(s) 344, 571, 653, 783, 1045
Bsp1407I TGTACA 1 cut(s) 963
Bsp143I GATC 5 cut(s) 237, 690, 706, 933, 1366
Bsp19I CCATGG 1 cut(s) 591
BspACI CCGC 2 cut(s) 94, 614
BspANI GGCC 4 cut(s) 97, 569, 596, 651
BspCNI CTCAG 1 cut(s) 1278
BspDI ATCGAT 2 cut(s) 294, 996
BspFNI CGCG 1 cut(s) 94
BspLI GGNNCC 7 cut(s) 381, 382, 497, 569, 612, 651, 765
BspPI GGATC 2 cut(s) 714, 1374
BspTI CTTAAG 1 cut(s) 562
BsrBI CCGCTC 1 cut(s) 616
BsrDI GCAATG 1 cut(s) 77
BsrGI TGTACA 1 cut(s) 963
BsrI ACTGG 1 cut(s) 642
BssECI CCNNGG 6 cut(s) 337, 528, 529, 591, 837, 838
BssMI GATC 5 cut(s) 237, 690, 706, 933, 1366
BssSI CACGAG 2 cut(s) 419, 794
BssT1I CCWWGG 1 cut(s) 591
Bst2BI CACGAG 2 cut(s) 419, 794
Bst2UI CCWGG 4 cut(s) 530, 598, 608, 839
Bst4CI ACNGT 4 cut(s) 308, 400, 868, 1200
BstAFI CTTAAG 1 cut(s) 562
BstAUI TGTACA 1 cut(s) 963
BstC8I GCNNGC 1 cut(s) 344
BstDEI CTNAG 3 cut(s) 1026, 1086, 1265
BstDSI CCRYGG 1 cut(s) 591
BstEII GGTNACC 1 cut(s) 438
BstF5I GGATG 3 cut(s) 574, 857, 1313
BstFNI CGCG 1 cut(s) 94
BstKTI GATC 5 cut(s) 240, 693, 709, 936, 1369
BstMAI GTCTC 1 cut(s) 227
BstMBI GATC 5 cut(s) 237, 690, 706, 933, 1366
BstMCI CGRYCG 1 cut(s) 98
BstMWI GCNNNNNNNGC 1 cut(s) 1319
BstNI CCWGG 4 cut(s) 530, 598, 608, 839
BstPI GGTNACC 1 cut(s) 438
BstSCI CCNGG 6 cut(s) 336, 337, 528, 596, 606, 837
BstSFI CTRYAG 1 cut(s) 213
BstSLI GKGCMC 2 cut(s) 571, 653
BstUI CGCG 1 cut(s) 94
BstV2I GAAGAC 1 cut(s) 1194
BstZI CGGCCG 1 cut(s) 95
Bsu15I ATCGAT 2 cut(s) 294, 996
BsuI GTATCC 2 cut(s) 935, 1118
BsuRI GGCC 4 cut(s) 97, 569, 596, 651
BsuTUI ATCGAT 2 cut(s) 294, 996
BtgI CCRYGG 1 cut(s) 591
BtgZI GCGATG 2 cut(s) 549, 858
BtsCI GGATG 3 cut(s) 574, 857, 1313
BtsIMutI CAGTG 2 cut(s) 864, 1196
Cac8I GCNNGC 1 cut(s) 344
Cfr13I GGNCC 8 cut(s) 380, 567, 568, 610, 649, 650, 1082, 1124
Cfr9I CCCGGG 1 cut(s) 337
ClaI ATCGAT 2 cut(s) 294, 996
Csp6I GTAC 1 cut(s) 964
CviAII CATG 6 cut(s) 220, 361, 449, 592, 717, 1016
CviQI GTAC 1 cut(s) 964
DdeI CTNAG 3 cut(s) 1026, 1086, 1265
DpnI GATC 5 cut(s) 239, 692, 708, 935, 1368
DpnII GATC 5 cut(s) 237, 690, 706, 933, 1366
DrdI GACNNNNNNGTC 1 cut(s) 579
DseDI GACNNNNNNGTC 1 cut(s) 579
EaeI YGGCCR 2 cut(s) 95, 594
EagI CGGCCG 1 cut(s) 95
Ecl136II GAGCTC 1 cut(s) 781
EclXI CGGCCG 1 cut(s) 95
Eco130I CCWWGG 1 cut(s) 591
Eco24I GRGCYC 4 cut(s) 344, 571, 653, 783
Eco32I GATATC 1 cut(s) 1278
Eco47I GGWCC 4 cut(s) 380, 610, 1082, 1124
Eco52I CGGCCG 1 cut(s) 95
Eco53kI GAGCTC 1 cut(s) 781
