pycom01g11860

Zinc finger MYM-type protein 1-like

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr1
Physical Location & Seq
Forward (+)
12856795 .. 12857332
538 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom01g11860.4

Sequence Viewer

Length: 408 bp
ATGAAAATAAAACGCTCTAAACTCTTTTTCTATAAACAGCTTGCGTTAGCACATAGTGCGAATAAAACTACACTACAAAAAATATGGGCACTGCACACTATAAATTATTTGTGCCCTTTGAGGTCAAAGGGCACCAACATATGCGTCCATAGACCAATGGCAACCGTGCAGCAACTAAGTTTGTATCTGTGCCCTCTATGGGCGTCACCATTACTAAAAGGGCACAATACACTGTTTGGTGTTCTGACAAACTTGTCAGATGACCTTCTCCATCCATGTTTGCACTATTTTTGTTATTGTTTTGAAATAAAACCAAAAATTTTAAATTTTCATAAAATCAAAGATGGCAAGCAATCCAATAGTAGAAATGGAATGTCTATAATGAAACTACAGAAATATTCCTCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

136

Amino Acids

15.6

Weight (kDa)

9.85

Isoelectric Point (pI)

49.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000158)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g10163
malus_domestica MD04G1068000.v1.1 MD05G1130900.v1.1 MD06G1153600.v1.1 MD10G1255900.v1.1 MD10G1282000.v1.1 MD13G1075400.v1.1 MD13G1192400.v1.1
pyrus_communis pycom01g00130 pycom01g00390 pycom01g00700 pycom01g00720 pycom01g00750 pycom01g00850 pycom01g00870 pycom01g00910 pycom01g01250 pycom01g01560 pycom01g01680 pycom01g01860 pycom01g01900 pycom01g01910 pycom01g02200 pycom01g02260 pycom01g02270 pycom01g02280 pycom01g02330 pycom01g02480 pycom01g02720 pycom01g02730 pycom01g02750 pycom01g02770 pycom01g02780 pycom01g02860 pycom01g02910 pycom01g03540 pycom01g04090 pycom01g04100 pycom01g04150 pycom01g04250 pycom01g04430 pycom01g11810 pycom01g11860 pycom01g11940 pycom01g21380 pycom02g06650 pycom02g08490 pycom02g08600 pycom02g18230 pycom02g18450 pycom02g18800 pycom02g19150 pycom02g20740 pycom02g21340 pycom02g26210 pycom03g12060 pycom03g19060 pycom03g19100 pycom03g19120 pycom04g06890 pycom04g08960 pycom05g01790 pycom05g07910 pycom05g08080 pycom05g08100 pycom05g08570 pycom05g21500 pycom05g22400 pycom05g22510 pycom05g22620 pycom05g23020 pycom05g23720 pycom05g23890 pycom05g24040 pycom07g12080 pycom08g07930 pycom08g11940 pycom09g12120 pycom10g03890 pycom10g23360 pycom10g28250 pycom11g02850 pycom11g14370 pycom11g14400 pycom11g21840 pycom11g21860 pycom11g21980 pycom11g23580 pycom11g23650 pycom11g24050 pycom11g25610 pycom12424g00060 pycom1256g00130 pycom12661g00030 pycom12g09520 pycom12g09530 pycom12g09660 pycom12g09730 pycom12g11210 pycom12g16710 pycom12g16740 pycom12g16750 pycom13g08800 pycom13g18580 pycom13g18670 pycom13g18770 pycom13g22900 pycom13g23050 pycom13g23160 pycom13g23480 pycom13g23610 pycom13g23660 pycom13g23790 pycom13g23840 pycom13g24010 pycom13g24140 pycom13g24210 pycom13g24300 pycom13g24310 pycom13g24480 pycom13g24520 pycom13g24570 pycom13g24730 pycom13g24760 pycom13g24820 pycom13g25010 pycom13g25020 pycom13g25270 pycom13g25620 pycom13g25670 pycom13g25760 pycom13g25800 pycom13g25900 pycom13g26620 pycom13g26640 pycom13g26670 pycom13g26940 pycom13g27040 pycom13g27130 pycom13g27530 pycom13g27770 pycom13g27830 pycom13g27920 pycom13g27940 pycom13g28100 pycom13g28420 pycom13g28430 pycom13g28460 pycom13g28520 pycom13g29160 pycom14g05380 pycom15g03480 pycom15g04370 pycom15g27500 pycom16g13590 pycom16g13610 pycom16g13630 pycom16g14390 pycom16g18310 pycom17g01940 pycom17g04000 pycom17g16100 pycom17g16220 pycom17g16230 pycom17g16340 pycom17g16430 pycom17g16460 pycom17g16740 pycom17g16960 pycom17g17020 pycom17g17090 pycom17g17100 pycom17g17170 pycom17g17430 pycom17g17850 pycom17g18230 pycom17g18250 pycom17g18380 pycom17g21170 pycom17g21330 pycom520g00150 pycom520g00160 pycom808g00030 pycom808g00160 pycom808g00250 pycom808g00290
rosa_chinensis RchiOBHm_Chr5g0054451

