pycom520g00150

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
SuperScaffold_520
Physical Location & Seq
Forward (+)
163795 .. 166080
2286 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom520g00150.17

Sequence Viewer

Length: 1521 bp
ATGATCGATCGTTCTGGACCGGGGATTTTGAGATGTATCTCTATCATGCTGTTCATAGTTAGGGAATTTGAGAAGAATAATTTGGTTGCGTCGCTGATGTTGTTCACAGTTAATTTGGGGTATTGTCATTCATGGTCTATAGGAAGAATAACCGGAAGTCTATTTGTATGCATATGTTTCATTCACATCTTAATTTACTTGCTGCACTTTATTTTTGCTTTAATTAAATTCATCCAAAATCCCCTAGTCATTGTTTTGTTTAGCATCCCTTCTAATCCTCAAAATGGAACAATCCCTACTTACTCATACTACGATTGCATAATTTATAAGAGTTTCTTTGAATTAGAAAATACAAAAATAACAAAGTTAGAAAAACTAACAAATTTGGAGATTAAGGCTTACATAAATGCAATATCCCAAAGACAGAATTTCACCCATACTCTTGTCTATAATCCAAAGTTGAAACACTTCAATTTTGGACTCTGGCGAACTTTATATATTTCAAACAAAATGAGGAAACCGTATTTCTCAAGAGTAAAGATTAACTCTATTTTTTTTTCTTCTATGCATGTCTTAGTGTCTTTCGGTTTATTAGAAAATATGCAATATTTCAAACCAAAAACCGTTAGTTCTTCACTACTTGGCATTATGTTTGCATGTGGAACAATGCAATCATTCATATCATATTTTCATTCACATAATAAAATTAATATTATAATATGTAATTTCCAACAATTAAAATACAACCAAATTGGGAACAACTACTCTCGTATGAAATATAATTTCATAAGGTGGATTATGCACACCATTAAAGATAAGAGTAGGTTGATCCTTGAGGGGAATGAGGCTAAAGTCAAACTAATGAATCAGCCGGTCCAAGAGTTAACACACTATGTACCTCATTCCTATGATGGAAGAAGTTTGTTGTCTACAGAAGTTTTTGGGGTGTTTCCCCACTTTGTTCCTCTCATTCTTAGTTTGTCAAATTTTGAGTCGTGTCTTGAGAGTACGGAATATATAAAGTTCATTGTTGAATTCTGGAGGACGAACGTCTTTAGGATATTGCATTTATGCAAGCCTCAATCTTCAAGTTTGTCAGTTTTTCTAACTTTCTCCCTAGTTGTTCATGTCACATCCCGGCCCGGGATGGATCACTTCCCGGGCCCGCTCCACCATCGTAGCATGATATTGTCCGTTTTGGGCTTACCATTCCCTCACAGTTTTGTTTTTGGGAACTCACGAGCAACTTCCCAGTGGGTCACTCATCATGGGATTGCTCTAGCCCCCTTCTCGCTTAACTTCGGAGTTCCTACGGAACCCGAAGCCAGTGAACTCCCAAAAGGCCTCGTGCTAGGTAGGGATGAGAATATACATATAAGGATCACACCCCTGGGCTGTGAATTTCTTTGTGATTATTATTATTGGAATTCTTGTGTTATTTTCATATTTTCTAATATTGCTCCAACAAAACTAACAAATGTAGTGTCGAGACTAGAGATGTATTGTGTGATGAATATTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

507

Amino Acids

58.56

Weight (kDa)

9.28

Isoelectric Point (pI)

