pycom13g23480

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr13
OG0000158
Physical Location & Seq
Forward (+)
20993614 .. 20994764
1151 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom13g23480.5

Sequence Viewer

Length: 774 bp
ATGAAGCAAACAGACTTTATTAACAAAACCAATCTTGTCTTAAGTTGTTGGAAAAAGCTTCGAAAAATTAAAATTTCTACAAATGCAAGAAGAACAAGGAATAGAAGAACCTTGAGAGATCGAGAGGCTCTGTCTGCTTCCAAGGCACAAAGGATCCGTCTGCTTCCAAGGCACAAAGGATGCAACGTTTATTCAAAGTTGCATTTGTTTCCAATACACAAAGGTTATGACCTTTGTTCAAACATACATAACCTTTTAGAAAAGCTGCATGTCAAACTCATCCCATCCCATGACTGTAACATCCCACATCGCTCGGGGGAGTGGATCCTGAACTCCGAAGTTAAGCGAGTCGCGCGTGAGAGAAATCCCATGATGGGTGACTTACTAGGAAGTTCTCGTGTGAGTTCCCAGAAACAAAACCGTGAGGGCATGCAGGCCAGAGATGTGGTGGACCCTGGGCCGGGATGTGACAATTTTGTATCGGAGCCTAACCCTGGCCGCGTGTGTGCCGACGAGGACGTCGAGCCCCTAAGGGGTGTGGATTGTAACATCCCACATCGCCTAGGAGAGTGGATCCTCTTCGGGTTCCGTAGGAACTCCGAAGTTAAGCGAGTCGCACACGAGAGTAATCCCATGATGGGTGACCCAGTGGGAAGTTCTTGTCCCAAAGCGGACAATATCATGCTACGGTGGTGGAGCAGGCCTGGGATGTGGTGGACCCCAGGCCAGGATGTGATAATGACTACTTTAATTTTCATTCACTTAAATATTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

258

Amino Acids

29.57

Weight (kDa)

9.88

Isoelectric Point (pI)

