pycom12g09530

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr12
OG0000158
Physical Location & Seq
Forward (+)
11475394 .. 11477071
1678 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom12g09530.5

Sequence Viewer

Length: 1299 bp
ATGAATGAACTCGATCTTCAATTTAATATATTTACACTAGTGGATACTACAAAATCTTATGTTATACTTAATGAAAGATACACATTCTACGAAATTAATTTCAATGATCCAACCATCAGACATGTCACATCCCGGCCCGAGGCGGATCACTTCCTGGGCCCGCTCCACCACCGTAGCACGATATTGTCCGCTTTGGGCTTACCATTCCCCCTCGGTTTTGTTTTTGGGAACTCACGAGCAACTTCCCAGTGGGTCACCTATCATGGGATTGCTCTAGCCCCTTTCTCGCTTAACTTCGGAGTTCCAACGGAACCCGAAGCCAGTGAGCTCCCAAAATGCCTCGTGTTAGGTAGGGATGGGAATATACATTTAAGGATCACTCCCCTGGGCGATGTGGGATGTTACAAAACATGTTTGTATATACTTCGAGATCGAATGCGCCAAAAATTTTTTCGACGATTATCATTGAAAAATCATGATTTAACGGTGAATACAATGAATGAACTCAATCTTCAATTTAAAATATTTATACTAGTGGATACTACAAAATCTTATGTTATACTTACTAAAAGTATGAATAAACTTTTAAGTGTTAGTGAATCTATCGTTTTGATGGGATATGCATCCTACGAAATTAATTTCAACGATCCAACTGTCAAAATTGTTTGTATATTCAGAGATCAAGTAAAGGGACAAAACTTTTCGACGGTTATCAATGAAAAATCACGATTTAACAGTTATTTTAACTCCGATTTTGATGATTTTTTACGTAAAATATTTACACTAGTGGATACCGCAAAATCTTATGTTATACTTAATGAAAACACATTCTACGAAACTAGTTTCAACGATCCAACTGTCAAACATATTTGTATATACTTCAAGATCGCATACGCCAAAAATTGCAAAAAACAAACATTCAGAGATCAAGTAATGAGACAAAACTTTTTGATGGTTATCAATGAAAAATCACGATTTAACGGTTATTTTAAATCTAATTTTGATGATTTTTTACACTTCAATTTAAAATATTTACCCTATGTTAGTGAATCTATCATTTTGATGGGATACGCATTCTATGAAAATAATTTCAACGATCCAACCATCAAACTTGTTTGTATATGCTTCAAGATCGCATACGCCAAAAATTGCAAAAAACAAACATTCAGAGATCAAGTAACGAGACAAAAAATTTCAACGGTTATCAACAAAAAATCACGATTTAACGGTTATTTTAACTCCGATTTTGATGATTTTTTACAGGTACATTCCTTGACCCTATATGAATATAATGAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

433

Amino Acids

50.59

Weight (kDa)

8.91

Isoelectric Point (pI)

