pycom01g00720

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr1
OG0000158
Physical Location & Seq
Forward (+)
716469 .. 717142
674 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom01g00720.2

Sequence Viewer

Length: 474 bp
ATGTTACTTGCATTGATTGACATTACTTGGGTTACTTACATTTTATGTGGAGGCATTCAGATTGTAAGATCCCACATCGCCCAGGGAAGTGATCCTTATATGTATATTCCCATCCCTACCTACACTCCCATGATGGGTGACCCACTGGGAAGCTCTCGTGTGAGTTCCCAGAAACAAAGCCGTGAAGGCGTAGTCGGGGCCCAAAATAGACAATATCGTTCTACGGTGGTGGAGCGGGCCCGGGATGTGACATTTTATGTCGTTTACGTGTCGTGTAAAAAATTTAAAAAAAAAATTTATCATAATTTTCTTTTCTTGACGATTAACACCGTCATATTTGACAACGAATCGATGAGATTTTTCTTACCCAAGATAAAAATAATTAATAGCAACATCCATACACATGATCATGAAACATTGATTTATAACCGCAATTTCCAAGACGAATGTATTGTTGTGACAACCCGTCCCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

158

Amino Acids

18.21

Weight (kDa)

9.32

Isoelectric Point (pI)

40.44

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000158)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g10163
malus_domestica MD04G1068000.v1.1 MD05G1130900.v1.1 MD06G1153600.v1.1 MD10G1255900.v1.1 MD10G1282000.v1.1 MD13G1075400.v1.1 MD13G1192400.v1.1
pyrus_communis pycom01g00130 pycom01g00390 pycom01g00700 pycom01g00720 pycom01g00750 pycom01g00850 pycom01g00870 pycom01g00910 pycom01g01250 pycom01g01560 pycom01g01680 pycom01g01860 pycom01g01900 pycom01g01910 pycom01g02200 pycom01g02260 pycom01g02270 pycom01g02280 pycom01g02330 pycom01g02480 pycom01g02720 pycom01g02730 pycom01g02750 pycom01g02770 pycom01g02780 pycom01g02860 pycom01g02910 pycom01g03540 pycom01g04090 pycom01g04100 pycom01g04150 pycom01g04250 pycom01g04430 pycom01g11810 pycom01g11860 pycom01g11940 pycom01g21380 pycom02g06650 pycom02g08490 pycom02g08600 pycom02g18230 pycom02g18450 pycom02g18800 pycom02g19150 pycom02g20740 pycom02g21340 pycom02g26210 pycom03g12060 pycom03g19060 pycom03g19100 pycom03g19120 pycom04g06890 pycom04g08960 pycom05g01790 pycom05g07910 pycom05g08080 pycom05g08100 pycom05g08570 pycom05g21500 pycom05g22400 pycom05g22510 pycom05g22620 pycom05g23020 pycom05g23720 pycom05g23890 pycom05g24040 pycom07g12080 pycom08g07930 pycom08g11940 pycom09g12120 pycom10g03890 pycom10g23360 pycom10g28250 pycom11g02850 pycom11g14370 pycom11g14400 pycom11g21840 pycom11g21860 pycom11g21980 pycom11g23580 pycom11g23650 pycom11g24050 pycom11g25610 pycom12424g00060 pycom1256g00130 pycom12661g00030 pycom12g09520 pycom12g09530 pycom12g09660 pycom12g09730 pycom12g11210 pycom12g16710 pycom12g16740 pycom12g16750 pycom13g08800 pycom13g18580 pycom13g18670 pycom13g18770 pycom13g22900 pycom13g23050 pycom13g23160 pycom13g23480 pycom13g23610 pycom13g23660 pycom13g23790 pycom13g23840 pycom13g24010 pycom13g24140 pycom13g24210 pycom13g24300 pycom13g24310 pycom13g24480 pycom13g24520 pycom13g24570 pycom13g24730 pycom13g24760 pycom13g24820 pycom13g25010 pycom13g25020 pycom13g25270 pycom13g25620 pycom13g25670 pycom13g25760 pycom13g25800 pycom13g25900 pycom13g26620 pycom13g26640 pycom13g26670 pycom13g26940 pycom13g27040 pycom13g27130 pycom13g27530 pycom13g27770 pycom13g27830 pycom13g27920 pycom13g27940 pycom13g28100 pycom13g28420 pycom13g28430 pycom13g28460 pycom13g28520 pycom13g29160 pycom14g05380 pycom15g03480 pycom15g04370 pycom15g27500 pycom16g13590 pycom16g13610 pycom16g13630 pycom16g14390 pycom16g18310 pycom17g01940 pycom17g04000 pycom17g16100 pycom17g16220 pycom17g16230 pycom17g16340 pycom17g16430 pycom17g16460 pycom17g16740 pycom17g16960 pycom17g17020 pycom17g17090 pycom17g17100 pycom17g17170 pycom17g17430 pycom17g17850 pycom17g18230 pycom17g18250 pycom17g18380 pycom17g21170 pycom17g21330 pycom520g00150 pycom520g00160 pycom808g00030 pycom808g00160 pycom808g00250 pycom808g00290
rosa_chinensis RchiOBHm_Chr5g0054451

