pycom13g24300

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr13
OG0000158
Physical Location & Seq
Forward (+)
21485869 .. 21488607
2739 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom13g24300.8

Sequence Viewer

Length: 2145 bp
ATGTTGAAAACCACAAAACTTGAGGGTAGTAAACTGAGATTTACCCTAAATCTTATTATACCTATTCGAAGTAGCCACTTGTATTTACTTTCGCGTGATAAGAATTCGACTCTCATTATTTTCTTTCTTAAATCAAAAGAATTAAAACAACAACTGTCACGTCTCGATCCTCACATACGTCCAGGATTGATACGTGATATCACCAAGTATCAAATTCAAGGTTCAAATTGCGTAAAAATTTTCGTATACTTAATGGCTGCATCTAACCTCCTCGTTAAACTGCCTACGTACCTTAAAAAGGGATCAACGCATAAATCACTATGTCTCAACATAATACCACACAACAGGTATGTAACATCACGAGGAACATTCGACGAAGCACAACATAACTCTCTAGCCATATTGGTCAACGAGTCTAATCATAATGACAACAATCACAACCAACATCATTCCATAATCACATCAATGAATAACACATACCATACACCAAAATGCAAGGCTAGACAATCCAAGGAACCAACAAATCCAATGACACGATTTCAGACCACTCAACGAAATCCATCAACATCAGATTCTGAACCACTCGACGGAATCAAAGTACCAAACGGGATTTCGGACCACTCAACGGAATCATGGAGTATAAAGGATTTCAGACCTCTTAACAGAATCCAAATGGATACGATTCCGAGCCACTCAACTGAATCGCGGAGTACAATGCATATCAAACCACTCAATGAAATTCAGCTGGATATGATTATGAACCACTCAATGGAATTCAGAACACTCAACGGAAGCCCAGCGGAACCCAGTTATGGATCACTCAACGGAACCGAGCAGAAGTCCAAGAAATATAGCAATGCCCGAGGAAGAAGACATGAAACAAGTACTCAAAATACAAAAGCTCAACGAAACAAGAAATGGAATAATGATACGATATGTGAAACAAGTCTCGAAGCAACAAACCCCATGACAATGGGTTCATGGTCCACTCGTAGCCCTCACATTTTATCATATCAGGCCAAACATACAAATCAACCACACTCCACAACAAGTTCAATACACAACAAGGTGCACGTTAATCGAGGAAGACACATCATCATGCTGAGCACACTAAGCTCCATAGAATCTCAACAACACTCTAAGATTAGCAACACACCAGAAGAACTCAGGCTAAAATCCAAACCGAAAGATCCACCTATCAGATTTCTGATCCATAACTTCCGAAATTCCACATTATGCTTCCAGAACAACATACTAAAACTTCATTACGATCCAACAGTTAGATGTCTGCCAATCGCAAATTCAAGTGGCAGTCAACTTCCTATTGTCCTCAAATATTATGTACTATTATGTATTAAAGTTGGTAACGATCCAATGGTTGGATTGTCAATTCATCTAATGGCCAAGTGGCGGTCTCTATTAAAACTATACCAAATTAGTCTAGGAAGGGTAGGTGGGGTCTTGGCCCACATGCTGCCGCACTCGGCGGCCGGCCACCCCAACTTCTCAATGAGTGGAGCAAGTTTCATACCTGAGTCGAAGTCCAATTCGGTCGGGAAATGCCTAAATTTTCCCACGAACTTCCAGGACCCTAGTTTTGGGTGTGCTTCAATTCGACCTCCATACGCACTCCAACGCCTCCACCATTGCTTAGGCTTTGTTCATGGCCTCCAGATGAGTGTTTTGATGGTGGTGATCGAAGGTAAGCATTTCCGAAAAGGGTGGATTGTCGTCGGTTCGAGTTTGGATGAAATTGGAAATAGGGACGAAGAGAAATCGACGAAAATCTCATCAGAAACCATGCAACCTATCGGGTTGCATTCGAGTCGCAAGGAGAAACAAGCAAGGATAGAGAATCTAGTGCTTCTCACTCTCTCCCTTCCCCTTCTTTCTTTCTCTTCCCATTGGGCAGCCTTCTTCCTCTCTCCTCTTCCCCTCCTTTCTTTGGTTGGTCTCCCTTTTCCTAGCCACTCACATGGCTTCCTTTCACCAAGACAAGGCTCCCACAAATCTGGAACCTTCCAAATTCATAGCAAAATGACTATTTTGCCCCTACCTTTGTTCGTTTATAACTCCAAATTCCATTCCATTTGCGCTCACACATTCATATCGACACGTACCACCCAAAAATGTAAAGAAATTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

