MD04G1068000.v1.1

No description available

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr04
Physical Location & Seq
Reverse (-)
9225099 .. 9228472
3374 bp
Loading structure...
UTR
Exon/CDS
Intron
MD04G1068000.v1.1.491

Sequence Viewer

Length: 261 bp
ATGTTACTTCTTCGTCGCACAAACCCTGCTTTCACTACCTTGGCACGACGGTTGGTGTGCGATGAAGGTTTCATTGGGTTAATTTTTTGTGCGACGTTTTTTGACTTTGATCGACGAAGGACCTATGTCGTGCAAACTGTTTTTTGTACTAGTGAACGTGATTGTTCAAGAAAATTTGAAAGGGTACTTGGATGTCTATATAAATCAAACGGTAGGATGGAGATTTTATACAACAATTTAATTCATCTTTCTTGTCTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

87

Amino Acids

10.14

Weight (kDa)

9.12

Isoelectric Point (pI)

64.42

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000158)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g10163
malus_domestica MD04G1068000.v1.1 MD05G1130900.v1.1 MD06G1153600.v1.1 MD10G1255900.v1.1 MD10G1282000.v1.1 MD13G1075400.v1.1 MD13G1192400.v1.1
pyrus_communis pycom01g00130 pycom01g00390 pycom01g00700 pycom01g00720 pycom01g00750 pycom01g00850 pycom01g00870 pycom01g00910 pycom01g01250 pycom01g01560 pycom01g01680 pycom01g01860 pycom01g01900 pycom01g01910 pycom01g02200 pycom01g02260 pycom01g02270 pycom01g02280 pycom01g02330 pycom01g02480 pycom01g02720 pycom01g02730 pycom01g02750 pycom01g02770 pycom01g02780 pycom01g02860 pycom01g02910 pycom01g03540 pycom01g04090 pycom01g04100 pycom01g04150 pycom01g04250 pycom01g04430 pycom01g11810 pycom01g11860 pycom01g11940 pycom01g21380 pycom02g06650 pycom02g08490 pycom02g08600 pycom02g18230 pycom02g18450 pycom02g18800 pycom02g19150 pycom02g20740 pycom02g21340 pycom02g26210 pycom03g12060 pycom03g19060 pycom03g19100 pycom03g19120 pycom04g06890 pycom04g08960 pycom05g01790 pycom05g07910 pycom05g08080 pycom05g08100 pycom05g08570 pycom05g21500 pycom05g22400 pycom05g22510 pycom05g22620 pycom05g23020 pycom05g23720 pycom05g23890 pycom05g24040 pycom07g12080 pycom08g07930 pycom08g11940 pycom09g12120 pycom10g03890 pycom10g23360 pycom10g28250 pycom11g02850 pycom11g14370 pycom11g14400 pycom11g21840 pycom11g21860 pycom11g21980 pycom11g23580 pycom11g23650 pycom11g24050 pycom11g25610 pycom12424g00060 pycom1256g00130 pycom12661g00030 pycom12g09520 pycom12g09530 pycom12g09660 pycom12g09730 pycom12g11210 pycom12g16710 pycom12g16740 pycom12g16750 pycom13g08800 pycom13g18580 pycom13g18670 pycom13g18770 pycom13g22900 pycom13g23050 pycom13g23160 pycom13g23480 pycom13g23610 pycom13g23660 pycom13g23790 pycom13g23840 pycom13g24010 pycom13g24140 pycom13g24210 pycom13g24300 pycom13g24310 pycom13g24480 pycom13g24520 pycom13g24570 pycom13g24730 pycom13g24760 pycom13g24820 pycom13g25010 pycom13g25020 pycom13g25270 pycom13g25620 pycom13g25670 pycom13g25760 pycom13g25800 pycom13g25900 pycom13g26620 pycom13g26640 pycom13g26670 pycom13g26940 pycom13g27040 pycom13g27130 pycom13g27530 pycom13g27770 pycom13g27830 pycom13g27920 pycom13g27940 pycom13g28100 pycom13g28420 pycom13g28430 pycom13g28460 pycom13g28520 pycom13g29160 pycom14g05380 pycom15g03480 pycom15g04370 pycom15g27500 pycom16g13590 pycom16g13610 pycom16g13630 pycom16g14390 pycom16g18310 pycom17g01940 pycom17g04000 pycom17g16100 pycom17g16220 pycom17g16230 pycom17g16340 pycom17g16430 pycom17g16460 pycom17g16740 pycom17g16960 pycom17g17020 pycom17g17090 pycom17g17100 pycom17g17170 pycom17g17430 pycom17g17850 pycom17g18230 pycom17g18250 pycom17g18380 pycom17g21170 pycom17g21330 pycom520g00150 pycom520g00160 pycom808g00030 pycom808g00160 pycom808g00250 pycom808g00290
rosa_chinensis RchiOBHm_Chr5g0054451