28.44

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000158)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g10163
malus_domestica MD04G1068000.v1.1 MD05G1130900.v1.1 MD06G1153600.v1.1 MD10G1255900.v1.1 MD10G1282000.v1.1 MD13G1075400.v1.1 MD13G1192400.v1.1
pyrus_communis pycom01g00130 pycom01g00390 pycom01g00700 pycom01g00720 pycom01g00750 pycom01g00850 pycom01g00870 pycom01g00910 pycom01g01250 pycom01g01560 pycom01g01680 pycom01g01860 pycom01g01900 pycom01g01910 pycom01g02200 pycom01g02260 pycom01g02270 pycom01g02280 pycom01g02330 pycom01g02480 pycom01g02720 pycom01g02730 pycom01g02750 pycom01g02770 pycom01g02780 pycom01g02860 pycom01g02910 pycom01g03540 pycom01g04090 pycom01g04100 pycom01g04150 pycom01g04250 pycom01g04430 pycom01g11810 pycom01g11860 pycom01g11940 pycom01g21380 pycom02g06650 pycom02g08490 pycom02g08600 pycom02g18230 pycom02g18450 pycom02g18800 pycom02g19150 pycom02g20740 pycom02g21340 pycom02g26210 pycom03g12060 pycom03g19060 pycom03g19100 pycom03g19120 pycom04g06890 pycom04g08960 pycom05g01790 pycom05g07910 pycom05g08080 pycom05g08100 pycom05g08570 pycom05g21500 pycom05g22400 pycom05g22510 pycom05g22620 pycom05g23020 pycom05g23720 pycom05g23890 pycom05g24040 pycom07g12080 pycom08g07930 pycom08g11940 pycom09g12120 pycom10g03890 pycom10g23360 pycom10g28250 pycom11g02850 pycom11g14370 pycom11g14400 pycom11g21840 pycom11g21860 pycom11g21980 pycom11g23580 pycom11g23650 pycom11g24050 pycom11g25610 pycom12424g00060 pycom1256g00130 pycom12661g00030 pycom12g09520 pycom12g09530 pycom12g09660 pycom12g09730 pycom12g11210 pycom12g16710 pycom12g16740 pycom12g16750 pycom13g08800 pycom13g18580 pycom13g18670 pycom13g18770 pycom13g22900 pycom13g23050 pycom13g23160 pycom13g23480 pycom13g23610 pycom13g23660 pycom13g23790 pycom13g23840 pycom13g24010 pycom13g24140 pycom13g24210 pycom13g24300 pycom13g24310 pycom13g24480 pycom13g24520 pycom13g24570 pycom13g24730 pycom13g24760 pycom13g24820 pycom13g25010 pycom13g25020 pycom13g25270 pycom13g25620 pycom13g25670 pycom13g25760 pycom13g25800 pycom13g25900 pycom13g26620 pycom13g26640 pycom13g26670 pycom13g26940 pycom13g27040 pycom13g27130 pycom13g27530 pycom13g27770 pycom13g27830 pycom13g27920 pycom13g27940 pycom13g28100 pycom13g28420 pycom13g28430 pycom13g28460 pycom13g28520 pycom13g29160 pycom14g05380 pycom15g03480 pycom15g04370 pycom15g27500 pycom16g13590 pycom16g13610 pycom16g13630 pycom16g14390 pycom16g18310 pycom17g01940 pycom17g04000 pycom17g16100 pycom17g16220 pycom17g16230 pycom17g16340 pycom17g16430 pycom17g16460 pycom17g16740 pycom17g16960 pycom17g17020 pycom17g17090 pycom17g17100 pycom17g17170 pycom17g17430 pycom17g17850 pycom17g18230 pycom17g18250 pycom17g18380 pycom17g21170 pycom17g21330 pycom520g00150 pycom520g00160 pycom808g00030 pycom808g00160 pycom808g00250 pycom808g00290
rosa_chinensis RchiOBHm_Chr5g0054451