715

Amino Acids

80.57

Weight (kDa)

9.89

Isoelectric Point (pI)

43.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000158)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g10163
malus_domestica MD04G1068000.v1.1 MD05G1130900.v1.1 MD06G1153600.v1.1 MD10G1255900.v1.1 MD10G1282000.v1.1 MD13G1075400.v1.1 MD13G1192400.v1.1
pyrus_communis pycom01g00130 pycom01g00390 pycom01g00700 pycom01g00720 pycom01g00750 pycom01g00850 pycom01g00870 pycom01g00910 pycom01g01250 pycom01g01560 pycom01g01680 pycom01g01860 pycom01g01900 pycom01g01910 pycom01g02200 pycom01g02260 pycom01g02270 pycom01g02280 pycom01g02330 pycom01g02480 pycom01g02720 pycom01g02730 pycom01g02750 pycom01g02770 pycom01g02780 pycom01g02860 pycom01g02910 pycom01g03540 pycom01g04090 pycom01g04100 pycom01g04150 pycom01g04250 pycom01g04430 pycom01g11810 pycom01g11860 pycom01g11940 pycom01g21380 pycom02g06650 pycom02g08490 pycom02g08600 pycom02g18230 pycom02g18450 pycom02g18800 pycom02g19150 pycom02g20740 pycom02g21340 pycom02g26210 pycom03g12060 pycom03g19060 pycom03g19100 pycom03g19120 pycom04g06890 pycom04g08960 pycom05g01790 pycom05g07910 pycom05g08080 pycom05g08100 pycom05g08570 pycom05g21500 pycom05g22400 pycom05g22510 pycom05g22620 pycom05g23020 pycom05g23720 pycom05g23890 pycom05g24040 pycom07g12080 pycom08g07930 pycom08g11940 pycom09g12120 pycom10g03890 pycom10g23360 pycom10g28250 pycom11g02850 pycom11g14370 pycom11g14400 pycom11g21840 pycom11g21860 pycom11g21980 pycom11g23580 pycom11g23650 pycom11g24050 pycom11g25610 pycom12424g00060 pycom1256g00130 pycom12661g00030 pycom12g09520 pycom12g09530 pycom12g09660 pycom12g09730 pycom12g11210 pycom12g16710 pycom12g16740 pycom12g16750 pycom13g08800 pycom13g18580 pycom13g18670 pycom13g18770 pycom13g22900 pycom13g23050 pycom13g23160 pycom13g23480 pycom13g23610 pycom13g23660 pycom13g23790 pycom13g23840 pycom13g24010 pycom13g24140 pycom13g24210 pycom13g24300 pycom13g24310 