pycom04g06890

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr4
OG0000158
Physical Location & Seq
Forward (+)
7181232 .. 7181558
327 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom04g06890.1

Sequence Viewer

Length: 327 bp
ATGTGGAGGCAGAAAATGTCACATCTCGGCCCGGGGCGGAACCACTTTCCGGGCCTGCTCCACCACTGTAGCACGATATTGTCCGCTTTGGGCCCCGACCACGCCCTCATGGTTTTGTTTCTGGGAACTCACACGAGAACTTCCCGATGGGTCACCCATCCTAGGAATGCTCTCGCGCGCTACTCGCTTAACTTCGGAGTTCCCATGGAACCCGAAGCCAGTGAGTTCCCAAAAGGCCTCGTGCTAGGTAGGGATGAGAATATACATATAAGGATCACTCCCCTGGGCGATGTGGGATGTCACAGAAAAAATATGTGGAATGCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

109

Amino Acids

12.21

Weight (kDa)

10.03

Isoelectric Point (pI)

43.86

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000158)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g10163
malus_domestica MD04G1068000.v1.1 MD05G1130900.v1.1 MD06G1153600.v1.1 MD10G1255900.v1.1 MD10G1282000.v1.1 MD13G1075400.v1.1 MD13G1192400.v1.1
pyrus_communis pycom01g00130 pycom01g00390 pycom01g00700 pycom01g00720 pycom01g00750 pycom01g00850 pycom01g00870 pycom01g00910 pycom01g01250 pycom01g01560 pycom01g01680 pycom01g01860 pycom01g01900 pycom01g01910 pycom01g02200 pycom01g02260 pycom01g02270 pycom01g02280 pycom01g02330 pycom01g02480 pycom01g02720 pycom01g02730 pycom01g02750 pycom01g02770 pycom01g02780 pycom01g02860 pycom01g02910 pycom01g03540 pycom01g04090 pycom01g04100 pycom01g04150 pycom01g04250 pycom01g04430 pycom01g11810 pycom01g11860 pycom01g11940 pycom01g21380 pycom02g06650 pycom02g08490 pycom02g08600 pycom02g18230 pycom02g18450 pycom02g18800 pycom02g19150 pycom02g20740 pycom02g21340 pycom02g26210 pycom03g12060 pycom03g19060 pycom03g19100 pycom03g19120 pycom04g06890 pycom04g08960 pycom05g01790 pycom05g07910 pycom05g08080 pycom05g08100 pycom05g08570 pycom05g21500 pycom05g22400 pycom05g22510 pycom05g22620 pycom05g23020 pycom05g23720 pycom05g23890 pycom05g24040 pycom07g12080 pycom08g07930 pycom08g11940 pycom09g12120 pycom10g03890 pycom10g23360 pycom10g28250 pycom11g02850 pycom11g14370 pycom11g14400 pycom11g21840 pycom11g21860 pycom11g21980 pycom11g23580 pycom11g23650 pycom11g24050 pycom11g25610 pycom12424g00060 pycom1256g00130 pycom12661g00030 pycom12g09520 pycom12g09530 pycom12g09660 pycom12g09730 pycom12g11210 pycom12g16710 pycom12g16740 pycom12g16750 pycom13g08800 pycom13g18580 pycom13g18670 pycom13g18770 pycom13g22900 pycom13g23050 pycom13g23160 pycom13g23480 pycom13g23610 pycom13g23660 pycom13g23790 pycom13g23840 pycom13g24010 pycom13g24140 pycom13g24210 pycom13g24300 pycom13g24310 pycom13g24480 pycom13g24520 pycom13g24570 pycom13g24730 pycom13g24760 pycom13g24820 pycom13g25010 pycom13g25020 pycom13g25270 pycom13g25620 pycom13g25670 pycom13g25760 pycom13g25800 pycom13g25900 pycom13g26620 pycom13g26640 pycom13g26670 pycom13g26940 pycom13g27040 pycom13g27130 pycom13g27530 pycom13g27770 pycom13g27830 pycom13g27920 pycom13g27940 pycom13g28100 pycom13g28420 pycom13g28430 pycom13g28460 pycom13g28520 pycom13g29160 pycom14g05380 pycom15g03480 pycom15g04370 pycom15g27500 pycom16g13590 pycom16g13610 pycom16g13630 pycom16g14390 pycom16g18310 pycom17g01940 pycom17g04000 pycom17g16100 pycom17g16220 pycom17g16230 pycom17g16340 pycom17g16430 pycom17g16460 pycom17g16740 pycom17g16960 pycom17g17020 pycom17g17090 pycom17g17100 pycom17g17170 pycom17g17430 pycom17g17850 pycom17g18230 pycom17g18250 pycom17g18380 pycom17g21170 pycom17g21330 pycom520g00150 pycom520g00160 pycom808g00030 pycom808g00160 pycom808g00250 pycom808g00290
rosa_chinensis RchiOBHm_Chr5g0054451