Eco88I CYCGRG 1 cut(s) 337
Eco91I GGTNACC 1 cut(s) 438
EcoICRI GAGCTC 1 cut(s) 781
EcoO109I RGGNCCY 3 cut(s) 380, 567, 650
EcoO65I GGTNACC 1 cut(s) 438
EcoRII CCWGG 4 cut(s) 528, 596, 606, 837
EcoRV GATATC 1 cut(s) 1278
EcoT14I CCWWGG 1 cut(s) 591
EcoT38I GRGCYC 4 cut(s) 344, 571, 653, 783
ErhI CCWWGG 1 cut(s) 591
Esp3I CGTCTC 1 cut(s) 227
FaeI CATG 6 cut(s) 223, 364, 452, 595, 720, 1019
FaqI GGGAC 1 cut(s) 366
FatI CATG 6 cut(s) 219, 360, 448, 591, 716, 1015
FauI CCCGC 1 cut(s) 621
FauNDI CATATG 1 cut(s) 120
Fnu4HI GCNGC 1 cut(s) 95
FokI GGATG 3 cut(s) 561, 864, 1320
FriOI GRGCYC 4 cut(s) 344, 571, 653, 783
Fsp4HI GCNGC 1 cut(s) 95
FspBI CTAG 4 cut(s) 432, 774, 800, 1073
GluI GCNGC 1 cut(s) 95
HaeIII GGCC 4 cut(s) 97, 569, 596, 651
HapII CCGG 1 cut(s) 338
Hin1II CATG 6 cut(s) 223, 364, 452, 595, 720, 1019
HindIII AAGCTT 1 cut(s) 1088
HinfI GANTC 3 cut(s) 886, 998, 1094
HpaII CCGG 1 cut(s) 338
HphI GGTGA 2 cut(s) 432, 701
Hpy166II GTNNAC 2 cut(s) 205, 372
Hpy188I TCNGA 3 cut(s) 484, 752, 885
Hpy188III TCNNGA 7 cut(s) 138, 191, 383, 419, 688, 890, 948
Hpy8I GTNNAC 2 cut(s) 205, 372
HpyAV CCTTC 2 cut(s) 95, 909
HpyCH4III ACNGT 4 cut(s) 308, 400, 868, 1200
HpyCH4IV ACGT 2 cut(s) 895, 938
HpyCH4V TGCA 5 cut(s) 82, 124, 200, 328, 1171
HpyF10VI GCNNNNNNNGC 1 cut(s) 1319
HpyF3I CTNAG 3 cut(s) 1026, 1086, 1265
HpySE526I ACGT 2 cut(s) 895, 938
Hsp92II CATG 6 cut(s) 223, 364, 452, 595, 720, 1019
KflI GGGWCCC 1 cut(s) 380
Kzo9I GATC 5 cut(s) 237, 690, 706, 933, 1366
LmnI GCTCC 2 cut(s) 351, 621
MaeI CTAG 4 cut(s) 432, 774, 800, 1073
MaeII ACGT 2 cut(s) 895, 938
MaeIII GTNAC 5 cut(s) 277, 356, 438, 545, 854
MalI GATC 5 cut(s) 239, 692, 708, 935, 1368
MbiI CCGCTC 1 cut(s) 616
MboI GATC 5 cut(s) 237, 690, 706, 933, 1366
MboII GAAGA 1 cut(s) 1194
MfeI CAATTG 2 cut(s) 248, 903
MhlI GDGCHC 5 cut(s) 344, 571, 653, 783, 1045
MlsI TGGCCA 1 cut(s) 596
MluNI TGGCCA 1 cut(s) 596
MlyI GAGTC 1 cut(s) 880
MmeI TCCRAC 1 cut(s) 1344
MnlI CCTC 8 cut(s) 304, 404, 588, 803, 944, 1022, 1298, 1299
Mox20I TGGCCA 1 cut(s) 596
MscI TGGCCA 1 cut(s) 596
MseI TTAA 6 cut(s) 476, 563, 744, 1050, 1272, 1350
MslI CAYNNNNRTG 2 cut(s) 275, 1006
Msp20I TGGCCA 1 cut(s) 596
MspCI CTTAAG 1 cut(s) 562
MspI CCGG 1 cut(s) 338
MspR9I CCNGG 6 cut(s) 338, 339, 530, 598, 608, 839
MunI CAATTG 2 cut(s) 248, 903
MvaI CCWGG 4 cut(s) 530, 598, 608, 839
MvnI CGCG 1 cut(s) 94
MwoI GCNNNNNNNGC 1 cut(s) 1319
NciI CCSGG 2 cut(s) 338, 339
