MD10G1282000.v1.1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr10
OG0000158
Physical Location & Seq
Forward (+)
37275843 .. 37276619
777 bp
Loading structure...
UTR
Exon/CDS
Intron
MD10G1282000.v1.1.491

Sequence Viewer

Length: 777 bp
ATGGTGACTACCTTTGAAGACATACCGCAAAACCGAGGAATTGCAAGCGAAGCAAATTTGTCACATCCCGGCCAGGGGCGGACCACTTCCCAGGCCCGCTCCACCACCGTAGCACGATATTGTCCGCTTTGGGCTTACCATTCCCTCACGGTTTTGTTTTTAGGAACTCACGAGCAACTTCCCAATGGGTCACCCATCCTGGGAGTGCTCTGGCTCCCTTCTCGCTTAACTTTGGAGTTTCCTATGGAACCCGAAGCCAGTGAGCTCCCAAAAAGCCTCGTGCTAGGTAAGGATGAGAATATACATTTAAGGATCACACCCCTGGGCGATGTGGGATGTCACAATCCACCCCCCTTAGGGGCCCGACGTCCTCGTCGGCACACTTCCGGCCAGGGATTGGCTCTGATACCATTTGTCACATCCCGGCTAGGGGCGGACCACTTCCCAGGCCCGCTCCACCACCGTAGCACGATATTGTCCGCTTTGGGCTTACCATTCTCCCTCACGGTTTTGTTTTTGGGAACTCACGAGCAACTTCCCAGTGGGTCACCCATCCTGGGAGTGCTCTGGCTCCCTTCTCGCTTAACTTCGGAGTTTCCTACGGAACCCGAAGCCAGTGAGCTCCCAAAAGGCCTCGTGCTAGGTAAGGATGAGAATATACATTTAAGGATCACTCCCCTGGGCGATGTGGGATGTCACAAAATTACCCATACCAGGCTACTGAGGGAATATGCCACCCTAACAACTCAAATTGGCACGCTTCCGGTGCAAGTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

259

Amino Acids

28.13

Weight (kDa)

7.24

Isoelectric Point (pI)

59.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000158)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g10163
malus_domestica MD04G1068000.v1.1 MD05G1130900.v1.1 MD06G1153600.v1.1 MD10G1255900.v1.1 MD10G1282000.v1.1 MD13G1075400.v1.1 MD13G1192400.v1.1
pyrus_communis pycom01g00130 pycom01g00390 pycom01g00700 pycom01g00720 pycom01g00750 pycom01g00850 pycom01g00870 pycom01g00910 pycom01g01250 pycom01g01560 pycom01g01680 pycom01g01860 pycom01g01900 pycom01g01910 pycom01g02200 pycom01g02260 pycom01g02270 pycom01g02280 pycom01g02330 pycom01g02480 pycom01g02720 pycom01g02730 pycom01g02750 pycom01g02770 pycom01g02780 pycom01g02860 pycom01g02910 pycom01g03540 pycom01g04090 pycom01g04100 pycom01g04150 pycom01g04250 pycom01g04430 pycom01g11810 pycom01g11860 pycom01g11940 pycom01g21380 pycom02g06650 pycom02g08490 pycom02g08600 pycom02g18230 pycom02g18450 pycom02g18800 pycom02g19150 pycom02g20740 pycom02g21340 pycom02g26210 pycom03g12060 pycom03g19060 pycom03g19100 pycom03g19120 pycom04g06890 pycom04g08960 pycom05g01790 pycom05g07910 pycom05g08080 pycom05g08100 pycom05g08570 pycom05g21500 pycom05g22400 pycom05g22510 pycom05g22620 pycom05g23020 pycom05g23720 pycom05g23890 pycom05g24040 pycom07g12080 pycom08g07930 pycom08g11940 pycom09g12120 pycom10g03890 pycom10g23360 pycom10g28250 pycom11g02850 pycom11g14370 pycom11g14400 pycom11g21840 pycom11g21860 pycom11g21980 pycom11g23580 pycom11g23650 pycom11g24050 pycom11g25610 pycom12424g00060 pycom1256g00130 pycom12661g00030 pycom12g09520 pycom12g09530 pycom12g09660 pycom12g09730 pycom12g11210 pycom12g16710 pycom12g16740 pycom12g16750 pycom13g08800 pycom13g18580 pycom13g18670 pycom13g18770 pycom13g22900 pycom13g23050 pycom13g23160 pycom13g23480 pycom13g23610 pycom13g23660 pycom13g23790 pycom13g23840 pycom13g24010 pycom13g24140 pycom13g24210 pycom13g24300 pycom13g24310 pycom13g24480 pycom13g24520 pycom13g24570 pycom13g24730 pycom13g24760 pycom13g24820 pycom13g25010 pycom13g25020 pycom13g25270 pycom13g25620 pycom13g25670 pycom13g25760 pycom13g25800 pycom13g25900 pycom13g26620 pycom13g26640 pycom13g26670 pycom13g26940 pycom13g27040 pycom13g27130 pycom13g27530 pycom13g27770 pycom13g27830 pycom13g27920 pycom13g27940 pycom13g28100 pycom13g28420 pycom13g28430 pycom13g28460 pycom13g28520 pycom13g29160 pycom14g05380 pycom15g03480 pycom15g04370 pycom15g27500 pycom16g13590 pycom16g13610 pycom16g13630 pycom16g14390 pycom16g18310 pycom17g01940 pycom17g04000 pycom17g16100 pycom17g16220 pycom17g16230 pycom17g16340 pycom17g16430 pycom17g16460 pycom17g16740 pycom17g16960 pycom17g17020 pycom17g17090 pycom17g17100 pycom17g17170 pycom17g17430 pycom17g17850 pycom17g18230 pycom17g18250 pycom17g18380 pycom17g21170 pycom17g21330 pycom520g00150 pycom520g00160 pycom808g00030 pycom808g00160 pycom808g00250 pycom808g00290
rosa_chinensis RchiOBHm_Chr5g0054451