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 163
AciI CCGC 4 cut(s) 143, 161, 189, 795
AclWI GGATC 6 cut(s) 101, 153, 383, 641, 845, 1091
AcsI RAATTY 2 cut(s) 446, 1191
AfaI GTAC 1 cut(s) 1266
AfiI CCNNNNNNNGG 2 cut(s) 139, 264
AflIII ACRYGT 2 cut(s) 121, 410
AhlI ACTAGT 4 cut(s) 37, 532, 784, 839
AjnI CCWGG 2 cut(s) 153, 384
AjuI GAANNNNNNNTTGG 2 cut(s) 435, 467
AluBI AGCT 1 cut(s) 328
AluI AGCT 1 cut(s) 328
Alw21I GWGCWC 1 cut(s) 330
Alw26I GTCTC 2 cut(s) 931, 1177
AlwI GGATC 6 cut(s) 101, 153, 383, 641, 845, 1091
Ama87I CYCGRG 1 cut(s) 137
AoxI GGCC 2 cut(s) 134, 157
ApaI GGGCCC 1 cut(s) 161
ApoI RAATTY 2 cut(s) 446, 1191
AseI ATTAAT 2 cut(s) 96, 636
AspLEI GCGC 1 cut(s) 441
AspS9I GGNCC 3 cut(s) 135, 157, 158
AsuC2I CCSGG 1 cut(s) 133
AsuHPI GGTGA 2 cut(s) 247, 499
AvaI CYCGRG 1 cut(s) 137
BaeGI GKGCMC 1 cut(s) 161
BanII GRGCYC 2 cut(s) 161, 330
BauI CACGAG 2 cut(s) 234, 341
Bbv12I GWGCWC 1 cut(s) 330
BccI CCATC 6 cut(s) 122, 350, 607, 946, 1057, 1112
BciT130I CCWGG 2 cut(s) 155, 386
BciVI GTATCC 4 cut(s) 37, 532, 784, 1061
BcnI CCSGG 1 cut(s) 133
BcoDI GTCTC 2 cut(s) 931, 1177
BcuI ACTAGT 4 cut(s) 37, 532, 784, 839
BfaI CTAG 5 cut(s) 38, 275, 533, 785, 840
BfuI GTATCC 4 cut(s) 37, 532, 784, 1061
Bme1390I CCNGG 3 cut(s) 133, 155, 386
BmeT110I CYCGRG 1 cut(s) 137
BmgT120I GGNCC 3 cut(s) 135, 157, 158
BmiI GGNNCC 2 cut(s) 159, 312
BmrFI CCNGG 3 cut(s) 133, 155, 386
BmrI ACTGGG 1 cut(s) 241
BmsI GCATC 1 cut(s) 632
BmuI ACTGGG 1 cut(s) 241
BpuMI CCSGG 1 cut(s) 133
BsaAI YACGTR 1 cut(s) 770
BsaBI GATNNNNATC 2 cut(s) 622, 956
BsaJI CCNNGG 5 cut(s) 138, 154, 211, 384, 385
Bsc4I CCNNNNNNNGG 2 cut(s) 139, 264
Bse1I ACTGG 2 cut(s) 247, 321
Bse8I GATNNNNATC 2 cut(s) 622, 956
BseBI CCWGG 2 cut(s) 155, 386
BseDI CCNNGG 5 cut(s) 138, 154, 211, 384, 385
BseGI GGATG 4 cut(s) 128, 361, 404, 623
BseJI GATNNNNATC 2 cut(s) 622, 956
BseLI CCNNNNNNNGG 2 cut(s) 139, 264
BseNI ACTGG 2 cut(s) 247, 321
BseSI GKGCMC 1 cut(s) 161
BshFI GGCC 2 cut(s) 136, 159
BsiHKAI GWGCWC 1 cut(s) 330
BsiHKCI CYCGRG 1 cut(s) 137
BsiSI CCGG 1 cut(s) 133
BslFI GGGAC 1 cut(s) 705
BslI CCNNNNNNNGG 2 cut(s) 139, 264
BsmAI GTCTC 2 cut(s) 931, 1177
BsmFI GGGAC 1 cut(s) 705
BsmI GAATGC 2 cut(s) 441, 1073
BsnI GGCC 2 cut(s) 136, 159
BsoBI CYCGRG 1 cut(s) 137
Bsp120I GGGCCC 1 cut(s) 157
Bsp1286I GDGCHC 2 cut(s) 161, 330
BspACI CCGC 4 cut(s) 143, 161, 189, 795