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 2 cut(s) 176, 178
AciI CCGC 2 cut(s) 37, 84
AclWI GGATC 1 cut(s) 281
AfiI CCNNNNNNNGG 2 cut(s) 49, 162
AjnI CCWGG 1 cut(s) 282
AlwI GGATC 1 cut(s) 281
Ama87I CYCGRG 1 cut(s) 31
AoxI GGCC 4 cut(s) 28, 52, 91, 235
ApaI GGGCCC 1 cut(s) 95
AspA2I CCTAGG 1 cut(s) 161
AspLEI GCGC 2 cut(s) 178, 180
AspS9I GGNCC 4 cut(s) 29, 52, 91, 92
AsuC2I CCSGG 3 cut(s) 32, 33, 51
AsuHPI GGTGA 1 cut(s) 145
AvaI CYCGRG 1 cut(s) 31
AvrII CCTAGG 1 cut(s) 161
BaeGI GKGCMC 1 cut(s) 95
BanII GRGCYC 1 cut(s) 95
BauI CACGAG 2 cut(s) 133, 239
BccI CCATC 2 cut(s) 141, 165
BciT130I CCWGG 1 cut(s) 284
BcnI CCSGG 3 cut(s) 32, 33, 51
BfaI CTAG 2 cut(s) 162, 245
BfmI CTRYAG 1 cut(s) 67
BlnI CCTAGG 1 cut(s) 161
Bme1390I CCNGG 4 cut(s) 32, 33, 51, 284
BmeT110I CYCGRG 1 cut(s) 31
BmgT120I GGNCC 4 cut(s) 29, 52, 91, 92
BmiI GGNNCC 4 cut(s) 41, 93, 94, 210
BmrFI CCNGG 4 cut(s) 32, 33, 51, 284
BpuMI CCSGG 3 cut(s) 32, 33, 51
BsaJI CCNNGG 6 cut(s) 31, 32, 161, 204, 282, 283
Bsc4I CCNNNNNNNGG 2 cut(s) 49, 162
Bse1I ACTGG 1 cut(s) 219
BseBI CCWGG 1 cut(s) 284
BseDI CCNNGG 6 cut(s) 31, 32, 161, 204, 282, 283
BseGI GGATG 3 cut(s) 157, 259, 302
BseLI CCNNNNNNNGG 2 cut(s) 49, 162
BseNI ACTGG 1 cut(s) 219
BsePI GCGCGC 1 cut(s) 176
BseSI GKGCMC 1 cut(s) 95
Bsh1236I CGCG 2 cut(s) 176, 178
BshFI GGCC 4 cut(s) 30, 54, 93, 237
BsiHKCI CYCGRG 1 cut(s) 31
BsiSI CCGG 2 cut(s) 32, 50
BslI CCNNNNNNNGG 2 cut(s) 49, 162
BsmI GAATGC 2 cut(s) 172, 325
BsnI GGCC 4 cut(s) 30, 54, 93, 237
BsoBI CYCGRG 1 cut(s) 31
Bsp120I GGGCCC 1 cut(s) 91
Bsp1286I GDGCHC 1 cut(s) 95
Bsp143I GATC 1 cut(s) 273
Bsp19I CCATGG 1 cut(s) 204
BspACI CCGC 2 cut(s) 37, 84
BspANI GGCC 4 cut(s) 30, 54, 93, 237
BspFNI CGCG 2 cut(s) 176, 178
BspLI GGNNCC 4 cut(s) 41, 93, 94, 210
BspPI GGATC 1 cut(s) 281
BsrI ACTGG 1 cut(s) 219
BssECI CCNNGG 6 cut(s) 31, 32, 161, 204, 282, 283
