pycom13g25010

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr13
OG0000158
Physical Location & Seq
Forward (+)
21972698 .. 21973384
687 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom13g25010.5

Sequence Viewer

Length: 483 bp
ATGATGAACACTTTCTTCAATGGCCGTTGGGGCTTGATCTTGAATTGGTGGAAATTCTTTAAGGGTCGTTGGGCCTTGATCTTGAAGGAGGATTTGACAAAGAACGAAGATTTCAAAGCTTCAAGGTTTTGGTGTGATGTAAATTCCTCCCCTTTTCCTTTGATGGAGAAGGCTATTTATAGTGATAAGTGTGTGAGGTTGGTGAATGAAATGAATAAAAATTGTAATTTTAATACATTGATCAACATTTATTTCACTGAAATTTCAATGTCTATACCATCTCCAATTAGCACGAGGCATTTTGGGACGAGTTCGCGCGAGAGCAATCCAAGGATGGGTGACCCACTGGGAAGTTCTCATGTGAGTTCCCAGAAACAAAACCGTGAGGGCATGGTCAGGGCCCAAAGCGGTCAATATCGTGCTACGGTGGAGTCGAGCCCGGGATGTGGCCTTTTGGGAGCTCACTGGCTTCCAGTTCCGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

161

Amino Acids

18.32

Weight (kDa)

9.35

Isoelectric Point (pI)

52.24

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000158)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g10163
malus_domestica MD04G1068000.v1.1 MD05G1130900.v1.1 MD06G1153600.v1.1 MD10G1255900.v1.1 MD10G1282000.v1.1 MD13G1075400.v1.1 MD13G1192400.v1.1
pyrus_communis pycom01g00130 pycom01g00390 pycom01g00700 pycom01g00720 pycom01g00750 pycom01g00850 pycom01g00870 pycom01g00910 pycom01g01250 pycom01g01560 pycom01g01680 pycom01g01860 pycom01g01900 pycom01g01910 pycom01g02200 pycom01g02260 pycom01g02270 pycom01g02280 pycom01g02330 pycom01g02480 pycom01g02720 pycom01g02730 pycom01g02750 pycom01g02770 pycom01g02780 pycom01g02860 pycom01g02910 pycom01g03540 pycom01g04090 pycom01g04100 pycom01g04150 pycom01g04250 pycom01g04430 pycom01g11810 pycom01g11860 pycom01g11940 pycom01g21380 pycom02g06650 pycom02g08490 pycom02g08600 pycom02g18230 pycom02g18450 pycom02g18800 pycom02g19150 pycom02g20740 pycom02g21340 pycom02g26210 pycom03g12060 pycom03g19060 pycom03g19100 pycom03g19120 pycom04g06890 pycom04g08960 pycom05g01790 pycom05g07910 pycom05g08080 pycom05g08100 pycom05g08570 pycom05g21500 pycom05g22400 pycom05g22510 pycom05g22620 pycom05g23020 pycom05g23720 pycom05g23890 pycom05g24040 pycom07g12080 pycom08g07930 pycom08g11940 pycom09g12120 pycom10g03890 pycom10g23360 pycom10g28250 pycom11g02850 pycom11g14370 pycom11g14400 pycom11g21840 pycom11g21860 pycom11g21980 pycom11g23580 pycom11g23650 pycom11g24050 pycom11g25610 pycom12424g00060 pycom1256g00130 pycom12661g00030 pycom12g09520 pycom12g09530 pycom12g09660 pycom12g09730 pycom12g11210 pycom12g16710 pycom12g16740 pycom12g16750 pycom13g08800 pycom13g18580 pycom13g18670 pycom13g18770 pycom13g22900 pycom13g23050 pycom13g23160 pycom13g23480 pycom13g23610 pycom13g23660 pycom13g23790 pycom13g23840 pycom13g24010 pycom13g24140 pycom13g24210 pycom13g24300 pycom13g24310 pycom13g24480 pycom13g24520 pycom13g24570 pycom13g24730 pycom13g24760 pycom13g24820 pycom13g25010 pycom13g25020 pycom13g25270 pycom13g25620 pycom13g25670 pycom13g25760 pycom13g25800 pycom13g25900 pycom13g26620 pycom13g26640 pycom13g26670 pycom13g26940 pycom13g27040 pycom13g27130 pycom13g27530 pycom13g27770 pycom13g27830 pycom13g27920 pycom13g27940 pycom13g28100 pycom13g28420 pycom13g28430 pycom13g28460 pycom13g28520 pycom13g29160 pycom14g05380 pycom15g03480 pycom15g04370 pycom15g27500 pycom16g13590 pycom16g13610 pycom16g13630 pycom16g14390 pycom16g18310 pycom17g01940 pycom17g04000 pycom17g16100 pycom17g16220 pycom17g16230 pycom17g16340 pycom17g16430 pycom17g16460 pycom17g16740 pycom17g16960 pycom17g17020 pycom17g17090 pycom17g17100 pycom17g17170 pycom17g17430 pycom17g17850 pycom17g18230 pycom17g18250 pycom17g18380 pycom17g21170 pycom17g21330 pycom520g00150 pycom520g00160 pycom808g00030 pycom808g00160 pycom808g00250 pycom808g00290
rosa_chinensis RchiOBHm_Chr5g0054451