pycom13g24480 pycom13g24520 pycom13g24570 pycom13g24730 pycom13g24760 pycom13g24820 pycom13g25010 pycom13g25020 pycom13g25270 pycom13g25620 pycom13g25670 pycom13g25760 pycom13g25800 pycom13g25900 pycom13g26620 pycom13g26640 pycom13g26670 pycom13g26940 pycom13g27040 pycom13g27130 pycom13g27530 pycom13g27770 pycom13g27830 pycom13g27920 pycom13g27940 pycom13g28100 pycom13g28420 pycom13g28430 pycom13g28460 pycom13g28520 pycom13g29160 pycom14g05380 pycom15g03480 pycom15g04370 pycom15g27500 pycom16g13590 pycom16g13610 pycom16g13630 pycom16g14390 pycom16g18310 pycom17g01940 pycom17g04000 pycom17g16100 pycom17g16220 pycom17g16230 pycom17g16340 pycom17g16430 pycom17g16460 pycom17g16740 pycom17g16960 pycom17g17020 pycom17g17090 pycom17g17100 pycom17g17170 pycom17g17430 pycom17g17850 pycom17g18230 pycom17g18250 pycom17g18380 pycom17g21170 pycom17g21330 pycom520g00150 pycom520g00160 pycom808g00030 pycom808g00160 pycom808g00250 pycom808g00290
rosa_chinensis RchiOBHm_Chr5g0054451

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 2070
AccB7I CCANNNNNTGG 2 cut(s) 769, 1379
AccI GTMKAC 1 cut(s) 246
AccII CGCG 2 cut(s) 94, 706
AciI CCGC 5 cut(s) 706, 800, 1411, 1478, 1487
AclWI GGATC 7 cut(s) 161, 310, 823, 1184, 1204, 1265, 1364
AcoI YGGCCR 3 cut(s) 1401, 1488, 1492
AfaI GTAC 6 cut(s) 290, 600, 712, 886, 1344, 2119
AflIII ACRYGT 1 cut(s) 2114
AgsI TTSAA 6 cut(s) 7, 218, 225, 1056, 1305, 1611
AjiI CACGTC 1 cut(s) 161
AjnI CCWGG 2 cut(s) 181, 1584
AjuI GAANNNNNNNTTGG 4 cut(s) 595, 627, 1285, 1317
AluBI AGCT 3 cut(s) 745, 902, 1116
AluI AGCT 3 cut(s) 745, 902, 1116
Alw21I GWGCWC 2 cut(s) 1074, 1109
Alw26I GTCTC 5 cut(s) 167, 329, 953, 1419, 1958
Alw44I GTGCAC 1 cut(s) 1070
AlwI GGATC 7 cut(s) 161, 310, 823, 1184, 1204, 1265, 1364
AlwNI CAGNNNCTG 1 cut(s) 575
Ama87I CYCGRG 1 cut(s) 861
AoxI GGCC 6 cut(s) 1017, 1401, 1464, 1488, 1492, 1666
ApaLI GTGCAC 1 cut(s) 1070
ApeKI GCWGC 3 cut(s) 257, 1474, 1910
ArsI GACNNNNNNTTYG 2 cut(s) 1580, 1612
AspLEI GCGC 1 cut(s) 2096
AspS9I GGNCC 4 cut(s) 616, 984, 1465, 1588
AsuHPI GGTGA 3 cut(s) 193, 1705, 1980
AsuII TTCGAA 1 cut(s) 67
AvaI CYCGRG 1 cut(s) 861
AvaII GGWCC 3 cut(s) 616, 984, 1588
BaeGI GKGCMC 1 cut(s) 1074