BssHII GCGCGC 1 cut(s) 176
BssMI GATC 1 cut(s) 273
BssSI CACGAG 2 cut(s) 133, 239
BssT1I CCWWGG 2 cut(s) 161, 204
Bst2BI CACGAG 2 cut(s) 133, 239
Bst2UI CCWGG 1 cut(s) 284
Bst4CI ACNGT 1 cut(s) 68
BstC8I GCNNGC 2 cut(s) 56, 178
BstDSI CCRYGG 1 cut(s) 204
BstEII GGTNACC 1 cut(s) 151
BstF5I GGATG 3 cut(s) 157, 259, 302
BstFNI CGCG 2 cut(s) 176, 178
BstHHI GCGC 2 cut(s) 178, 180
BstKTI GATC 1 cut(s) 276
BstMBI GATC 1 cut(s) 273
BstMWI GCNNNNNNNGC 1 cut(s) 184
BstNI CCWGG 1 cut(s) 284
BstPI GGTNACC 1 cut(s) 151
BstSCI CCNGG 4 cut(s) 30, 31, 49, 282
BstSFI CTRYAG 1 cut(s) 67
BstSLI GKGCMC 1 cut(s) 95
BstUI CGCG 2 cut(s) 176, 178
BsuRI GGCC 4 cut(s) 30, 54, 93, 237
BtgI CCRYGG 1 cut(s) 204
BtgZI GCGATG 1 cut(s) 303
BtsCI GGATG 3 cut(s) 157, 259, 302
BtsIMutI CAGTG 2 cut(s) 64, 226
Cac8I GCNNGC 2 cut(s) 56, 178
CfoI GCGC 2 cut(s) 178, 180
Cfr13I GGNCC 4 cut(s) 29, 52, 91, 92
Cfr9I CCCGGG 1 cut(s) 31
CviAII CATG 2 cut(s) 109, 205
CviJI RGCY 5 cut(s) 30, 54, 93, 218, 237
CviKI_1 RGCY 5 cut(s) 30, 54, 93, 218, 237
DpnI GATC 1 cut(s) 275
DpnII GATC 1 cut(s) 273
EciI GGCGGA 1 cut(s) 52
Eco130I CCWWGG 2 cut(s) 161, 204
Eco147I AGGCCT 1 cut(s) 237
Eco24I GRGCYC 1 cut(s) 95
Eco88I CYCGRG 1 cut(s) 31
Eco91I GGTNACC 1 cut(s) 151
EcoO109I RGGNCCY 1 cut(s) 92
EcoO65I GGTNACC 1 cut(s) 151
EcoRII CCWGG 1 cut(s) 282
EcoT14I CCWWGG 2 cut(s) 161, 204
EcoT38I GRGCYC 1 cut(s) 95
ErhI CCWWGG 2 cut(s) 161, 204
FaeI CATG 2 cut(s) 112, 208
FaiI YATR 6 cut(s) 110, 206, 263, 267, 269, 314
FatI CATG 2 cut(s) 108, 204
FokI GGATG 3 cut(s) 144, 266, 309
FriOI GRGCYC 1 cut(s) 95
FspBI CTAG 2 cut(s) 162, 245
GlaI GCGC 2 cut(s) 177, 179
HaeIII GGCC 4 cut(s) 30, 54, 93, 237
HapII CCGG 2 cut(s) 32, 50
HhaI GCGC 2 cut(s) 178, 180
Hin1II CATG 2 cut(s) 112, 208
Hin6I GCGC 2 cut(s) 176, 178
HinP1I GCGC 2 cut(s) 176, 178
HpaII CCGG 2 cut(s) 32, 50
HphI GGTGA 1 cut(s) 145
Hpy188I TCNGA 1 cut(s) 197