39.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000158)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g10163
malus_domestica MD04G1068000.v1.1 MD05G1130900.v1.1 MD06G1153600.v1.1 MD10G1255900.v1.1 MD10G1282000.v1.1 MD13G1075400.v1.1 MD13G1192400.v1.1
pyrus_communis pycom01g00130 pycom01g00390 pycom01g00700 pycom01g00720 pycom01g00750 pycom01g00850 pycom01g00870 pycom01g00910 pycom01g01250 pycom01g01560 pycom01g01680 pycom01g01860 pycom01g01900 pycom01g01910 pycom01g02200 pycom01g02260 pycom01g02270 pycom01g02280 pycom01g02330 pycom01g02480 pycom01g02720 pycom01g02730 pycom01g02750 pycom01g02770 pycom01g02780 pycom01g02860 pycom01g02910 pycom01g03540 pycom01g04090 pycom01g04100 pycom01g04150 pycom01g04250 pycom01g04430 pycom01g11810 pycom01g11860 pycom01g11940 pycom01g21380 pycom02g06650 pycom02g08490 pycom02g08600 pycom02g18230 pycom02g18450 pycom02g18800 pycom02g19150 pycom02g20740 pycom02g21340 pycom02g26210 pycom03g12060 pycom03g19060 pycom03g19100 pycom03g19120 pycom04g06890 pycom04g08960 pycom05g01790 pycom05g07910 pycom05g08080 pycom05g08100 pycom05g08570 pycom05g21500 pycom05g22400 pycom05g22510 pycom05g22620 pycom05g23020 pycom05g23720 pycom05g23890 pycom05g24040 pycom07g12080 pycom08g07930 pycom08g11940 pycom09g12120 pycom10g03890 pycom10g23360 pycom10g28250 pycom11g02850 pycom11g14370 pycom11g14400 pycom11g21840 pycom11g21860 pycom11g21980 pycom11g23580 pycom11g23650 pycom11g24050 pycom11g25610 pycom12424g00060 pycom1256g00130 pycom12661g00030 pycom12g09520 pycom12g09530 pycom12g09660 pycom12g09730 pycom12g11210 pycom12g16710 pycom12g16740 pycom12g16750 pycom13g08800 pycom13g18580 pycom13g18670 pycom13g18770 pycom13g22900 pycom13g23050 pycom13g23160 pycom13g23480 pycom13g23610 pycom13g23660 pycom13g23790 pycom13g23840 pycom13g24010 pycom13g24140 pycom13g24210 pycom13g24300 pycom13g24310 pycom13g24480 pycom13g24520 pycom13g24570 pycom13g24730 pycom13g24760 pycom13g24820 pycom13g25010 pycom13g25020 pycom13g25270 pycom13g25620 pycom13g25670 pycom13g25760 pycom13g25800 pycom13g25900 pycom13g26620 pycom13g26640 pycom13g26670 pycom13g26940 pycom13g27040 pycom13g27130 pycom13g27530 pycom13g27770 pycom13g27830 pycom13g27920 pycom13g27940 pycom13g28100 pycom13g28420 pycom13g28430 pycom13g28460 pycom13g28520 pycom13g29160 pycom14g05380 pycom15g03480 pycom15g04370 pycom15g27500 pycom16g13590 pycom16g13610 pycom16g13630 pycom16g14390 pycom16g18310 pycom17g01940 pycom17g04000 pycom17g16100 pycom17g16220 pycom17g16230 pycom17g16340 pycom17g16430 pycom17g16460 pycom17g16740 pycom17g16960 pycom17g17020 pycom17g17090 pycom17g17100 pycom17g17170 pycom17g17430 pycom17g17850 pycom17g18230 pycom17g18250 pycom17g18380 pycom17g21170 pycom17g21330 pycom520g00150 pycom520g00160 pycom808g00030 pycom808g00160 pycom808g00250 pycom808g00290
rosa_chinensis RchiOBHm_Chr5g0054451