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 372
AatII GACGTC 1 cut(s) 370
AccB7I CCANNNNNTGG 1 cut(s) 397
AccBSI CCGCTC 2 cut(s) 99, 454
AciI CCGC 7 cut(s) 26, 79, 97, 125, 434, 452, 480
AclWI GGATC 2 cut(s) 320, 677
AcoI YGGCCR 2 cut(s) 70, 388
AcsI RAATTY 1 cut(s) 55
AcyI GRCGYC 1 cut(s) 367
AgsI TTSAA 1 cut(s) 17
AjnI CCWGG 9 cut(s) 72, 90, 198, 321, 390, 445, 555, 678, 713
AluBI AGCT 2 cut(s) 265, 622
AluI AGCT 2 cut(s) 265, 622
Alw21I GWGCWC 4 cut(s) 210, 267, 567, 624
AlwI GGATC 2 cut(s) 320, 677
AoxI GGCC 6 cut(s) 70, 93, 360, 388, 448, 631
ApaI GGGCCC 1 cut(s) 364
ApoI RAATTY 1 cut(s) 55
AspS9I GGNCC 6 cut(s) 81, 94, 360, 361, 436, 449
AsuC2I CCSGG 2 cut(s) 69, 424
AsuHPI GGTGA 3 cut(s) 16, 183, 540
AvaII GGWCC 2 cut(s) 81, 436
AxyI CCTNAGG 1 cut(s) 355
BaeGI GKGCMC 1 cut(s) 364
BanII GRGCYC 3 cut(s) 267, 364, 624
BauI CACGAG 4 cut(s) 170, 278, 527, 635
BbsI GAAGAC 1 cut(s) 24
Bbv12I GWGCWC 4 cut(s) 210, 267, 567, 624
BccI CCATC 2 cut(s) 203, 560
BciT130I CCWGG 9 cut(s) 74, 92, 200, 323, 392, 447, 557, 680, 715
BcnI CCSGG 2 cut(s) 69, 424
BfaI CTAG 3 cut(s) 284, 428, 641
Bme18I GGWCC 2 cut(s) 81, 436
BmgT120I GGNCC 6 cut(s) 81, 94, 360, 361, 436, 449
BmiI GGNNCC 6 cut(s) 215, 249, 361, 362, 572, 606
BmrI ACTGGG 1 cut(s) 534
BmuI ACTGGG 1 cut(s) 534
BpiI GAAGAC 1 cut(s) 24
BpuMI CCSGG 2 cut(s) 69, 424
BsaHI GRCGYC 1 cut(s) 367
BsaWI WCCGGW 1 cut(s) 763
Bse1I ACTGG 3 cut(s) 258, 540, 615
Bse21I CCTNAGG 1 cut(s) 355
BseBI CCWGG 9 cut(s) 74, 92, 200, 323, 392, 447, 557, 680, 715
BseGI GGATG 8 cut(s) 64, 195, 298, 341, 419, 552, 655, 698
BseMII CTCAG 1 cut(s) 713
BseNI ACTGG 3 cut(s) 258, 540, 615
BseSI GKGCMC 1 cut(s) 364
BshFI GGCC 6 cut(s) 72, 95, 362, 390, 450, 633
BsiHKAI GWGCWC 4 cut(s) 210, 267, 567, 624
BsiSI CCGG 4 cut(s) 69, 387, 424, 764
BsnI GGCC 6 cut(s) 72, 95, 362, 390, 450, 633
Bsp120I GGGCCC 1 cut(s) 360
Bsp1286I GDGCHC 5 cut(s) 210, 267, 364, 567, 624
Bsp143I GATC 2 cut(s) 312, 669
BspACI CCGC 7 cut(s) 26, 79, 97, 125, 434, 452, 480
BspANI GGCC 6 cut(s) 72, 95, 362, 390, 450, 633
BspCNI CTCAG 1 cut(s) 714
BspLI GGNNCC 6 cut(s) 215, 249, 361, 362, 572, 606
BspPI GGATC 2 cut(s) 320, 677
BsrBI CCGCTC 2 cut(s) 99, 454
BsrI ACTGG 3 cut(s) 258, 540, 615
BssMI GATC 2 cut(s) 312, 669