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 426
AccBSI CCGCTC 1 cut(s) 235
AciI CCGC 2 cut(s) 235, 430
AclWI GGATC 2 cut(s) 63, 86
AcsI RAATTY 2 cut(s) 281, 294
AfiI CCNNNNNNNGG 1 cut(s) 134
AflIII ACRYGT 1 cut(s) 267
AhdI GACNNNNNGTC 1 cut(s) 465
AjnI CCWGG 1 cut(s) 81
AluBI AGCT 1 cut(s) 153
AluI AGCT 1 cut(s) 153
AlwI GGATC 2 cut(s) 63, 86
Ama87I CYCGRG 1 cut(s) 240
AoxI GGCC 2 cut(s) 198, 237
ApaI GGGCCC 2 cut(s) 202, 241
ApoI RAATTY 2 cut(s) 281, 294
AseI ATTAAT 1 cut(s) 384
AspS9I GGNCC 4 cut(s) 198, 199, 237, 238
AsuC2I CCSGG 2 cut(s) 241, 242
AsuHPI GGTGA 1 cut(s) 149
AvaI CYCGRG 1 cut(s) 240
BaeGI GKGCMC 2 cut(s) 202, 241
BanII GRGCYC 2 cut(s) 202, 241
BauI CACGAG 1 cut(s) 156
BccI CCATC 2 cut(s) 119, 127
BceAI ACGGC 1 cut(s) 165
BciT130I CCWGG 1 cut(s) 83
BclI TGATCA 1 cut(s) 406
BcnI CCSGG 2 cut(s) 241, 242
BglI GCCNNNNNGGC 1 cut(s) 186
Bme1390I CCNGG 3 cut(s) 83, 241, 242
BmeRI GACNNNNNGTC 1 cut(s) 465
BmeT110I CYCGRG 1 cut(s) 240
BmgT120I GGNCC 4 cut(s) 198, 199, 237, 238
BmiI GGNNCC 3 cut(s) 199, 200, 239
BmrFI CCNGG 3 cut(s) 83, 241, 242
BmrI ACTGGG 1 cut(s) 155
BmuI ACTGGG 1 cut(s) 155
BpuMI CCSGG 2 cut(s) 241, 242
Bsa29I ATCGAT 1 cut(s) 350
BsaAI YACGTR 1 cut(s) 268
BsaJI CCNNGG 3 cut(s) 81, 82, 240
BsaXI ACNNNNNCTCC 2 cut(s) 109, 139
Bsc4I CCNNNNNNNGG 1 cut(s) 134
Bse1I ACTGG 1 cut(s) 150
BseBI CCWGG 1 cut(s) 83
BseCI ATCGAT 1 cut(s) 350
BseDI CCNNGG 3 cut(s) 81, 82, 240
BseGI GGATG 3 cut(s) 111, 250, 393
BseLI CCNNNNNNNGG 1 cut(s) 134
BseNI ACTGG 1 cut(s) 150
BseSI GKGCMC 2 cut(s) 202, 241
BshFI GGCC 2 cut(s) 200, 239
BshVI ATCGAT 1 cut(s) 350
BsiHKCI CYCGRG 1 cut(s) 240
BsiSI CCGG 1 cut(s) 241
BslFI GGGAC 1 cut(s) 453
BslI CCNNNNNNNGG 1 cut(s) 134
BsmFI GGGAC 1 cut(s) 453
BsmI GAATGC 1 cut(s) 54
BsnI GGCC 2 cut(s) 200, 239
BsoBI CYCGRG 1 cut(s) 240
Bsp120I GGGCCC 2 cut(s) 198, 237
Bsp1286I GDGCHC 2 cut(s) 202, 241
Bsp143I GATC 3 cut(s) 68, 91, 406
BspACI CCGC 2 cut(s) 235, 430
BspANI GGCC 2 cut(s) 200, 239
BspDI ATCGAT 1 cut(s) 350
BspHI TCATGA 1 cut(s) 409
BspLI GGNNCC 3 cut(s) 199, 200, 239
BspPI GGATC 2 cut(s) 63, 86
BsrBI CCGCTC 1 cut(s) 235
BsrI ACTGG 1 cut(s) 150
BssECI CCNNGG 3 cut(s) 81, 82, 240
BssMI GATC 3 cut(s) 68, 91, 406
BssSI CACGAG 1 cut(s) 156
Bst2BI CACGAG 1 cut(s) 156
Bst2UI CCWGG 1 cut(s) 83
Bst4CI ACNGT 2 cut(s) 226, 331
BstBAI YACGTR 1 cut(s) 268
BstC8I GCNNGC 1 cut(s) 237
BstEII GGTNACC 1 cut(s) 137
BstF5I GGATG 3 cut(s) 111, 250, 393
BstKTI GATC 3 cut(s) 71, 94, 409
BstMBI GATC 3 cut(s) 68, 91, 406