BalI TGGCCA 1 cut(s) 1403
BauI CACGAG 1 cut(s) 360
BbsI GAAGAC 2 cut(s) 877, 1093
Bbv12I GWGCWC 2 cut(s) 1074, 1109
BbvI GCAGC 3 cut(s) 244, 1461, 1922
BccI CCATC 2 cut(s) 568, 1681
BcgI CGANNNNNNTGC 4 cut(s) 1061, 1095, 1808, 1842
BciT130I CCWGG 2 cut(s) 183, 1586
BciVI GTATCC 1 cut(s) 670
BcoDI GTCTC 5 cut(s) 167, 329, 953, 1419, 1958
BfaI CTAG 6 cut(s) 395, 501, 1442, 1593, 1859, 1965
BfuI GTATCC 1 cut(s) 670
BisI GCNGC 5 cut(s) 258, 1475, 1478, 1488, 1911
BlpI GCTNAGC 1 cut(s) 1103
BlsI GCNGC 5 cut(s) 259, 1476, 1479, 1489, 1912
BmcAI AGTACT 1 cut(s) 886
Bme1390I CCNGG 2 cut(s) 183, 1586
Bme18I GGWCC 3 cut(s) 616, 984, 1588
BmeT110I CYCGRG 1 cut(s) 861
BmgBI CACGTC 1 cut(s) 161
BmgT120I GGNCC 4 cut(s) 616, 984, 1465, 1588
BmiI GGNNCC 6 cut(s) 516, 804, 829, 1590, 2002, 2017
BmrFI CCNGG 2 cut(s) 183, 1586
BmrI ACTGGG 1 cut(s) 801
BmsI GCATC 1 cut(s) 269
BmuI ACTGGG 1 cut(s) 801
BpiI GAAGAC 2 cut(s) 877, 1093
BpmI CTGGAG 1 cut(s) 1655
Bpu10I CCTNAGC 1 cut(s) 1651
Bpu1102I GCTNAGC 1 cut(s) 1103
Bpu14I TTCGAA 1 cut(s) 67
BpuEI CTTGAG 1 cut(s) 41
BsaAI YACGTR 3 cut(s) 194, 288, 2117
BsaI GGTCTC 2 cut(s) 1419, 1958
BsaJI CCNNGG 2 cut(s) 510, 862
Bse118I RCCGGY 1 cut(s) 1490
Bse1I ACTGG 1 cut(s) 807
Bse3DI GCAATG 2 cut(s) 862, 1645
BseBI CCWGG 2 cut(s) 183, 1586
BseDI CCNNGG 2 cut(s) 510, 862
BseGI GGATG 1 cut(s) 1753
BseMI GCAATG 2 cut(s) 862, 1645
BseMII CTCAG 4 cut(s) 26, 1094, 1180, 1524
BseNI ACTGG 1 cut(s) 807
BseRI GAGGAG 2 cut(s) 260, 1917
BseSI GKGCMC 1 cut(s) 1074
BseX3I CGGCCG 1 cut(s) 1488
BseXI GCAGC 3 cut(s) 244, 1461, 1922
BseYI CCCAGC 1 cut(s) 796
Bsh1236I CGCG 2 cut(s) 94, 706
Bsh1285I CGRYCG 2 cut(s) 1491, 1554
BshFI GGCC 6 cut(s) 1019, 1403, 1466, 1490, 1494, 1668
BsiEI CGRYCG 2 cut(s) 1491, 1554
BsiHKAI GWGCWC 2 cut(s) 1074, 1109
BsiHKCI CYCGRG 1 cut(s) 861
BsiSI CCGG 1 cut(s) 1491
BslFI GGGAC 1 cut(s) 1778
BsmAI GTCTC 5 cut(s) 167, 329, 953, 1419, 1958
BsmBI CGTCTC 1 cut(s) 167
BsmFI GGGAC 1 cut(s) 1778
BsmI GAATGC 1 cut(s) 1819
BsnI GGCC 6 cut(s) 1019, 1403, 1466, 1490, 1494, 1668
Bso31I GGTCTC 2 cut(s) 1419, 1958
BsoBI CYCGRG 1 cut(s) 861
Bsp119I TTCGAA 1 cut(s) 67
Bsp1286I GDGCHC 2 cut(s) 1074, 1109