NcoI CCATGG 1 cut(s) 591
NdeI CATATG 1 cut(s) 120
NdeII GATC 5 cut(s) 237, 690, 706, 933, 1366
NlaIII CATG 6 cut(s) 223, 364, 452, 595, 720, 1019
NlaIV GGNNCC 7 cut(s) 381, 382, 497, 569, 612, 651, 765
NmuCI GTSAC 3 cut(s) 277, 438, 545
PasI CCCWGGG 2 cut(s) 529, 838
PcsI WCGNNNNNNNCGW 1 cut(s) 1184
PfeI GAWTC 2 cut(s) 998, 1094
PfoI TCCNGGA 1 cut(s) 606
PkrI GCNGC 1 cut(s) 96
PleI GAGTC 1 cut(s) 880
PpsI GAGTC 1 cut(s) 880
PpuMI RGGWCCY 1 cut(s) 380
PsiI TTATAA 1 cut(s) 23
Psp124BI GAGCTC 1 cut(s) 783
Psp5II RGGWCCY 1 cut(s) 380
Psp6I CCWGG 4 cut(s) 528, 596, 606, 837
PspEI GGTNACC 1 cut(s) 438
PspGI CCWGG 4 cut(s) 528, 596, 606, 837
PspN4I GGNNCC 7 cut(s) 381, 382, 497, 569, 612, 651, 765
PspOMI GGGCCC 2 cut(s) 567, 649
PspPI GGNCC 8 cut(s) 380, 567, 568, 610, 649, 650, 1082, 1124
PspPPI RGGWCCY 1 cut(s) 380
RsaI GTAC 1 cut(s) 965
RsaNI GTAC 1 cut(s) 964
RseI CAYNNNNRTG 2 cut(s) 275, 1006
SacI GAGCTC 1 cut(s) 783
SaqAI TTAA 6 cut(s) 476, 563, 744, 1050, 1272, 1350
SatI GCNGC 1 cut(s) 95
Sau3AI GATC 5 cut(s) 237, 690, 706, 933, 1366
Sau96I GGNCC 8 cut(s) 380, 567, 568, 610, 649, 650, 1082, 1124
SchI GAGTC 1 cut(s) 880
ScrFI CCNGG 6 cut(s) 338, 339, 530, 598, 608, 839
SduI GDGCHC 5 cut(s) 344, 571, 653, 783, 1045
SfcI CTRYAG 1 cut(s) 213
SinI GGWCC 4 cut(s) 380, 610, 1082, 1124
SmaI CCCGGG 1 cut(s) 339
SmiMI CAYNNNNRTG 2 cut(s) 275, 1006
SmlI CTYRAG 3 cut(s) 111, 562, 946
SmoI CTYRAG 3 cut(s) 111, 562, 946
SsiI CCGC 2 cut(s) 94, 614
SspMI CTAG 4 cut(s) 432, 774, 800, 1073
SstI GAGCTC 1 cut(s) 783
StyD4I CCNGG 6 cut(s) 336, 337, 528, 596, 606, 837
StyI CCWWGG 1 cut(s) 591
TaaI ACNGT 4 cut(s) 308, 400, 868, 1200
TaiI ACGT 2 cut(s) 898, 941
TaqI TCGA 6 cut(s) 45, 294, 932, 996, 1303, 1369
TatI WGTACW 1 cut(s) 963
TauI GCSGC 1 cut(s) 97
TfiI GAWTC 2 cut(s) 998, 1094
Tru1I TTAA 6 cut(s) 476, 563, 744, 1050, 1272, 1350
Tru9I TTAA 6 cut(s) 476, 563, 744, 1050, 1272, 1350
TscAI CASTG 2 cut(s) 871, 1203
TseFI GTSAC 3 cut(s) 277, 438, 545
Tsp45I GTSAC 3 cut(s) 277, 438, 545
TspDTI ATGAA 7 cut(s) 4, 66, 236, 990, 1032, 1104, 1242
TspGWI ACGGA 3 cut(s) 508, 776, 1176
TspMI CCCGGG 1 cut(s) 337
TspRI CASTG 2 cut(s) 871, 1203
Vha464I CTTAAG 1 cut(s) 562
VpaK11BI GGWCC 4 cut(s) 380, 610, 1082, 1124
XapI RAATTY 2 cut(s) 144, 1020
XcmI CCANNNNNNNNNTGG 1 cut(s) 604
XmaI CCCGGG 1 cut(s) 337
XspI CTAG 4 cut(s) 432, 774, 800, 1073
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.