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 2 cut(s) 327, 716
AccBSI CCGCTC 1 cut(s) 1168
AccI GTMKAC 1 cut(s) 929
AciI CCGC 1 cut(s) 1166
AclWI GGATC 3 cut(s) 823, 1158, 1388
AcsI RAATTY 8 cut(s) 65, 227, 382, 427, 985, 1034, 1400, 1426
AfaI GTAC 2 cut(s) 897, 1009
AfiI CCNNNNNNNGG 2 cut(s) 284, 1143
AgsI TTSAA 7 cut(s) 341, 463, 472, 504, 613, 1034, 1089
AjnI CCWGG 1 cut(s) 1389
AjuI GAANNNNNNNTTGG 2 cut(s) 65, 97
Alw26I GTCTC 1 cut(s) 1483
AlwI GGATC 3 cut(s) 823, 1158, 1388
Ama87I CYCGRG 2 cut(s) 1142, 1159
AoxI GGCC 3 cut(s) 1139, 1162, 1342
ApaI GGGCCC 1 cut(s) 1166
ApeKI GCWGC 1 cut(s) 202
ApoI RAATTY 8 cut(s) 65, 227, 382, 427, 985, 1034, 1400, 1426
ArsI GACNNNNNNTTYG 4 cut(s) 977, 1009, 1469, 1501
AseI ATTAAT 1 cut(s) 708
Asp700I GAANNNNTTC 1 cut(s) 467
AspS9I GGNCC 5 cut(s) 17, 874, 1140, 1162, 1163
AsuC2I CCSGG 6 cut(s) 21, 1138, 1143, 1144, 1160, 1161
AsuHPI GGTGA 1 cut(s) 424
AvaI CYCGRG 2 cut(s) 1142, 1159
AvaII GGWCC 2 cut(s) 17, 874
BaeGI GKGCMC 1 cut(s) 1166
BanII GRGCYC 1 cut(s) 1166
BauI CACGAG 2 cut(s) 1239, 1346
BbvI GCAGC 1 cut(s) 189
BccI CCATC 3 cut(s) 905, 1141, 1182
BciT130I CCWGG 1 cut(s) 1391
BcnI CCSGG 6 cut(s) 21, 1138, 1143, 1144, 1160, 1161
BcoDI GTCTC 1 cut(s) 1483
BfaI CTAG 5 cut(s) 245, 1118, 1280, 1352, 1493
BfmI CTRYAG 2 cut(s) 138, 930
BisI GCNGC 1 cut(s) 203
BlsI GCNGC 1 cut(s) 204
Bme1390I CCNGG 7 cut(s) 21, 1138, 1143, 1144, 1160, 1161, 1391
Bme18I GGWCC 2 cut(s) 17, 874
BmeT110I CYCGRG 2 cut(s) 1142, 1159
BmgT120I GGNCC 5 cut(s) 17, 874, 1140, 1162, 1163
BmiI GGNNCC 2 cut(s) 1164, 1317
BmrFI CCNGG 7 cut(s) 21, 1138, 1143, 1144, 1160, 1161, 1391
BmrI ACTGGG 1 cut(s) 1246
BmsI GCATC 1 cut(s) 273
BmuI ACTGGG 1 cut(s) 1246
BoxI GACNNNNGTC 1 cut(s) 1049
BpmI CTGGAG 1 cut(s) 1060
BpuEI CTTGAG 3 cut(s) 514, 854, 1022
BpuMI CCSGG 6 cut(s) 21, 1138, 1143, 1144, 1160, 1161
Bsa29I ATCGAT 1 cut(s) 6
BsaJI CCNNGG 5 cut(s) 20, 1142, 1159, 1389, 1390
BsaWI WCCGGW 1 cut(s) 152
Bsc4I CCNNNNNNNGG 2 cut(s) 284, 1143
Bse118I RCCGGY 1 cut(s) 871
Bse1I ACTGG 2 cut(s) 1252, 1326
BseBI CCWGG 1 cut(s) 1391
BseCI ATCGAT 1 cut(s) 6
BseDI CCNNGG 5 cut(s) 20, 1142, 1159, 1389, 1390
BseGI GGATG 5 cut(s) 231, 264, 1133, 1152, 1366
BseLI CCNNNNNNNGG 2 cut(s) 284, 1143