BspANI GGCC 2 cut(s) 136, 159
BspHI TCATGA 1 cut(s) 475
BspLI GGNNCC 2 cut(s) 159, 312
BspPI GGATC 6 cut(s) 101, 153, 383, 641, 845, 1091
BsrBI CCGCTC 1 cut(s) 163
BsrI ACTGG 2 cut(s) 247, 321
BssECI CCNNGG 5 cut(s) 138, 154, 211, 384, 385
BssSI CACGAG 2 cut(s) 234, 341
Bst2BI CACGAG 2 cut(s) 234, 341
Bst2UI CCWGG 2 cut(s) 155, 386
Bst4CI ACNGT 9 cut(s) 173, 487, 655, 709, 737, 859, 983, 1201, 1229
BstBAI YACGTR 1 cut(s) 770
BstC8I GCNNGC 1 cut(s) 161
BstEII GGTNACC 1 cut(s) 253
BstF5I GGATG 4 cut(s) 128, 361, 404, 623
BstHHI GCGC 1 cut(s) 441
BstMAI GTCTC 2 cut(s) 931, 1177
BstNI CCWGG 2 cut(s) 155, 386
BstNSI RCATGY 2 cut(s) 125, 414
BstPI GGTNACC 1 cut(s) 253
BstSCI CCNGG 3 cut(s) 131, 153, 384
BstSLI GKGCMC 1 cut(s) 161
BstSNI TACGTA 1 cut(s) 770
BsuI GTATCC 4 cut(s) 37, 532, 784, 1061
BsuRI GGCC 2 cut(s) 136, 159
BtgZI GCGATG 1 cut(s) 405
BtsCI GGATG 4 cut(s) 128, 361, 404, 623
BtsIMutI CAGTG 2 cut(s) 254, 328
Cac8I GCNNGC 1 cut(s) 161
CciI TCATGA 1 cut(s) 475
CfoI GCGC 1 cut(s) 441
Cfr13I GGNCC 3 cut(s) 135, 157, 158
Csp6I GTAC 1 cut(s) 1265
CviAII CATG 4 cut(s) 122, 263, 411, 476
CviJI RGCY 6 cut(s) 136, 159, 198, 278, 320, 328
CviKI_1 RGCY 6 cut(s) 136, 159, 198, 278, 320, 328
CviQI GTAC 1 cut(s) 1265
DraI TTTAAA 3 cut(s) 520, 991, 1026
EciI GGCGGA 1 cut(s) 158
Ecl136II GAGCTC 1 cut(s) 328
Eco105I TACGTA 1 cut(s) 770
Eco24I GRGCYC 2 cut(s) 161, 330
Eco53kI GAGCTC 1 cut(s) 328
Eco88I CYCGRG 1 cut(s) 137
Eco91I GGTNACC 1 cut(s) 253
EcoICRI GAGCTC 1 cut(s) 328
EcoO65I GGTNACC 1 cut(s) 253
EcoRII CCWGG 2 cut(s) 153, 384
EcoT22I ATGCAT 1 cut(s) 625
EcoT38I GRGCYC 2 cut(s) 161, 330
FaeI CATG 4 cut(s) 125, 266, 414, 479
FaqI GGGAC 1 cut(s) 705
FatI CATG 4 cut(s) 121, 262, 410, 475
FauI CCCGC 1 cut(s) 168
FokI GGATG 4 cut(s) 115, 368, 411, 610
FriOI GRGCYC 2 cut(s) 161, 330
FspBI CTAG 5 cut(s) 38, 275, 533, 785, 840
GlaI GCGC 1 cut(s) 440
HaeIII GGCC 2 cut(s) 136, 159
HapII CCGG 1 cut(s) 133
HhaI GCGC 1 cut(s) 441
Hin1II CATG 4 cut(s) 125, 266, 414, 479
Hin6I GCGC 1 cut(s) 439
HinP1I GCGC 1 cut(s) 439
HinfI GANTC 2 cut(s) 599, 1049
HpaII CCGG 1 cut(s) 133
HphI GGTGA 2 cut(s) 247, 499
Hpy188I TCNGA 7 cut(s) 119, 299, 677, 751, 923, 1169, 1243
Hpy188III TCNNGA 8 cut(s) 234, 428, 476, 726, 883, 972, 1129, 1218
Hpy99I CGWCG 2 cut(s) 459, 709
HpyCH4III ACNGT 9 cut(s) 173, 487, 655, 709, 737, 859, 983, 1201, 1229
HpyCH4IV ACGT 1 cut(s) 769