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 2 cut(s) 316, 318
AciI CCGC 1 cut(s) 408
AcoI YGGCCR 1 cut(s) 22
AcsI RAATTY 3 cut(s) 53, 142, 261
AfiI CCNNNNNNNGG 2 cut(s) 335, 446
AgsI TTSAA 6 cut(s) 19, 43, 85, 115, 123, 267
AluBI AGCT 2 cut(s) 119, 461
AluI AGCT 2 cut(s) 119, 461
Alw21I GWGCWC 1 cut(s) 463
Ama87I CYCGRG 1 cut(s) 439
AoxI GGCC 4 cut(s) 22, 72, 399, 448
ApaI GGGCCC 1 cut(s) 403
ApoI RAATTY 3 cut(s) 53, 142, 261
Asp700I GAANNNNTTC 1 cut(s) 11
AspLEI GCGC 1 cut(s) 318
AspS9I GGNCC 3 cut(s) 72, 399, 400
AsuC2I CCSGG 2 cut(s) 440, 441
AsuHPI GGTGA 2 cut(s) 214, 350
AvaI CYCGRG 1 cut(s) 439
BaeGI GKGCMC 1 cut(s) 403
BanII GRGCYC 3 cut(s) 403, 440, 463
BauI CACGAG 1 cut(s) 292
Bbv12I GWGCWC 1 cut(s) 463
BccI CCATC 3 cut(s) 157, 286, 328
BceAI ACGGC 1 cut(s) 9
BclI TGATCA 1 cut(s) 240
BcnI CCSGG 2 cut(s) 440, 441
BglI GCCNNNNNGGC 1 cut(s) 30
Bme1390I CCNGG 2 cut(s) 440, 441
BmeT110I CYCGRG 1 cut(s) 439
BmgT120I GGNCC 3 cut(s) 72, 399, 400
BmiI GGNNCC 1 cut(s) 401
BmrFI CCNGG 2 cut(s) 440, 441
BmrI ACTGGG 1 cut(s) 356
BmuI ACTGGG 1 cut(s) 356
BpuMI CCSGG 2 cut(s) 440, 441
BsaJI CCNNGG 2 cut(s) 329, 439
Bsc4I CCNNNNNNNGG 2 cut(s) 335, 446
Bse1I ACTGG 3 cut(s) 351, 470, 473
BseDI CCNNGG 2 cut(s) 329, 439
BseGI GGATG 2 cut(s) 339, 449
BseLI CCNNNNNNNGG 2 cut(s) 335, 446
BseNI ACTGG 3 cut(s) 351, 470, 473
BseSI GKGCMC 1 cut(s) 403
Bsh1236I CGCG 2 cut(s) 316, 318
BshFI GGCC 4 cut(s) 24, 74, 401, 450
BsiHKAI GWGCWC 1 cut(s) 463
BsiHKCI CYCGRG 1 cut(s) 439
BsiSI CCGG 1 cut(s) 440
BslFI GGGAC 1 cut(s) 319
BslI CCNNNNNNNGG 2 cut(s) 335, 446
BsmFI GGGAC 1 cut(s) 319
BsnI GGCC 4 cut(s) 24, 74, 401, 450
BsoBI CYCGRG 1 cut(s) 439
Bsp120I GGGCCC 1 cut(s) 399
Bsp1286I GDGCHC 3 cut(s) 403, 440, 463
Bsp143I GATC 3 cut(s) 36, 78, 240
BspACI CCGC 1 cut(s) 408
BspANI GGCC 4 cut(s) 24, 74, 401, 450
BspFNI CGCG 2 cut(s) 316, 318
BspLI GGNNCC 1 cut(s) 401