BseNI ACTGG 2 cut(s) 1252, 1326
BseSI GKGCMC 1 cut(s) 1166
BseXI GCAGC 1 cut(s) 189
BsgI GTGCAG 1 cut(s) 188
Bsh1285I CGRYCG 1 cut(s) 10
BshFI GGCC 3 cut(s) 1141, 1164, 1344
BshVI ATCGAT 1 cut(s) 6
BsiEI CGRYCG 1 cut(s) 10
BsiHKCI CYCGRG 2 cut(s) 1142, 1159
BsiSI CCGG 6 cut(s) 20, 153, 872, 1138, 1143, 1160
BslI CCNNNNNNNGG 2 cut(s) 284, 1143
BsmAI GTCTC 1 cut(s) 1483
BsnI GGCC 3 cut(s) 1141, 1164, 1344
BsoBI CYCGRG 2 cut(s) 1142, 1159
Bsp120I GGGCCC 1 cut(s) 1162
Bsp1286I GDGCHC 1 cut(s) 1166
Bsp143I GATC 5 cut(s) 3, 7, 828, 1150, 1380
BspACI CCGC 1 cut(s) 1166
BspANI GGCC 3 cut(s) 1141, 1164, 1344
BspDI ATCGAT 1 cut(s) 6
BspLI GGNNCC 2 cut(s) 1164, 1317
BspPI GGATC 3 cut(s) 823, 1158, 1388
BsrBI CCGCTC 1 cut(s) 1168
BsrFI RCCGGY 1 cut(s) 871
BsrI ACTGG 2 cut(s) 1252, 1326
BssAI RCCGGY 1 cut(s) 871
BssECI CCNNGG 5 cut(s) 20, 1142, 1159, 1389, 1390
BssMI GATC 5 cut(s) 3, 7, 828, 1150, 1380
BssSI CACGAG 2 cut(s) 1239, 1346
Bst2BI CACGAG 2 cut(s) 1239, 1346
Bst2UI CCWGG 1 cut(s) 1391
Bst4CI ACNGT 4 cut(s) 109, 522, 625, 1220
BstC8I GCNNGC 2 cut(s) 1076, 1166
BstDEI CTNAG 2 cut(s) 574, 974
BstF5I GGATG 5 cut(s) 231, 264, 1133, 1152, 1366
BstKTI GATC 5 cut(s) 6, 10, 831, 1153, 1383
BstMAI GTCTC 1 cut(s) 1483
BstMBI GATC 5 cut(s) 3, 7, 828, 1150, 1380
BstMCI CGRYCG 1 cut(s) 10
BstNI CCWGG 1 cut(s) 1391
BstNSI RCATGY 2 cut(s) 572, 660
BstPAI GACNNNNGTC 1 cut(s) 1049
BstSCI CCNGG 7 cut(s) 19, 1136, 1141, 1142, 1158, 1159, 1389
BstSFI CTRYAG 2 cut(s) 138, 930
BstSLI GKGCMC 1 cut(s) 1166
BstV1I GCAGC 1 cut(s) 189
Bsu15I ATCGAT 1 cut(s) 6
BsuRI GGCC 3 cut(s) 1141, 1164, 1344
BsuTUI ATCGAT 1 cut(s) 6
BtsCI GGATG 5 cut(s) 231, 264, 1133, 1152, 1366
BtsIMutI CAGTG 2 cut(s) 1259, 1333
Cac8I GCNNGC 2 cut(s) 1076, 1166
Cfr10I RCCGGY 1 cut(s) 871
Cfr13I GGNCC 5 cut(s) 17, 874, 1140, 1162, 1163
Cfr9I CCCGGG 2 cut(s) 1142, 1159
ClaI ATCGAT 1 cut(s) 6
CseI GACGC 1 cut(s) 78
Csp6I GTAC 2 cut(s) 896, 1008
CviAII CATG 7 cut(s) 46, 132, 569, 657, 1127, 1183, 1268
CviQI GTAC 2 cut(s) 896, 1008
DdeI CTNAG 2 cut(s) 574, 974
DpnI GATC 5 cut(s) 5, 9, 830, 1152, 1382
DpnII GATC 5 cut(s) 3, 7, 828, 1150, 1380
Eco147I AGGCCT 1 cut(s) 1344
Eco24I GRGCYC 1 cut(s) 1166
Eco47I GGWCC 2 cut(s) 17, 874
Eco88I CYCGRG 2 cut(s) 1142, 1159