Bsp143I GATC 8 cut(s) 166, 302, 815, 1189, 1209, 1270, 1369, 1695
Bsp1720I GCTNAGC 1 cut(s) 1103
BspACI CCGC 5 cut(s) 706, 800, 1411, 1478, 1487
BspANI GGCC 6 cut(s) 1019, 1403, 1466, 1490, 1494, 1668
BspCNI CTCAG 4 cut(s) 27, 1095, 1179, 1525
BspFNI CGCG 2 cut(s) 94, 706
BspLI GGNNCC 6 cut(s) 516, 804, 829, 1590, 2002, 2017
BspPI GGATC 7 cut(s) 161, 310, 823, 1184, 1204, 1265, 1364
BspT104I TTCGAA 1 cut(s) 67
BspTNI GGTCTC 2 cut(s) 1419, 1958
BsrDI GCAATG 2 cut(s) 862, 1645
BsrFI RCCGGY 1 cut(s) 1490
BsrI ACTGG 1 cut(s) 807
BssAI RCCGGY 1 cut(s) 1490
BssECI CCNNGG 2 cut(s) 510, 862
BssMI GATC 8 cut(s) 166, 302, 815, 1189, 1209, 1270, 1369, 1695
BssNAI GTATAC 1 cut(s) 247
BssSI CACGAG 1 cut(s) 360
BssT1I CCWWGG 1 cut(s) 510
Bst1107I GTATAC 1 cut(s) 247
Bst2BI CACGAG 1 cut(s) 360
Bst2UI CCWGG 2 cut(s) 183, 1586
Bst4CI ACNGT 2 cut(s) 156, 1279
Bst6I CTCTTC 3 cut(s) 1764, 1903, 1935
BstBAI YACGTR 3 cut(s) 194, 288, 2117
BstBI TTCGAA 1 cut(s) 67
BstC8I GCNNGC 1 cut(s) 1492
BstDEI CTNAG 7 cut(s) 35, 1103, 1112, 1140, 1166, 1533, 1651
BstENI CCTNNNNNAGG 1 cut(s) 296
BstF5I GGATG 1 cut(s) 1753
BstFNI CGCG 2 cut(s) 94, 706
BstHHI GCGC 1 cut(s) 2096
BstKTI GATC 8 cut(s) 169, 305, 818, 1192, 1212, 1273, 1372, 1698
BstMAI GTCTC 5 cut(s) 167, 329, 953, 1419, 1958
BstMBI GATC 8 cut(s) 166, 302, 815, 1189, 1209, 1270, 1369, 1695
BstMCI CGRYCG 2 cut(s) 1491, 1554
BstMWI GCNNNNNNNGC 1 cut(s) 1113
BstNI CCWGG 2 cut(s) 183, 1586
BstNSI RCATGY 1 cut(s) 1474
BstSCI CCNGG 2 cut(s) 181, 1584
BstSLI GKGCMC 1 cut(s) 1074
BstSNI TACGTA 1 cut(s) 288
BstUI CGCG 2 cut(s) 94, 706
BstV1I GCAGC 3 cut(s) 244, 1461, 1922
BstV2I GAAGAC 2 cut(s) 877, 1093
BstX2I RGATCY 1 cut(s) 1189
BstXI CCANNNNNNTGG 3 cut(s) 973, 1976, 2012
BstYI RGATCY 1 cut(s) 1189
BstZ17I GTATAC 1 cut(s) 247
BstZI CGGCCG 1 cut(s) 1488
BsuI GTATCC 1 cut(s) 670
BsuRI GGCC 6 cut(s) 1019, 1403, 1466, 1490, 1494, 1668
BtrI CACGTC 1 cut(s) 161
BtsCI GGATG 1 cut(s) 1753
Cac8I GCNNGC 1 cut(s) 1492
CaiI CAGNNNCTG 1 cut(s) 575
CfoI GCGC 1 cut(s) 2096
Cfr10I RCCGGY 1 cut(s) 1490
Cfr13I GGNCC 4 cut(s) 616, 984, 1465, 1588
Csp6I GTAC 6 cut(s) 289, 599, 711, 885, 1343, 2118
CspCI CAANNNNNGTGG 1 cut(s) 36