51.82

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000158)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g10163
malus_domestica MD04G1068000.v1.1 MD05G1130900.v1.1 MD06G1153600.v1.1 MD10G1255900.v1.1 MD10G1282000.v1.1 MD13G1075400.v1.1 MD13G1192400.v1.1
pyrus_communis pycom01g00130 pycom01g00390 pycom01g00700 pycom01g00720 pycom01g00750 pycom01g00850 pycom01g00870 pycom01g00910 pycom01g01250 pycom01g01560 pycom01g01680 pycom01g01860 pycom01g01900 pycom01g01910 pycom01g02200 pycom01g02260 pycom01g02270 pycom01g02280 pycom01g02330 pycom01g02480 pycom01g02720 pycom01g02730 pycom01g02750 pycom01g02770 pycom01g02780 pycom01g02860 pycom01g02910 pycom01g03540 pycom01g04090 pycom01g04100 pycom01g04150 pycom01g04250 pycom01g04430 pycom01g11810 pycom01g11860 pycom01g11940 pycom01g21380 pycom02g06650 pycom02g08490 pycom02g08600 pycom02g18230 pycom02g18450 pycom02g18800 pycom02g19150 pycom02g20740 pycom02g21340 pycom02g26210 pycom03g12060 pycom03g19060 pycom03g19100 pycom03g19120 pycom04g06890 pycom04g08960 pycom05g01790 pycom05g07910 pycom05g08080 pycom05g08100 pycom05g08570 pycom05g21500 pycom05g22400 pycom05g22510 pycom05g22620 pycom05g23020 pycom05g23720 pycom05g23890 pycom05g24040 pycom07g12080 pycom08g07930 pycom08g11940 pycom09g12120 pycom10g03890 pycom10g23360 pycom10g28250 pycom11g02850 pycom11g14370 pycom11g14400 pycom11g21840 pycom11g21860 pycom11g21980 pycom11g23580 pycom11g23650 pycom11g24050 pycom11g25610 pycom12424g00060 pycom1256g00130 pycom12661g00030 pycom12g09520 pycom12g09530 pycom12g09660 pycom12g09730 pycom12g11210 pycom12g16710 pycom12g16740 pycom12g16750 pycom13g08800 pycom13g18580 pycom13g18670 pycom13g18770 pycom13g22900 pycom13g23050 pycom13g23160 pycom13g23480 pycom13g23610 pycom13g23660 pycom13g23790 pycom13g23840 pycom13g24010 pycom13g24140 pycom13g24210 pycom13g24300 pycom13g24310 pycom13g24480 pycom13g24520 pycom13g24570 pycom13g24730 pycom13g24760 pycom13g24820 pycom13g25010 pycom13g25020 pycom13g25270 pycom13g25620 pycom13g25670 pycom13g25760 pycom13g25800 pycom13g25900 pycom13g26620 pycom13g26640 pycom13g26670 pycom13g26940 pycom13g27040 pycom13g27130 pycom13g27530 pycom13g27770 pycom13g27830 pycom13g27920 pycom13g27940 pycom13g28100 pycom13g28420 pycom13g28430 pycom13g28460 pycom13g28520 pycom13g29160 pycom14g05380 pycom15g03480 pycom15g04370 pycom15g27500 pycom16g13590 pycom16g13610 pycom16g13630 pycom16g14390 pycom16g18310 pycom17g01940 pycom17g04000 pycom17g16100 pycom17g16220 pycom17g16230 pycom17g16340 pycom17g16430 pycom17g16460 pycom17g16740 pycom17g16960 pycom17g17020 pycom17g17090 pycom17g17100 pycom17g17170 pycom17g17430 pycom17g17850 pycom17g18230 pycom17g18250 pycom17g18380 pycom17g21170 pycom17g21330 pycom520g00150 pycom520g00160 pycom808g00030 pycom808g00160 pycom808g00250 pycom808g00290
rosa_chinensis RchiOBHm_Chr5g0054451