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 173
AfaI GTAC 2 cut(s) 148, 186
AgsI TTSAA 2 cut(s) 168, 179
AhlI ACTAGT 1 cut(s) 149
AjuI GAANNNNNNNTTGG 4 cut(s) 57, 89, 171, 203
ApoI RAATTY 1 cut(s) 173
AspS9I GGNCC 1 cut(s) 120
AvaII GGWCC 1 cut(s) 120
BccI CCATC 1 cut(s) 211
BcuI ACTAGT 1 cut(s) 149
BfaI CTAG 1 cut(s) 150
Bme18I GGWCC 1 cut(s) 120
BmgT120I GGNCC 1 cut(s) 120
BoxI GACNNNNGTC 1 cut(s) 125
BsaJI CCNNGG 1 cut(s) 39
BseDI CCNNGG 1 cut(s) 39
BseGI GGATG 2 cut(s) 197, 222
Bsp143I GATC 1 cut(s) 109
BssECI CCNNGG 1 cut(s) 39
BssMI GATC 1 cut(s) 109
BssT1I CCWWGG 1 cut(s) 39
Bst4CI ACNGT 3 cut(s) 51, 139, 212
BstF5I GGATG 2 cut(s) 197, 222
BstKTI GATC 1 cut(s) 112
BstMBI GATC 1 cut(s) 109
BstPAI GACNNNNGTC 1 cut(s) 125
BtgZI GCGATG 1 cut(s) 75
BtsCI GGATG 2 cut(s) 197, 222
Cfr13I GGNCC 1 cut(s) 120
Csp6I GTAC 2 cut(s) 147, 185
CviQI GTAC 2 cut(s) 147, 185
DpnI GATC 1 cut(s) 111
DpnII GATC 1 cut(s) 109
Eco130I CCWWGG 1 cut(s) 39
Eco47I GGWCC 1 cut(s) 120
EcoO109I RGGNCCY 1 cut(s) 120
EcoT14I CCWWGG 1 cut(s) 39
ErhI CCWWGG 1 cut(s) 39
FaiI YATR 4 cut(s) 126, 199, 201, 229
FokI GGATG 2 cut(s) 204, 229
FspBI CTAG 1 cut(s) 150
Hpy166II GTNNAC 1 cut(s) 155
Hpy188III TCNNGA 1 cut(s) 168
Hpy8I GTNNAC 1 cut(s) 155
Hpy99I CGWCG 4 cut(s) 18, 51, 97, 117
HpyAV CCTTC 2 cut(s) 59, 111
HpyCH4III ACNGT 3 cut(s) 51, 139, 212
HpyCH4IV ACGT 2 cut(s) 95, 157
HpyCH4V TGCA 1 cut(s) 133
HpySE526I ACGT 2 cut(s) 95, 157
Kzo9I GATC 1 cut(s) 109
LpnPI CCDG 1 cut(s) 39
MaeI CTAG 1 cut(s) 150
MaeII ACGT 2 cut(s) 95, 157
MaeIII GTNAC 1 cut(s) 3
MalI GATC 1 cut(s) 111
MboI GATC 1 cut(s) 109
MluCI AATT 4 cut(s) 81, 173, 235, 240
MseI TTAA 3 cut(s) 80, 239, 259
NdeII GATC 1 cut(s) 109
PpuMI RGGWCCY 1 cut(s) 120
PshAI GACNNNNGTC 1 cut(s) 125
Psp5II RGGWCCY 1 cut(s) 120
PspPI GGNCC 1 cut(s) 120
PspPPI RGGWCCY 1 cut(s) 120
RsaI GTAC 2 cut(s) 148, 186
RsaNI GTAC 2 cut(s) 147, 185
SaqAI TTAA 3 cut(s) 80, 239, 259
Sau3AI GATC 1 cut(s) 109
Sau96I GGNCC 1 cut(s) 120
SetI ASST 5 cut(s) 41, 70, 98, 125, 160
SgeI CNNG 8 cut(s) 38, 52, 57, 142, 162, 170, 180, 200
SinI GGWCC 1 cut(s) 120
SpeI ACTAGT 1 cut(s) 149
Sse9I AATT 4 cut(s) 81, 173, 235, 240
SspMI CTAG 1 cut(s) 150
StyI CCWWGG 1 cut(s) 39
TaaI ACNGT 3 cut(s) 51, 139, 212
TaiI ACGT 2 cut(s) 98, 160
TaqI TCGA 1 cut(s) 112
TasI AATT 4 cut(s) 81, 173, 235, 240
TatI WGTACW 1 cut(s) 146
Tru1I TTAA 3 cut(s) 80, 239, 259
Tru9I TTAA 3 cut(s) 80, 239, 259
TspDTI ATGAA 3 cut(s) 61, 78, 233
VpaK11BI GGWCC 1 cut(s) 120
XapI RAATTY 1 cut(s) 173
XspI CTAG 1 cut(s) 150
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.