CviAII CATG 9 cut(s) 633, 875, 967, 981, 1099, 1471, 1664, 1801, 1976
CviQI GTAC 6 cut(s) 289, 599, 711, 885, 1343, 2118
DdeI CTNAG 7 cut(s) 35, 1103, 1112, 1140, 1166, 1533, 1651
DpnI GATC 8 cut(s) 168, 304, 817, 1191, 1211, 1272, 1371, 1697
DpnII GATC 8 cut(s) 166, 302, 815, 1189, 1209, 1270, 1369, 1695
EaeI YGGCCR 3 cut(s) 1401, 1488, 1492
EagI CGGCCG 1 cut(s) 1488
Eam1104I CTCTTC 3 cut(s) 1764, 1903, 1935
EarI CTCTTC 3 cut(s) 1764, 1903, 1935
EclXI CGGCCG 1 cut(s) 1488
Eco105I TACGTA 1 cut(s) 288
Eco130I CCWWGG 1 cut(s) 510
Eco31I GGTCTC 2 cut(s) 1419, 1958
Eco32I GATATC 1 cut(s) 199
Eco47I GGWCC 3 cut(s) 616, 984, 1588
Eco52I CGGCCG 1 cut(s) 1488
Eco88I CYCGRG 1 cut(s) 861
EcoNI CCTNNNNNAGG 1 cut(s) 296
EcoO109I RGGNCCY 1 cut(s) 1588
EcoRI GAATTC 2 cut(s) 103, 773
EcoRII CCWGG 2 cut(s) 181, 1584
EcoRV GATATC 1 cut(s) 199
EcoT14I CCWWGG 1 cut(s) 510
EcoT22I ATGCAT 1 cut(s) 720
ErhI CCWWGG 1 cut(s) 510
Esp3I CGTCTC 1 cut(s) 167
FaeI CATG 9 cut(s) 636, 878, 970, 984, 1102, 1474, 1667, 1804, 1979
FaqI GGGAC 1 cut(s) 1778
FatI CATG 9 cut(s) 632, 874, 966, 980, 1098, 1470, 1663, 1800, 1975
FblI GTMKAC 1 cut(s) 246
Fnu4HI GCNGC 5 cut(s) 258, 1475, 1478, 1488, 1911
FokI GGATG 1 cut(s) 1760
FseI GGCCGGCC 1 cut(s) 1494
Fsp4HI GCNGC 5 cut(s) 258, 1475, 1478, 1488, 1911
FspBI CTAG 6 cut(s) 395, 501, 1442, 1593, 1859, 1965
GlaI GCGC 1 cut(s) 2095
GluI GCNGC 5 cut(s) 258, 1475, 1478, 1488, 1911
GsaI CCCAGC 1 cut(s) 800
GsuI CTGGAG 1 cut(s) 1655
HaeIII GGCC 6 cut(s) 1019, 1403, 1466, 1490, 1494, 1668
HapII CCGG 1 cut(s) 1491
HhaI GCGC 1 cut(s) 2096
Hin1II CATG 9 cut(s) 636, 878, 970, 984, 1102, 1474, 1667, 1804, 1979
Hin6I GCGC 1 cut(s) 2094
HinP1I GCGC 1 cut(s) 2094
HincII GTYRAC 2 cut(s) 409, 1316
HindII GTYRAC 2 cut(s) 409, 1316
HpaII CCGG 1 cut(s) 1491
HphI GGTGA 3 cut(s) 193, 1705, 1980
Hpy166II GTNNAC 6 cut(s) 32, 247, 409, 987, 1072, 1316
Hpy188III TCNNGA 7 cut(s) 164, 360, 950, 1243, 1555, 1672, 2013
Hpy8I GTNNAC 6 cut(s) 32, 247, 409, 987, 1072, 1316
Hpy99I CGWCG 4 cut(s) 377, 590, 1736, 1783
HpyAV CCTTC 6 cut(s) 1440, 1694, 1889, 1895, 1924, 2029
HpyCH4III ACNGT 2 cut(s) 156, 1279
HpyCH4IV ACGT 6 cut(s) 160, 178, 193, 287, 1074, 2116