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 518
AatII GACGTC 1 cut(s) 522
AccII CGCG 3 cut(s) 353, 355, 501
AciI CCGC 2 cut(s) 499, 671
AclI AACGTT 1 cut(s) 186
AclWI GGATC 6 cut(s) 148, 161, 319, 332, 568, 581
AcoI YGGCCR 1 cut(s) 496
AcsI RAATTY 1 cut(s) 72
AcyI GRCGYC 1 cut(s) 519
AfiI CCNNNNNNNGG 7 cut(s) 374, 460, 461, 494, 533, 638, 727
AflII CTTAAG 1 cut(s) 40
AgsI TTSAA 2 cut(s) 195, 240
AjnI CCWGG 5 cut(s) 454, 493, 703, 721, 726
AluBI AGCT 2 cut(s) 58, 265
AluI AGCT 2 cut(s) 58, 265
AlwI GGATC 6 cut(s) 148, 161, 319, 332, 568, 581
Ama87I CYCGRG 1 cut(s) 313
AoxI GGCC 5 cut(s) 435, 458, 496, 701, 724
ApeKI GCWGC 1 cut(s) 265
ApoI RAATTY 1 cut(s) 72
ArsI GACNNNNNNTTYG 2 cut(s) 142, 174
AspA2I CCTAGG 1 cut(s) 562
AspLEI GCGC 1 cut(s) 355
AspS9I GGNCC 3 cut(s) 451, 458, 717
AsuC2I CCSGG 1 cut(s) 462
AsuHPI GGTGA 2 cut(s) 389, 653
AsuII TTCGAA 1 cut(s) 61
AvaI CYCGRG 1 cut(s) 313
AvaII GGWCC 2 cut(s) 451, 717
AvrII CCTAGG 1 cut(s) 562
AxyI CCTNAGG 1 cut(s) 530
BamHI GGATCC 3 cut(s) 153, 324, 573
BanII GRGCYC 1 cut(s) 528
BauI CACGAG 2 cut(s) 396, 620
BbvI GCAGC 1 cut(s) 252
BccI CCATC 3 cut(s) 292, 367, 631
BciT130I CCWGG 5 cut(s) 456, 495, 705, 723, 728
BcnI CCSGG 1 cut(s) 462
BfaI CTAG 2 cut(s) 386, 563
BfrI CTTAAG 1 cut(s) 40
BisI GCNGC 2 cut(s) 266, 499
BlnI CCTAGG 1 cut(s) 562
BlsI GCNGC 2 cut(s) 267, 500
Bme1390I CCNGG 6 cut(s) 456, 462, 495, 705, 723, 728
Bme18I GGWCC 2 cut(s) 451, 717
BmeT110I CYCGRG 1 cut(s) 313
BmgT120I GGNCC 3 cut(s) 451, 458, 717
BmiI GGNNCC 7 cut(s) 155, 326, 453, 486, 575, 587, 719
BmrFI CCNGG 6 cut(s) 456, 462, 495, 705, 723, 728
BmrI ACTGGG 1 cut(s) 641
BmsI GCATC 1 cut(s) 170
BmuI ACTGGG 1 cut(s) 641
Bpu14I TTCGAA 1 cut(s) 61
BpuEI CTTGAG 1 cut(s) 133
BpuMI CCSGG 1 cut(s) 462
BsaHI GRCGYC 1 cut(s) 519
BsaJI CCNNGG 8 cut(s) 141, 167, 454, 455, 493, 562, 704, 721
Bsc4I CCNNNNNNNGG 7 cut(s) 374, 460, 461, 494, 533, 638, 727
Bse1I ACTGG 1 cut(s) 647
Bse21I CCTNAGG 1 cut(s) 530
BseBI CCWGG 5 cut(s) 456, 495, 705, 723, 728
BseDI CCNNGG 8 cut(s) 141, 167, 454, 455, 493, 562, 704, 721
BseGI GGATG 8 cut(s) 185, 279, 284, 300, 470, 549, 714, 736
BseLI CCNNNNNNNGG 7 cut(s) 374, 460, 461, 494, 533, 638, 727
BseNI ACTGG 1 cut(s) 647
BseXI GCAGC 1 cut(s) 252
Bsh1236I CGCG 3 cut(s) 353, 355, 501
BshFI GGCC 5 cut(s) 437, 460, 498, 703, 726