EcoRI GAATTC 2 cut(s) 1034, 1426
EcoRII CCWGG 1 cut(s) 1389
EcoT22I ATGCAT 2 cut(s) 173, 570
EcoT38I GRGCYC 1 cut(s) 1166
FaeI CATG 7 cut(s) 49, 135, 572, 660, 1130, 1186, 1271
FalI AAGNNNNNCTT 2 cut(s) 320, 352
FatI CATG 7 cut(s) 45, 131, 568, 656, 1126, 1182, 1267
FauI CCCGC 1 cut(s) 1173
FauNDI CATATG 1 cut(s) 173
FblI GTMKAC 1 cut(s) 929
Fnu4HI GCNGC 1 cut(s) 203
FokI GGATG 5 cut(s) 218, 251, 1120, 1159, 1373
FriOI GRGCYC 1 cut(s) 1166
Fsp4HI GCNGC 1 cut(s) 203
FspBI CTAG 5 cut(s) 245, 1118, 1280, 1352, 1493
GluI GCNGC 1 cut(s) 203
GsuI CTGGAG 1 cut(s) 1060
HaeIII GGCC 3 cut(s) 1141, 1164, 1344
HapII CCGG 6 cut(s) 20, 153, 872, 1138, 1143, 1160
HgaI GACGC 1 cut(s) 78
Hin1II CATG 7 cut(s) 49, 135, 572, 660, 1130, 1186, 1271
HincII GTYRAC 1 cut(s) 885
HindII GTYRAC 1 cut(s) 885
HinfI GANTC 3 cut(s) 480, 865, 992
HpaI GTTAAC 1 cut(s) 885
HpaII CCGG 6 cut(s) 20, 153, 872, 1138, 1143, 1160
HphI GGTGA 1 cut(s) 424
Hpy166II GTNNAC 4 cut(s) 105, 885, 930, 1331
Hpy188I TCNGA 1 cut(s) 1304
Hpy188III TCNNGA 6 cut(s) 15, 531, 1001, 1039, 1239, 1488
Hpy8I GTNNAC 4 cut(s) 105, 885, 930, 1331
Hpy99I CGWCG 1 cut(s) 94
HpyAV CCTTC 2 cut(s) 279, 1297
HpyCH4III ACNGT 4 cut(s) 109, 522, 625, 1220
HpyCH4IV ACGT 1 cut(s) 1050
HpyF3I CTNAG 2 cut(s) 574, 974
HpySE526I ACGT 1 cut(s) 1050
Hsp92II CATG 7 cut(s) 49, 135, 572, 660, 1130, 1186, 1271
KspAI GTTAAC 1 cut(s) 885
Kzo9I GATC 5 cut(s) 3, 7, 828, 1150, 1380
LmnI GCTCC 2 cut(s) 1173, 1465
Lsp1109I GCAGC 1 cut(s) 189
LweI GCATC 1 cut(s) 273
MaeI CTAG 5 cut(s) 245, 1118, 1280, 1352, 1493
MaeII ACGT 1 cut(s) 1050
MaeIII GTNAC 2 cut(s) 1129, 1258
MalI GATC 5 cut(s) 5, 9, 830, 1152, 1382
MbiI CCGCTC 1 cut(s) 1168
MboI GATC 5 cut(s) 3, 7, 828, 1150, 1380
MboII GAAGA 6 cut(s) 85, 156, 552, 624, 927, 1077
MhlI GDGCHC 1 cut(s) 1166
MlyI GAGTC 2 cut(s) 474, 1001
MmeI TCCRAC 2 cut(s) 754, 1487
Mph1103I ATGCAT 2 cut(s) 173, 570
MroXI GAANNNNTTC 1 cut(s) 467
MslI CAYNNNNRTG 1 cut(s) 906
MspI CCGG 6 cut(s) 20, 153, 872, 1138, 1143, 1160
MspR9I CCNGG 7 cut(s) 21, 1138, 1143, 1144, 1160, 1161, 1391
MvaI CCWGG 1 cut(s) 1391
NciI CCSGG 6 cut(s) 21, 1138, 1143, 1144, 1160, 1161
NdeI CATATG 1 cut(s) 173
NdeII GATC 5 cut(s) 3, 7, 828, 1150, 1380