HpyCH4V TGCA 6 cut(s) 260, 495, 718, 1072, 1804, 1819
HpyF10VI GCNNNNNNNGC 1 cut(s) 1113
HpyF3I CTNAG 7 cut(s) 35, 1103, 1112, 1140, 1166, 1533, 1651
HpySE526I ACGT 6 cut(s) 160, 178, 193, 287, 1074, 2116
Hsp92II CATG 9 cut(s) 636, 878, 970, 984, 1102, 1474, 1667, 1804, 1979
HspAI GCGC 1 cut(s) 2094
KroI GCCGGC 1 cut(s) 1490
KroNI GCCGGC 1 cut(s) 1492
Kzo9I GATC 8 cut(s) 166, 302, 815, 1189, 1209, 1270, 1369, 1695
LmnI GCTCC 3 cut(s) 1121, 1517, 2006
Lsp1109I GCAGC 3 cut(s) 244, 1461, 1922
LweI GCATC 1 cut(s) 269
MaeI CTAG 6 cut(s) 395, 501, 1442, 1593, 1859, 1965
MaeII ACGT 6 cut(s) 160, 178, 193, 287, 1074, 2116
MaeIII GTNAC 3 cut(s) 156, 352, 1364
MalI GATC 8 cut(s) 168, 304, 817, 1191, 1211, 1272, 1371, 1697
MboI GATC 8 cut(s) 166, 302, 815, 1189, 1209, 1270, 1369, 1695
MboII GAAGA 8 cut(s) 879, 882, 1098, 1172, 1781, 1890, 1909, 1922
MflI RGATCY 1 cut(s) 1189
MhlI GDGCHC 2 cut(s) 1074, 1109
MlsI TGGCCA 1 cut(s) 1403
MluNI TGGCCA 1 cut(s) 1403
MlyI GAGTC 4 cut(s) 103, 422, 1544, 1834
MmeI TCCRAC 3 cut(s) 1298, 1360, 1657
Mox20I TGGCCA 1 cut(s) 1403
Mph1103I ATGCAT 1 cut(s) 720
MroNI GCCGGC 1 cut(s) 1490
MscI TGGCCA 1 cut(s) 1403
MseI TTAA 9 cut(s) 129, 143, 251, 276, 294, 660, 1077, 1356, 1421
MslI CAYNNNNRTG 5 cut(s) 464, 490, 971, 1097, 1974
Msp20I TGGCCA 1 cut(s) 1403
MspA1I CMGCKG 2 cut(s) 745, 800
MspI CCGG 1 cut(s) 1491
MspR9I CCNGG 2 cut(s) 183, 1586
Mva1269I GAATGC 1 cut(s) 1819
MvaI CCWGG 2 cut(s) 183, 1586
MvnI CGCG 2 cut(s) 94, 706
MwoI GCNNNNNNNGC 1 cut(s) 1113
NaeI GCCGGC 1 cut(s) 1492
NdeII GATC 8 cut(s) 166, 302, 815, 1189, 1209, 1270, 1369, 1695
NgoMIV GCCGGC 1 cut(s) 1490
NlaIII CATG 9 cut(s) 636, 878, 970, 984, 1102, 1474, 1667, 1804, 1979
NlaIV GGNNCC 6 cut(s) 516, 804, 829, 1590, 2002, 2017
NmeAIII GCCGAG 1 cut(s) 1463
NmuCI GTSAC 1 cut(s) 156
NsiI ATGCAT 1 cut(s) 720
NspI RCATGY 1 cut(s) 1474
NspV TTCGAA 1 cut(s) 67
PctI GAATGC 1 cut(s) 1819
PdiI GCCGGC 1 cut(s) 1492
PfeI GAWTC 8 cut(s) 572, 591, 629, 666, 682, 701, 1124, 1855
PflMI CCANNNNNTGG 2 cut(s) 769, 1379
PfoI TCCNGGA 2 cut(s) 181, 1584
PkrI GCNGC 5 cut(s) 259, 1476, 1479, 1489, 1912
PleI GAGTC 4 cut(s) 103, 421, 1543, 1833
PpsI GAGTC 4 cut(s) 103, 421, 1543, 1833