BsiHKCI CYCGRG 1 cut(s) 313
BsiSI CCGG 1 cut(s) 461
BslFI GGGAC 1 cut(s) 648
BslI CCNNNNNNNGG 7 cut(s) 374, 460, 461, 494, 533, 638, 727
BsmFI GGGAC 1 cut(s) 648
BsnI GGCC 5 cut(s) 437, 460, 498, 703, 726
BsoBI CYCGRG 1 cut(s) 313
Bsp119I TTCGAA 1 cut(s) 61
Bsp1286I GDGCHC 1 cut(s) 528
Bsp143I GATC 4 cut(s) 118, 153, 324, 573
BspACI CCGC 2 cut(s) 499, 671
BspANI GGCC 5 cut(s) 437, 460, 498, 703, 726
BspFNI CGCG 3 cut(s) 353, 355, 501
BspLI GGNNCC 7 cut(s) 155, 326, 453, 486, 575, 587, 719
BspPI GGATC 6 cut(s) 148, 161, 319, 332, 568, 581
BspT104I TTCGAA 1 cut(s) 61
BspTI CTTAAG 1 cut(s) 40
BsrI ACTGG 1 cut(s) 647
BssECI CCNNGG 8 cut(s) 141, 167, 454, 455, 493, 562, 704, 721
BssMI GATC 4 cut(s) 118, 153, 324, 573
BssNI GRCGYC 1 cut(s) 519
BssSI CACGAG 2 cut(s) 396, 620
BssT1I CCWWGG 3 cut(s) 141, 167, 562
Bst2BI CACGAG 2 cut(s) 396, 620
Bst2UI CCWGG 5 cut(s) 456, 495, 705, 723, 728
Bst4CI ACNGT 3 cut(s) 296, 422, 690
Bst6I CTCTTC 1 cut(s) 584
BstACI GRCGYC 1 cut(s) 519
BstAFI CTTAAG 1 cut(s) 40
BstBI TTCGAA 1 cut(s) 61
BstC8I GCNNGC 3 cut(s) 431, 435, 701
BstDEI CTNAG 1 cut(s) 530
BstEII GGTNACC 1 cut(s) 641
BstF5I GGATG 8 cut(s) 185, 279, 284, 300, 470, 549, 714, 736
BstFNI CGCG 3 cut(s) 353, 355, 501
BstHHI GCGC 1 cut(s) 355
BstKTI GATC 4 cut(s) 121, 156, 327, 576
BstMBI GATC 4 cut(s) 118, 153, 324, 573
BstMWI GCNNNNNNNGC 4 cut(s) 134, 143, 169, 352
BstNI CCWGG 5 cut(s) 456, 495, 705, 723, 728
BstNSI RCATGY 2 cut(s) 272, 433
BstPI GGTNACC 1 cut(s) 641
BstSCI CCNGG 6 cut(s) 454, 460, 493, 703, 721, 726
BstUI CGCG 3 cut(s) 353, 355, 501
BstV1I GCAGC 1 cut(s) 252
BstX2I RGATCY 3 cut(s) 153, 324, 573
BstXI CCANNNNNNTGG 1 cut(s) 445
BstYI RGATCY 3 cut(s) 153, 324, 573
Bsu36I CCTNAGG 1 cut(s) 530
BsuRI GGCC 5 cut(s) 437, 460, 498, 703, 726
BtgZI GCGATG 2 cut(s) 293, 542
BtsCI GGATG 8 cut(s) 185, 279, 284, 300, 470, 549, 714, 736
BtsIMutI CAGTG 1 cut(s) 654
Cac8I GCNNGC 3 cut(s) 431, 435, 701
CfoI GCGC 1 cut(s) 355
Cfr13I GGNCC 3 cut(s) 451, 458, 717
CviAII CATG 6 cut(s) 269, 290, 370, 430, 634, 682
DdeI CTNAG 1 cut(s) 530
DpnI GATC 4 cut(s) 120, 155, 326, 575
DpnII GATC 4 cut(s) 118, 153, 324, 573
DrdI GACNNNNNNGTC 1 cut(s) 518
DseDI GACNNNNNNGTC 1 cut(s) 518
EaeI YGGCCR 1 cut(s) 496
Eam1104I CTCTTC 1 cut(s) 584
EarI CTCTTC 1 cut(s) 584
Eco130I CCWWGG 3 cut(s) 141, 167, 562