NlaIII CATG 7 cut(s) 49, 135, 572, 660, 1130, 1186, 1271
NlaIV GGNNCC 2 cut(s) 1164, 1317
NmuCI GTSAC 2 cut(s) 1129, 1258
NsiI ATGCAT 2 cut(s) 173, 570
NspI RCATGY 2 cut(s) 572, 660
PacI TTAATTAA 1 cut(s) 225
PasI CCCWGGG 1 cut(s) 1390
PceI AGGCCT 1 cut(s) 1344
PdmI GAANNNNTTC 1 cut(s) 467
PfeI GAWTC 1 cut(s) 865
PkrI GCNGC 1 cut(s) 204
Ple19I CGATCG 1 cut(s) 10
PleI GAGTC 2 cut(s) 474, 1000
PpsI GAGTC 2 cut(s) 474, 1000
PshAI GACNNNNGTC 1 cut(s) 1049
PshBI ATTAAT 1 cut(s) 708
PsiI TTATAA 2 cut(s) 327, 716
Psp6I CCWGG 1 cut(s) 1389
PspGI CCWGG 1 cut(s) 1389
PspN4I GGNNCC 2 cut(s) 1164, 1317
PspOMI GGGCCC 1 cut(s) 1162
PspPI GGNCC 5 cut(s) 17, 874, 1140, 1162, 1163
PsrI GAACNNNNNNTAC 2 cut(s) 280, 312
PvuI CGATCG 1 cut(s) 10
RsaI GTAC 2 cut(s) 897, 1009
RsaNI GTAC 2 cut(s) 896, 1008
RseI CAYNNNNRTG 1 cut(s) 906
SatI GCNGC 1 cut(s) 203
Sau3AI GATC 5 cut(s) 3, 7, 828, 1150, 1380
Sau96I GGNCC 5 cut(s) 17, 874, 1140, 1162, 1163
SchI GAGTC 2 cut(s) 474, 1001
ScrFI CCNGG 7 cut(s) 21, 1138, 1143, 1144, 1160, 1161, 1391
SduI GDGCHC 1 cut(s) 1166
SetI ASST 5 cut(s) 794, 827, 901, 1053, 1357
SfaNI GCATC 1 cut(s) 273
SfcI CTRYAG 2 cut(s) 138, 930
SinI GGWCC 2 cut(s) 17, 874
SmaI CCCGGG 2 cut(s) 1144, 1161
SmiMI CAYNNNNRTG 1 cut(s) 906
SmlI CTYRAG 3 cut(s) 529, 833, 1001
SmoI CTYRAG 3 cut(s) 529, 833, 1001
SseBI AGGCCT 1 cut(s) 1344
SsiI CCGC 1 cut(s) 1166
SspI AATATT 4 cut(s) 608, 712, 1456, 1516
SspMI CTAG 5 cut(s) 245, 1118, 1280, 1352, 1493
StuI AGGCCT 1 cut(s) 1344
StyD4I CCNGG 7 cut(s) 19, 1136, 1141, 1142, 1158, 1159, 1389
TaaI ACNGT 4 cut(s) 109, 522, 625, 1220
TaiI ACGT 1 cut(s) 1053
TaqI TCGA 2 cut(s) 6, 1487
TfiI GAWTC 1 cut(s) 865
TscAI CASTG 2 cut(s) 1259, 1333
TseFI GTSAC 2 cut(s) 1129, 1258
TseI GCWGC 1 cut(s) 202
Tsp45I GTSAC 2 cut(s) 1129, 1258
TspGWI ACGGA 3 cut(s) 1025, 1183, 1328
TspMI CCCGGG 2 cut(s) 1142, 1159
TspRI CASTG 2 cut(s) 1259, 1333
VpaK11BI GGWCC 2 cut(s) 17, 874
VspI ATTAAT 1 cut(s) 708
XapI RAATTY 8 cut(s) 65, 227, 382, 427, 985, 1034, 1400, 1426
XceI RCATGY 2 cut(s) 572, 660
XmaI CCCGGG 2 cut(s) 1142, 1159
XmiI GTMKAC 1 cut(s) 929
XmnI GAANNNNTTC 1 cut(s) 467
XspI CTAG 5 cut(s) 245, 1118, 1280, 1352, 1493
Zsp2I ATGCAT 2 cut(s) 173, 570
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.