BssNI GRCGYC 1 cut(s) 367
BssSI CACGAG 4 cut(s) 170, 278, 527, 635
Bst2BI CACGAG 4 cut(s) 170, 278, 527, 635
Bst2UI CCWGG 9 cut(s) 74, 92, 200, 323, 392, 447, 557, 680, 715
Bst4CI ACNGT 4 cut(s) 109, 151, 464, 508
BstACI GRCGYC 1 cut(s) 367
BstC8I GCNNGC 4 cut(s) 46, 97, 452, 758
BstDEI CTNAG 2 cut(s) 355, 722
BstEII GGTNACC 2 cut(s) 189, 546
BstF5I GGATG 8 cut(s) 64, 195, 298, 341, 419, 552, 655, 698
BstKTI GATC 2 cut(s) 315, 672
BstMBI GATC 2 cut(s) 312, 669
BstMWI GCNNNNNNNGC 2 cut(s) 50, 766
BstNI CCWGG 9 cut(s) 74, 92, 200, 323, 392, 447, 557, 680, 715
BstPI GGTNACC 2 cut(s) 189, 546
BstSLI GKGCMC 1 cut(s) 364
BstV2I GAAGAC 1 cut(s) 24
Bsu36I CCTNAGG 1 cut(s) 355
BsuRI GGCC 6 cut(s) 72, 95, 362, 390, 450, 633
BtgZI GCGATG 2 cut(s) 342, 699
BtsCI GGATG 8 cut(s) 64, 195, 298, 341, 419, 552, 655, 698
BtsIMutI CAGTG 3 cut(s) 265, 547, 622
Cac8I GCNNGC 4 cut(s) 46, 97, 452, 758
Cfr13I GGNCC 6 cut(s) 81, 94, 360, 361, 436, 449
DdeI CTNAG 2 cut(s) 355, 722
DpnI GATC 2 cut(s) 314, 671
DpnII GATC 2 cut(s) 312, 669
DrdI GACNNNNNNGTC 1 cut(s) 372
DseDI GACNNNNNNGTC 1 cut(s) 372
EaeI YGGCCR 2 cut(s) 70, 388
EciI GGCGGA 2 cut(s) 94, 449
Ecl136II GAGCTC 2 cut(s) 265, 622
Eco147I AGGCCT 1 cut(s) 633
Eco24I GRGCYC 3 cut(s) 267, 364, 624
Eco47I GGWCC 2 cut(s) 81, 436
Eco53kI GAGCTC 2 cut(s) 265, 622
Eco81I CCTNAGG 1 cut(s) 355
Eco91I GGTNACC 2 cut(s) 189, 546
EcoICRI GAGCTC 2 cut(s) 265, 622
EcoO109I RGGNCCY 1 cut(s) 360
EcoO65I GGTNACC 2 cut(s) 189, 546
EcoRII CCWGG 9 cut(s) 72, 90, 198, 321, 390, 445, 555, 678, 713
EcoT38I GRGCYC 3 cut(s) 267, 364, 624
FaiI YATR 7 cut(s) 23, 245, 302, 659, 711, 732, 775
FauI CCCGC 2 cut(s) 104, 459
FokI GGATG 8 cut(s) 51, 182, 305, 348, 406, 539, 662, 705
FriOI GRGCYC 3 cut(s) 267, 364, 624
FspBI CTAG 3 cut(s) 284, 428, 641
HaeIII GGCC 6 cut(s) 72, 95, 362, 390, 450, 633
HapII CCGG 4 cut(s) 69, 387, 424, 764
Hin1I GRCGYC 1 cut(s) 367
HpaII CCGG 4 cut(s) 69, 387, 424, 764
HphI GGTGA 3 cut(s) 16, 183, 540
Hpy188I TCNGA 2 cut(s) 405, 592
Hpy188III TCNNGA 2 cut(s) 170, 527
Hpy99I CGWCG 2 cut(s) 369, 378
HpyAV CCTTC 2 cut(s) 228, 585
HpyCH4III ACNGT 4 cut(s) 109, 151, 464, 508
HpyCH4IV ACGT 1 cut(s) 367
HpyCH4V TGCA 2 cut(s) 44, 769
HpyF10VI GCNNNNNNNGC 2 cut(s) 50, 766
HpyF3I CTNAG 2 cut(s) 355, 722