Eco147I AGGCCT 1 cut(s) 703
Eco24I GRGCYC 1 cut(s) 528
Eco47I GGWCC 2 cut(s) 451, 717
Eco81I CCTNAGG 1 cut(s) 530
Eco88I CYCGRG 1 cut(s) 313
Eco91I GGTNACC 1 cut(s) 641
EcoO65I GGTNACC 1 cut(s) 641
EcoRII CCWGG 5 cut(s) 454, 493, 703, 721, 726
EcoT14I CCWWGG 3 cut(s) 141, 167, 562
EcoT38I GRGCYC 1 cut(s) 528
ErhI CCWWGG 3 cut(s) 141, 167, 562
FaeI CATG 6 cut(s) 272, 293, 373, 433, 637, 685
FaiI YATR 9 cut(s) 228, 245, 249, 270, 291, 371, 431, 635, 683
FaqI GGGAC 1 cut(s) 648
FatI CATG 6 cut(s) 268, 289, 369, 429, 633, 681
Fnu4HI GCNGC 2 cut(s) 266, 499
FokI GGATG 8 cut(s) 192, 266, 271, 287, 477, 536, 721, 743
FriOI GRGCYC 1 cut(s) 528
Fsp4HI GCNGC 2 cut(s) 266, 499
FspBI CTAG 2 cut(s) 386, 563
GlaI GCGC 1 cut(s) 354
GluI GCNGC 2 cut(s) 266, 499
HaeIII GGCC 5 cut(s) 437, 460, 498, 703, 726
HapII CCGG 1 cut(s) 461
HhaI GCGC 1 cut(s) 355
Hin1I GRCGYC 1 cut(s) 519
Hin1II CATG 6 cut(s) 272, 293, 373, 433, 637, 685
Hin6I GCGC 1 cut(s) 353
HinP1I GCGC 1 cut(s) 353
HindIII AAGCTT 1 cut(s) 56
HinfI GANTC 2 cut(s) 348, 612
HpaII CCGG 1 cut(s) 461
HphI GGTGA 2 cut(s) 389, 653
Hpy166II GTNNAC 2 cut(s) 451, 717
Hpy188I TCNGA 3 cut(s) 337, 484, 601
Hpy188III TCNNGA 2 cut(s) 122, 328
Hpy8I GTNNAC 2 cut(s) 451, 717
Hpy99I CGWCG 2 cut(s) 515, 524
HpyCH4III ACNGT 3 cut(s) 296, 422, 690
HpyCH4IV ACGT 2 cut(s) 186, 519
HpyCH4V TGCA 5 cut(s) 86, 183, 202, 268, 433
HpyF10VI GCNNNNNNNGC 4 cut(s) 134, 143, 169, 352
HpyF3I CTNAG 1 cut(s) 530
HpySE526I ACGT 2 cut(s) 186, 519
Hsp92I GRCGYC 1 cut(s) 519
Hsp92II CATG 6 cut(s) 272, 293, 373, 433, 637, 685
HspAI GCGC 1 cut(s) 353
Kzo9I GATC 4 cut(s) 118, 153, 324, 573
LmnI GCTCC 2 cut(s) 484, 696
Lsp1109I GCAGC 1 cut(s) 252
LweI GCATC 1 cut(s) 170
MaeI CTAG 2 cut(s) 386, 563
MaeII ACGT 2 cut(s) 186, 519
MaeIII GTNAC 5 cut(s) 296, 377, 467, 545, 641
MalI GATC 4 cut(s) 120, 155, 326, 575
MboI GATC 4 cut(s) 118, 153, 324, 573
MboII GAAGA 3 cut(s) 102, 117, 571
MflI RGATCY 3 cut(s) 153, 324, 573
MhlI GDGCHC 1 cut(s) 528
MluCI AATT 4 cut(s) 66, 72, 472, 750
MlyI GAGTC 2 cut(s) 357, 621
MmeI TCCRAC 1 cut(s) 29
MnlI CCTC 4 cut(s) 118, 418, 508, 587
MseI TTAA 8 cut(s) 21, 41, 69, 342, 606, 749, 764, 772
MspCI CTTAAG 1 cut(s) 40
MspI CCGG 1 cut(s) 461
MspR9I CCNGG 6 cut(s) 456, 462, 495, 705, 723, 728
MvaI CCWGG 5 cut(s) 456, 495, 705, 723, 728