BsrI ACTGG 3 cut(s) 351, 470, 473
BssECI CCNNGG 2 cut(s) 329, 439
BssMI GATC 3 cut(s) 36, 78, 240
BssSI CACGAG 1 cut(s) 292
BssT1I CCWWGG 1 cut(s) 329
Bst2BI CACGAG 1 cut(s) 292
Bst4CI ACNGT 2 cut(s) 383, 427
BstEII GGTNACC 1 cut(s) 338
BstF5I GGATG 2 cut(s) 339, 449
BstFNI CGCG 2 cut(s) 316, 318
BstHHI GCGC 1 cut(s) 318
BstKTI GATC 3 cut(s) 39, 81, 243
BstMBI GATC 3 cut(s) 36, 78, 240
BstMWI GCNNNNNNNGC 1 cut(s) 30
BstPI GGTNACC 1 cut(s) 338
BstSCI CCNGG 2 cut(s) 438, 439
BstSLI GKGCMC 1 cut(s) 403
BstUI CGCG 2 cut(s) 316, 318
BsuRI GGCC 4 cut(s) 24, 74, 401, 450
BtsCI GGATG 2 cut(s) 339, 449
BtsIMutI CAGTG 3 cut(s) 255, 344, 463
CfoI GCGC 1 cut(s) 318
Cfr13I GGNCC 3 cut(s) 72, 399, 400
Cfr9I CCCGGG 1 cut(s) 439
CviAII CATG 2 cut(s) 359, 391
DpnI GATC 3 cut(s) 38, 80, 242
DpnII GATC 3 cut(s) 36, 78, 240
EaeI YGGCCR 1 cut(s) 22
Ecl136II GAGCTC 1 cut(s) 461
Eco130I CCWWGG 1 cut(s) 329
Eco24I GRGCYC 3 cut(s) 403, 440, 463
Eco53kI GAGCTC 1 cut(s) 461
Eco88I CYCGRG 1 cut(s) 439
Eco91I GGTNACC 1 cut(s) 338
EcoICRI GAGCTC 1 cut(s) 461
EcoO109I RGGNCCY 1 cut(s) 399
EcoO65I GGTNACC 1 cut(s) 338
EcoT14I CCWWGG 1 cut(s) 329
EcoT38I GRGCYC 3 cut(s) 403, 440, 463
ErhI CCWWGG 1 cut(s) 329
FaeI CATG 2 cut(s) 362, 394
FaiI YATR 4 cut(s) 180, 275, 360, 392
FaqI GGGAC 1 cut(s) 319
FatI CATG 2 cut(s) 358, 390
FbaI TGATCA 1 cut(s) 240
FokI GGATG 2 cut(s) 346, 456
FriOI GRGCYC 3 cut(s) 403, 440, 463
GlaI GCGC 1 cut(s) 317
HaeIII GGCC 4 cut(s) 24, 74, 401, 450
HapII CCGG 1 cut(s) 440
HhaI GCGC 1 cut(s) 318
Hin1II CATG 2 cut(s) 362, 394
Hin6I GCGC 1 cut(s) 316
HinP1I GCGC 1 cut(s) 316
HindIII AAGCTT 1 cut(s) 117
HinfI GANTC 1 cut(s) 431
HpaII CCGG 1 cut(s) 440
HphI GGTGA 2 cut(s) 214, 350
Hpy188III TCNNGA 2 cut(s) 40, 82
HpyAV CCTTC 2 cut(s) 79, 163
HpyCH4III ACNGT 2 cut(s) 383, 427
HpyF10VI GCNNNNNNNGC 1 cut(s) 30
Hsp92II CATG 2 cut(s) 362, 394
HspAI GCGC 1 cut(s) 316