HpySE526I ACGT 1 cut(s) 367
Hsp92I GRCGYC 1 cut(s) 367
Kzo9I GATC 2 cut(s) 312, 669
LmnI GCTCC 6 cut(s) 104, 219, 270, 459, 576, 627
MaeI CTAG 3 cut(s) 284, 428, 641
MaeII ACGT 1 cut(s) 367
MaeIII GTNAC 7 cut(s) 4, 60, 189, 338, 415, 546, 695
MalI GATC 2 cut(s) 314, 671
MbiI CCGCTC 2 cut(s) 99, 454
MboI GATC 2 cut(s) 312, 669
MboII GAAGA 1 cut(s) 29
MhlI GDGCHC 5 cut(s) 210, 267, 364, 567, 624
MluCI AATT 4 cut(s) 39, 55, 702, 750
MnlI CCTC 7 cut(s) 29, 155, 287, 381, 512, 644, 717
MseI TTAA 4 cut(s) 227, 308, 584, 665
MspI CCGG 4 cut(s) 69, 387, 424, 764
MvaI CCWGG 9 cut(s) 74, 92, 200, 323, 392, 447, 557, 680, 715
MwoI GCNNNNNNNGC 2 cut(s) 50, 766
NciI CCSGG 2 cut(s) 69, 424
NdeII GATC 2 cut(s) 312, 669
NlaIV GGNNCC 6 cut(s) 215, 249, 361, 362, 572, 606
NmuCI GTSAC 7 cut(s) 4, 60, 189, 338, 415, 546, 695
PasI CCCWGGG 2 cut(s) 322, 679
PceI AGGCCT 1 cut(s) 633
PflMI CCANNNNNTGG 1 cut(s) 397
Psp124BI GAGCTC 2 cut(s) 267, 624
Psp6I CCWGG 9 cut(s) 72, 90, 198, 321, 390, 445, 555, 678, 713
PspEI GGTNACC 2 cut(s) 189, 546
PspGI CCWGG 9 cut(s) 72, 90, 198, 321, 390, 445, 555, 678, 713
PspN4I GGNNCC 6 cut(s) 215, 249, 361, 362, 572, 606
PspOMI GGGCCC 1 cut(s) 360
PspPI GGNCC 6 cut(s) 81, 94, 360, 361, 436, 449
SacI GAGCTC 2 cut(s) 267, 624
SaqAI TTAA 4 cut(s) 227, 308, 584, 665
Sau3AI GATC 2 cut(s) 312, 669
Sau96I GGNCC 6 cut(s) 81, 94, 360, 361, 436, 449
SduI GDGCHC 5 cut(s) 210, 267, 364, 567, 624
SetI ASST 6 cut(s) 14, 267, 289, 370, 624, 646
SinI GGWCC 2 cut(s) 81, 436
Sse9I AATT 4 cut(s) 39, 55, 702, 750
SseBI AGGCCT 1 cut(s) 633
SsiI CCGC 7 cut(s) 26, 79, 97, 125, 434, 452, 480
SspMI CTAG 3 cut(s) 284, 428, 641
SstI GAGCTC 2 cut(s) 267, 624
StuI AGGCCT 1 cut(s) 633
TaaI ACNGT 4 cut(s) 109, 151, 464, 508
TaiI ACGT 1 cut(s) 370
TasI AATT 4 cut(s) 39, 55, 702, 750
Tru1I TTAA 4 cut(s) 227, 308, 584, 665
Tru9I TTAA 4 cut(s) 227, 308, 584, 665
TscAI CASTG 3 cut(s) 265, 547, 622
TseFI GTSAC 7 cut(s) 4, 60, 189, 338, 415, 546, 695
Tsp45I GTSAC 7 cut(s) 4, 60, 189, 338, 415, 546, 695
TspGWI ACGGA 1 cut(s) 617
TspRI CASTG 3 cut(s) 265, 547, 622
Van91I CCANNNNNTGG 1 cut(s) 397
VpaK11BI GGWCC 2 cut(s) 81, 436
XapI RAATTY 1 cut(s) 55
XspI CTAG 3 cut(s) 284, 428, 641
ZraI GACGTC 1 cut(s) 368
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.