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 253
AccB1I GGYRCC 1 cut(s) 131
AcsI RAATTY 2 cut(s) 318, 325
AcyI GRCGYC 1 cut(s) 203
AdeI CACNNNGTG 1 cut(s) 56
AfiI CCNNNNNNNGG 1 cut(s) 199
AgsI TTSAA 1 cut(s) 305
AluBI AGCT 1 cut(s) 40
AluI AGCT 1 cut(s) 40
ApeKI GCWGC 1 cut(s) 169
ApoI RAATTY 2 cut(s) 318, 325
AsuHPI GGTGA 1 cut(s) 198
BaeGI GKGCMC 5 cut(s) 91, 116, 134, 194, 225
BanI GGYRCC 1 cut(s) 131
BbvI GCAGC 1 cut(s) 181
BccI CCATC 2 cut(s) 279, 338
BfmI CTRYAG 1 cut(s) 389
BisI GCNGC 1 cut(s) 170
BlsI GCNGC 1 cut(s) 171
BmiI GGNNCC 1 cut(s) 133
BsaHI GRCGYC 1 cut(s) 203
Bsc4I CCNNNNNNNGG 1 cut(s) 199
BseGI GGATG 1 cut(s) 271
BseLI CCNNNNNNNGG 1 cut(s) 199
BseSI GKGCMC 5 cut(s) 91, 116, 134, 194, 225
BseXI GCAGC 1 cut(s) 181
BsgI GTGCAG 2 cut(s) 77, 188
BshNI GGYRCC 1 cut(s) 131
BslI CCNNNNNNNGG 1 cut(s) 199
Bsp1286I GDGCHC 5 cut(s) 91, 116, 134, 194, 225
BspLI GGNNCC 1 cut(s) 133
BspT107I GGYRCC 1 cut(s) 131
BssNI GRCGYC 1 cut(s) 203
Bst4CI ACNGT 2 cut(s) 166, 234
BstACI GRCGYC 1 cut(s) 203
BstAPI GCANNNNNTGC 1 cut(s) 56
BstC8I GCNNGC 2 cut(s) 42, 350
BstDEI CTNAG 1 cut(s) 176
BstF5I GGATG 1 cut(s) 271
BstMWI GCNNNNNNNGC 1 cut(s) 56
BstSFI CTRYAG 1 cut(s) 389
BstSLI GKGCMC 5 cut(s) 91, 116, 134, 194, 225
BstV1I GCAGC 1 cut(s) 181
BtsCI GGATG 1 cut(s) 271
BtsI GCAGTG 1 cut(s) 89
BtsIMutI CAGTG 2 cut(s) 89, 230
Cac8I GCNNGC 2 cut(s) 42, 350
CseI GACGC 2 cut(s) 133, 192
CviAII CATG 1 cut(s) 276
CviJI RGCY 1 cut(s) 40
CviKI_1 RGCY 1 cut(s) 40
DdeI CTNAG 1 cut(s) 176
DraI TTTAAA 1 cut(s) 324
DraIII CACNNNGTG 1 cut(s) 56
DrdI GACNNNNNNGTC 1 cut(s) 253
DseDI GACNNNNNNGTC 1 cut(s) 253
FaeI CATG 1 cut(s) 279
FatI CATG 1 cut(s) 275
FauNDI CATATG 1 cut(s) 140
Fnu4HI GCNGC 1 cut(s) 170
FokI GGATG 1 cut(s) 258
Fsp4HI GCNGC 1 cut(s) 170
GluI GCNGC 1 cut(s) 170
HgaI GACGC 2 cut(s) 133, 192
Hin1I GRCGYC 1 cut(s) 203
Hin1II CATG 1 cut(s) 279
HphI GGTGA 1 cut(s) 198
Hpy188I TCNGA 2 cut(s) 246, 259
HpyAV CCTTC 1 cut(s) 275
HpyCH4III ACNGT 2 cut(s) 166, 234
HpyCH4V TGCA 3 cut(s) 94, 169, 283
HpyF10VI GCNNNNNNNGC 1 cut(s) 56
HpyF3I CTNAG 1 cut(s) 176
Hsp92I GRCGYC 1 cut(s) 203
Hsp92II CATG 1 cut(s) 279
Lsp1109I GCAGC 1 cut(s) 181
MaeIII GTNAC 1 cut(s) 204
MhlI GDGCHC 5 cut(s) 91, 116, 134, 194, 225
MluCI AATT 3 cut(s) 103, 318, 325
MnlI CCTC 2 cut(s) 114, 204
MseI TTAA 1 cut(s) 323
MwoI GCNNNNNNNGC 1 cut(s) 56
NdeI CATATG 1 cut(s) 140
NlaIII CATG 1 cut(s) 279
NlaIV GGNNCC 1 cut(s) 133
NmuCI GTSAC 1 cut(s) 204
PkrI GCNGC 1 cut(s) 171
PspN4I GGNNCC 1 cut(s) 133
SaqAI TTAA 1 cut(s) 323
SatI GCNGC 1 cut(s) 170
SduI GDGCHC 5 cut(s) 91, 116, 134, 194, 225
SetI ASST 3 cut(s) 42, 125, 267
SfcI CTRYAG 1 cut(s) 389
SgeI CNNG 5 cut(s) 53, 178, 265, 288, 361
Sse9I AATT 3 cut(s) 103, 318, 325
SspI AATATT 1 cut(s) 398
TaaI ACNGT 2 cut(s) 166, 234
TasI AATT 3 cut(s) 103, 318, 325
Tru1I TTAA 1 cut(s) 323
Tru9I TTAA 1 cut(s) 323
TscAI CASTG 2 cut(s) 96, 237
TseFI GTSAC 1 cut(s) 204
TseI GCWGC 1 cut(s) 169
Tsp45I GTSAC 1 cut(s) 204
TspDTI ATGAA 3 cut(s) 17, 320, 398
TspRI CASTG 2 cut(s) 96, 237
XapI RAATTY 2 cut(s) 318, 325
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.