Hpy188III TCNNGA 1 cut(s) 144
HpyCH4III ACNGT 1 cut(s) 68
HpyF10VI GCNNNNNNNGC 1 cut(s) 184
Hsp92II CATG 2 cut(s) 112, 208
HspAI GCGC 2 cut(s) 176, 178
Kzo9I GATC 1 cut(s) 273
LmnI GCTCC 1 cut(s) 63
LpnPI CCDG 7 cut(s) 45, 63, 68, 107, 232, 269, 296
MaeI CTAG 2 cut(s) 162, 245
MaeIII GTNAC 3 cut(s) 18, 151, 299
MalI GATC 1 cut(s) 275
MboI GATC 1 cut(s) 273
MhlI GDGCHC 1 cut(s) 95
MnlI CCTC 2 cut(s) 116, 248
MseI TTAA 1 cut(s) 189
MspI CCGG 2 cut(s) 32, 50
MspR9I CCNGG 4 cut(s) 32, 33, 51, 284
Mva1269I GAATGC 2 cut(s) 172, 325
MvaI CCWGG 1 cut(s) 284
MvnI CGCG 2 cut(s) 176, 178
MwoI GCNNNNNNNGC 1 cut(s) 184
NciI CCSGG 3 cut(s) 32, 33, 51
NcoI CCATGG 1 cut(s) 204
NdeII GATC 1 cut(s) 273
NlaIII CATG 2 cut(s) 112, 208
NlaIV GGNNCC 4 cut(s) 41, 93, 94, 210
NmeAIII GCCGAG 1 cut(s) 6
NmuCI GTSAC 3 cut(s) 18, 151, 299
PasI CCCWGGG 1 cut(s) 283
PauI GCGCGC 1 cut(s) 176
PceI AGGCCT 1 cut(s) 237
PctI GAATGC 2 cut(s) 172, 325
Psp6I CCWGG 1 cut(s) 282
PspEI GGTNACC 1 cut(s) 151
PspGI CCWGG 1 cut(s) 282
PspN4I GGNNCC 4 cut(s) 41, 93, 94, 210
PspOMI GGGCCC 1 cut(s) 91
PspPI GGNCC 4 cut(s) 29, 52, 91, 92
PteI GCGCGC 1 cut(s) 176
SaqAI TTAA 1 cut(s) 189
Sau3AI GATC 1 cut(s) 273
Sau96I GGNCC 4 cut(s) 29, 52, 91, 92
ScrFI CCNGG 4 cut(s) 32, 33, 51, 284
SduI GDGCHC 1 cut(s) 95
SetI ASST 1 cut(s) 250
SfcI CTRYAG 1 cut(s) 67
SmaI CCCGGG 1 cut(s) 33
SseBI AGGCCT 1 cut(s) 237
SsiI CCGC 2 cut(s) 37, 84
SspMI CTAG 2 cut(s) 162, 245
StuI AGGCCT 1 cut(s) 237
StyD4I CCNGG 4 cut(s) 30, 31, 49, 282
StyI CCWWGG 2 cut(s) 161, 204
TaaI ACNGT 1 cut(s) 68
Tru1I TTAA 1 cut(s) 189
Tru9I TTAA 1 cut(s) 189
TscAI CASTG 2 cut(s) 71, 226
TseFI GTSAC 3 cut(s) 18, 151, 299
Tsp45I GTSAC 3 cut(s) 18, 151, 299
TspMI CCCGGG 1 cut(s) 31
TspRI CASTG 2 cut(s) 71, 226
XmaI CCCGGG 1 cut(s) 31
XmaJI CCTAGG 1 cut(s) 161
XspI CTAG 2 cut(s) 162, 245
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.