Ppu21I YACGTR 3 cut(s) 194, 288, 2117
PpuMI RGGWCCY 1 cut(s) 1588
PsiI TTATAA 1 cut(s) 2070
Psp5II RGGWCCY 1 cut(s) 1588
Psp6I CCWGG 2 cut(s) 181, 1584
PspFI CCCAGC 1 cut(s) 796
PspGI CCWGG 2 cut(s) 181, 1584
PspN4I GGNNCC 6 cut(s) 516, 804, 829, 1590, 2002, 2017
PspPI GGNCC 4 cut(s) 616, 984, 1465, 1588
PspPPI RGGWCCY 1 cut(s) 1588
PstNI CAGNNNCTG 1 cut(s) 575
PsuI RGATCY 1 cut(s) 1189
PvuII CAGCTG 1 cut(s) 745
RigI GGCCGGCC 1 cut(s) 1494
RsaI GTAC 6 cut(s) 290, 600, 712, 886, 1344, 2119
RsaNI GTAC 6 cut(s) 289, 599, 711, 885, 1343, 2118
RseI CAYNNNNRTG 5 cut(s) 464, 490, 971, 1097, 1974
SaqAI TTAA 9 cut(s) 129, 143, 251, 276, 294, 660, 1077, 1356, 1421
SatI GCNGC 5 cut(s) 258, 1475, 1478, 1488, 1911
Sau3AI GATC 8 cut(s) 166, 302, 815, 1189, 1209, 1270, 1369, 1695
Sau96I GGNCC 4 cut(s) 616, 984, 1465, 1588
ScaI AGTACT 1 cut(s) 886
SchI GAGTC 4 cut(s) 103, 422, 1544, 1834
ScrFI CCNGG 2 cut(s) 183, 1586
SduI GDGCHC 2 cut(s) 1074, 1109
SfaNI GCATC 1 cut(s) 269
SfuI TTCGAA 1 cut(s) 67
SinI GGWCC 3 cut(s) 616, 984, 1588
SmiMI CAYNNNNRTG 5 cut(s) 464, 490, 971, 1097, 1974
SmlI CTYRAG 1 cut(s) 20
SmoI CTYRAG 1 cut(s) 20
SnaBI TACGTA 1 cut(s) 288
SsiI CCGC 5 cut(s) 706, 800, 1411, 1478, 1487
SspI AATATT 1 cut(s) 1337
SspMI CTAG 6 cut(s) 395, 501, 1442, 1593, 1859, 1965
StyD4I CCNGG 2 cut(s) 181, 1584
StyI CCWWGG 1 cut(s) 510
TaaI ACNGT 2 cut(s) 156, 1279
TaiI ACGT 6 cut(s) 163, 181, 196, 290, 1077, 2119
TaqII GACCGA 1 cut(s) 1540
TatI WGTACW 3 cut(s) 710, 884, 1342
TauI GCSGC 2 cut(s) 1480, 1490
TfiI GAWTC 8 cut(s) 572, 591, 629, 666, 682, 701, 1124, 1855
Tru1I TTAA 9 cut(s) 129, 143, 251, 276, 294, 660, 1077, 1356, 1421
Tru9I TTAA 9 cut(s) 129, 143, 251, 276, 294, 660, 1077, 1356, 1421
TseFI GTSAC 1 cut(s) 156
TseI GCWGC 3 cut(s) 257, 1474, 1910
Tsp45I GTSAC 1 cut(s) 156
TspGWI ACGGA 4 cut(s) 603, 641, 804, 840
Van91I CCANNNNNTGG 2 cut(s) 769, 1379
VneI GTGCAC 1 cut(s) 1070
VpaK11BI GGWCC 3 cut(s) 616, 984, 1588
XagI CCTNNNNNAGG 1 cut(s) 296
XceI RCATGY 1 cut(s) 1474
XmiI GTMKAC 1 cut(s) 246
XspI CTAG 6 cut(s) 395, 501, 1442, 1593, 1859, 1965
ZrmI AGTACT 1 cut(s) 886
Zsp2I ATGCAT 1 cut(s) 720
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.