HpyCH4V TGCA 3 cut(s) 623, 906, 1152
HpySE526I ACGT 1 cut(s) 769
Hsp92II CATG 4 cut(s) 125, 266, 414, 479
HspAI GCGC 1 cut(s) 439
LmnI GCTCC 2 cut(s) 168, 333
LpnPI CCDG 8 cut(s) 140, 146, 167, 260, 334, 371, 398, 1247
LweI GCATC 1 cut(s) 632
MaeI CTAG 5 cut(s) 38, 275, 533, 785, 840
MaeII ACGT 1 cut(s) 769
MaeIII GTNAC 4 cut(s) 124, 253, 401, 1177
MbiI CCGCTC 1 cut(s) 163
MboII GAAGA 2 cut(s) 8, 503
MhlI GDGCHC 2 cut(s) 161, 330
MmeI TCCRAC 5 cut(s) 134, 329, 674, 878, 1124
MnlI CCTC 3 cut(s) 133, 221, 350
Mph1103I ATGCAT 1 cut(s) 625
MslI CAYNNNNRTG 1 cut(s) 1061
MspI CCGG 1 cut(s) 133
MspR9I CCNGG 3 cut(s) 133, 155, 386
Mva1269I GAATGC 2 cut(s) 441, 1073
MvaI CCWGG 2 cut(s) 155, 386
NciI CCSGG 1 cut(s) 133
NlaIII CATG 4 cut(s) 125, 266, 414, 479
NlaIV GGNNCC 2 cut(s) 159, 312
NmuCI GTSAC 2 cut(s) 124, 253
NsiI ATGCAT 1 cut(s) 625
NspI RCATGY 2 cut(s) 125, 414
PagI TCATGA 1 cut(s) 475
PasI CCCWGGG 1 cut(s) 385
PciI ACATGT 2 cut(s) 121, 410
PctI GAATGC 2 cut(s) 441, 1073
PfeI GAWTC 2 cut(s) 599, 1049
Ppu21I YACGTR 1 cut(s) 770
PscI ACATGT 2 cut(s) 121, 410
PshBI ATTAAT 2 cut(s) 96, 636
Psp124BI GAGCTC 1 cut(s) 330
Psp6I CCWGG 2 cut(s) 153, 384
PspEI GGTNACC 1 cut(s) 253
PspGI CCWGG 2 cut(s) 153, 384
PspN4I GGNNCC 2 cut(s) 159, 312
PspOMI GGGCCC 1 cut(s) 157
PspPI GGNCC 3 cut(s) 135, 157, 158
RsaI GTAC 1 cut(s) 1266
RsaNI GTAC 1 cut(s) 1265
RseI CAYNNNNRTG 1 cut(s) 1061
SacI GAGCTC 1 cut(s) 330
Sau96I GGNCC 3 cut(s) 135, 157, 158
ScrFI CCNGG 3 cut(s) 133, 155, 386
SduI GDGCHC 2 cut(s) 161, 330
SetI ASST 5 cut(s) 260, 330, 352, 772, 1266
SfaNI GCATC 1 cut(s) 632
SmiMI CAYNNNNRTG 1 cut(s) 1061
SnaBI TACGTA 1 cut(s) 770
SpeI ACTAGT 4 cut(s) 37, 532, 784, 839
SsiI CCGC 4 cut(s) 143, 161, 189, 795
SspI AATATT 3 cut(s) 525, 777, 1031
SspMI CTAG 5 cut(s) 38, 275, 533, 785, 840
SstI GAGCTC 1 cut(s) 330
StyD4I CCNGG 3 cut(s) 131, 153, 384
TaaI ACNGT 9 cut(s) 173, 487, 655, 709, 737, 859, 983, 1201, 1229
TaiI ACGT 1 cut(s) 772
TaqI TCGA 5 cut(s) 12, 427, 433, 454, 704
TfiI GAWTC 2 cut(s) 599, 1049
TscAI CASTG 2 cut(s) 254, 328
TseFI GTSAC 2 cut(s) 124, 253
Tsp45I GTSAC 2 cut(s) 124, 253
TspGWI ACGGA 1 cut(s) 323
TspRI CASTG 2 cut(s) 254, 328
VspI ATTAAT 2 cut(s) 96, 636
XapI RAATTY 2 cut(s) 446, 1191
XceI RCATGY 2 cut(s) 125, 414
XspI CTAG 5 cut(s) 38, 275, 533, 785, 840
Zsp2I ATGCAT 1 cut(s) 625
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.