MvnI CGCG 3 cut(s) 353, 355, 501
MwoI GCNNNNNNNGC 4 cut(s) 134, 143, 169, 352
NciI CCSGG 1 cut(s) 462
NdeII GATC 4 cut(s) 118, 153, 324, 573
NlaIII CATG 6 cut(s) 272, 293, 373, 433, 637, 685
NlaIV GGNNCC 7 cut(s) 155, 326, 453, 486, 575, 587, 719
NmuCI GTSAC 3 cut(s) 377, 467, 641
NspI RCATGY 2 cut(s) 272, 433
NspV TTCGAA 1 cut(s) 61
PaeI GCATGC 1 cut(s) 433
PasI CCCWGGG 1 cut(s) 455
PceI AGGCCT 1 cut(s) 703
PcsI WCGNNNNNNNCGW 1 cut(s) 519
PkrI GCNGC 2 cut(s) 267, 500
PleI GAGTC 2 cut(s) 356, 620
PpsI GAGTC 2 cut(s) 356, 620
Psp1406I AACGTT 1 cut(s) 186
Psp6I CCWGG 5 cut(s) 454, 493, 703, 721, 726
PspEI GGTNACC 1 cut(s) 641
PspGI CCWGG 5 cut(s) 454, 493, 703, 721, 726
PspN4I GGNNCC 7 cut(s) 155, 326, 453, 486, 575, 587, 719
PspPI GGNCC 3 cut(s) 451, 458, 717
PsuI RGATCY 3 cut(s) 153, 324, 573
SaqAI TTAA 8 cut(s) 21, 41, 69, 342, 606, 749, 764, 772
SatI GCNGC 2 cut(s) 266, 499
Sau3AI GATC 4 cut(s) 118, 153, 324, 573
Sau96I GGNCC 3 cut(s) 451, 458, 717
SchI GAGTC 2 cut(s) 357, 621
ScrFI CCNGG 6 cut(s) 456, 462, 495, 705, 723, 728
SduI GDGCHC 1 cut(s) 528
SetI ASST 8 cut(s) 60, 113, 189, 226, 234, 255, 267, 522
SfaNI GCATC 1 cut(s) 170
SfuI TTCGAA 1 cut(s) 61
SinI GGWCC 2 cut(s) 451, 717
SmlI CTYRAG 2 cut(s) 40, 112
SmoI CTYRAG 2 cut(s) 40, 112
SphI GCATGC 1 cut(s) 433
Sse9I AATT 4 cut(s) 66, 72, 472, 750
SseBI AGGCCT 1 cut(s) 703
SsiI CCGC 2 cut(s) 499, 671
SspI AATATT 1 cut(s) 769
SspMI CTAG 2 cut(s) 386, 563
StuI AGGCCT 1 cut(s) 703
StyD4I CCNGG 6 cut(s) 454, 460, 493, 703, 721, 726
StyI CCWWGG 3 cut(s) 141, 167, 562
TaaI ACNGT 3 cut(s) 296, 422, 690
TaiI ACGT 2 cut(s) 189, 522
TaqI TCGA 3 cut(s) 61, 121, 522
TasI AATT 4 cut(s) 66, 72, 472, 750
TauI GCSGC 1 cut(s) 501
Tru1I TTAA 8 cut(s) 21, 41, 69, 342, 606, 749, 764, 772
Tru9I TTAA 8 cut(s) 21, 41, 69, 342, 606, 749, 764, 772
TscAI CASTG 1 cut(s) 654
TseFI GTSAC 3 cut(s) 377, 467, 641
TseI GCWGC 1 cut(s) 265
Tsp45I GTSAC 3 cut(s) 377, 467, 641
TspDTI ATGAA 2 cut(s) 17, 745
TspGWI ACGGA 2 cut(s) 146, 578
TspRI CASTG 1 cut(s) 654
Vha464I CTTAAG 1 cut(s) 40
VpaK11BI GGWCC 2 cut(s) 451, 717
XapI RAATTY 1 cut(s) 72
XceI RCATGY 2 cut(s) 272, 433
XcmI CCANNNNNNNNNTGG 1 cut(s) 445
XmaJI CCTAGG 1 cut(s) 562
XspI CTAG 2 cut(s) 386, 563
ZraI GACGTC 1 cut(s) 520
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.