Ksp22I TGATCA 1 cut(s) 240
Kzo9I GATC 3 cut(s) 36, 78, 240
LmnI GCTCC 1 cut(s) 458
LpnPI CCDG 5 cut(s) 332, 382, 383, 451, 453
MaeIII GTNAC 1 cut(s) 338
MalI GATC 3 cut(s) 38, 80, 242
MboI GATC 3 cut(s) 36, 78, 240
MboII GAAGA 2 cut(s) 7, 119
MhlI GDGCHC 3 cut(s) 403, 440, 463
MluCI AATT 7 cut(s) 43, 53, 142, 220, 226, 261, 285
MlyI GAGTC 1 cut(s) 440
MnlI CCTC 5 cut(s) 82, 157, 189, 288, 379
MroXI GAANNNNTTC 1 cut(s) 11
MseI TTAA 2 cut(s) 60, 231
MspI CCGG 1 cut(s) 440
MspR9I CCNGG 2 cut(s) 440, 441
MvnI CGCG 2 cut(s) 316, 318
MwoI GCNNNNNNNGC 1 cut(s) 30
NciI CCSGG 2 cut(s) 440, 441
NdeII GATC 3 cut(s) 36, 78, 240
NlaIII CATG 2 cut(s) 362, 394
NlaIV GGNNCC 1 cut(s) 401
NmuCI GTSAC 1 cut(s) 338
PcsI WCGNNNNNNNCGW 1 cut(s) 431
PdmI GAANNNNTTC 1 cut(s) 11
PleI GAGTC 1 cut(s) 439
PpsI GAGTC 1 cut(s) 439
Psp124BI GAGCTC 1 cut(s) 463
PspEI GGTNACC 1 cut(s) 338
PspN4I GGNNCC 1 cut(s) 401
PspOMI GGGCCC 1 cut(s) 399
PspPI GGNCC 3 cut(s) 72, 399, 400
SacI GAGCTC 1 cut(s) 463
SaqAI TTAA 2 cut(s) 60, 231
Sau3AI GATC 3 cut(s) 36, 78, 240
Sau96I GGNCC 3 cut(s) 72, 399, 400
SchI GAGTC 1 cut(s) 440
ScrFI CCNGG 2 cut(s) 440, 441
SduI GDGCHC 3 cut(s) 403, 440, 463
SetI ASST 4 cut(s) 121, 128, 200, 463
SmaI CCCGGG 1 cut(s) 441
Sse9I AATT 7 cut(s) 43, 53, 142, 220, 226, 261, 285
SsiI CCGC 1 cut(s) 408
SstI GAGCTC 1 cut(s) 463
StyD4I CCNGG 2 cut(s) 438, 439
StyI CCWWGG 1 cut(s) 329
TaaI ACNGT 2 cut(s) 383, 427
TaqI TCGA 1 cut(s) 434
TasI AATT 7 cut(s) 43, 53, 142, 220, 226, 261, 285
Tru1I TTAA 2 cut(s) 60, 231
Tru9I TTAA 2 cut(s) 60, 231
TscAI CASTG 3 cut(s) 262, 351, 470
TseFI GTSAC 1 cut(s) 338
Tsp45I GTSAC 1 cut(s) 338
TspDTI ATGAA 3 cut(s) 20, 222, 227
TspGWI ACGGA 1 cut(s) 468
TspMI CCCGGG 1 cut(s) 439
TspRI CASTG 3 cut(s) 262, 351, 470
XapI RAATTY 3 cut(s) 53, 142, 261
XmaI CCCGGG 1 cut(s) 439
XmnI GAANNNNTTC 1 cut(s) 11
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.