BstMWI GCNNNNNNNGC 1 cut(s) 186
BstNI CCWGG 1 cut(s) 83
BstPI GGTNACC 1 cut(s) 137
BstSCI CCNGG 3 cut(s) 81, 239, 240
BstSLI GKGCMC 2 cut(s) 202, 241
BstX2I RGATCY 1 cut(s) 68
BstYI RGATCY 1 cut(s) 68
Bsu15I ATCGAT 1 cut(s) 350
BsuRI GGCC 2 cut(s) 200, 239
BsuTUI ATCGAT 1 cut(s) 350
BtgZI GCGATG 1 cut(s) 61
BtsCI GGATG 3 cut(s) 111, 250, 393
BtsIMutI CAGTG 1 cut(s) 143
Cac8I GCNNGC 1 cut(s) 237
CciI TCATGA 1 cut(s) 409
Cfr13I GGNCC 4 cut(s) 198, 199, 237, 238
Cfr9I CCCGGG 1 cut(s) 240
ClaI ATCGAT 1 cut(s) 350
CviAII CATG 3 cut(s) 130, 404, 410
CviJI RGCY 4 cut(s) 153, 180, 200, 239
CviKI_1 RGCY 4 cut(s) 153, 180, 200, 239
DpnI GATC 3 cut(s) 70, 93, 408
DpnII GATC 3 cut(s) 68, 91, 406
DraI TTTAAA 1 cut(s) 286
DriI GACNNNNNGTC 1 cut(s) 465
Eam1105I GACNNNNNGTC 1 cut(s) 465
Eco24I GRGCYC 2 cut(s) 202, 241
Eco88I CYCGRG 1 cut(s) 240
Eco91I GGTNACC 1 cut(s) 137
EcoO109I RGGNCCY 1 cut(s) 198
EcoO65I GGTNACC 1 cut(s) 137
EcoRII CCWGG 1 cut(s) 81
EcoT38I GRGCYC 2 cut(s) 202, 241
FaeI CATG 3 cut(s) 133, 407, 413
FalI AAGNNNNNCTT 2 cut(s) 79, 111
FaqI GGGAC 1 cut(s) 453
FatI CATG 3 cut(s) 129, 403, 409
FauI CCCGC 1 cut(s) 228
FbaI TGATCA 1 cut(s) 406
FokI GGATG 3 cut(s) 98, 257, 380
FriOI GRGCYC 2 cut(s) 202, 241
HaeIII GGCC 2 cut(s) 200, 239
HapII CCGG 1 cut(s) 241
Hin1II CATG 3 cut(s) 133, 407, 413
HinfI GANTC 1 cut(s) 347
HpaII CCGG 1 cut(s) 241
HphI GGTGA 1 cut(s) 149
Hpy166II GTNNAC 1 cut(s) 265
Hpy188I TCNGA 1 cut(s) 60
Hpy188III TCNNGA 2 cut(s) 316, 410
Hpy8I GTNNAC 1 cut(s) 265
HpyAV CCTTC 1 cut(s) 179
HpyCH4III ACNGT 2 cut(s) 226, 331
HpyCH4IV ACGT 1 cut(s) 267
HpyCH4V TGCA 1 cut(s) 11
HpyF10VI GCNNNNNNNGC 1 cut(s) 186
HpySE526I ACGT 1 cut(s) 267
Hsp92II CATG 3 cut(s) 133, 407, 413
Ksp22I TGATCA 1 cut(s) 406
Kzo9I GATC 3 cut(s) 68, 91, 406
LmnI GCTCC 1 cut(s) 232
LpnPI CCDG 5 cut(s) 68, 95, 131, 182, 254
MaeII ACGT 1 cut(s) 267
MaeIII GTNAC 5 cut(s) 3, 31, 137, 247, 457
MalI GATC 3 cut(s) 70, 93, 408
MbiI CCGCTC 1 cut(s) 235
MboI GATC 3 cut(s) 68, 91, 406
MflI RGATCY 1 cut(s) 68
MhlI GDGCHC 2 cut(s) 202, 241
MluCI AATT 5 cut(s) 281, 294, 304, 381, 433
MnlI CCTC 1 cut(s) 44
MseI TTAA 3 cut(s) 285, 324, 384
MslI CAYNNNNRTG 3 cut(s) 128, 402, 408
MspI CCGG 1 cut(s) 241
MspR9I CCNGG 3 cut(s) 83, 241, 242
Mva1269I GAATGC 1 cut(s) 54
MvaI CCWGG 1 cut(s) 83
MwoI GCNNNNNNNGC 1 cut(s) 186
NciI CCSGG 2 cut(s) 241, 242
NdeII GATC 3 cut(s) 68, 91, 406
NlaIII CATG 3 cut(s) 133, 407, 413
NlaIV GGNNCC 3 cut(s) 199, 200, 239
NmuCI GTSAC 3 cut(s) 137, 247, 457
PagI TCATGA 1 cut(s) 409
PasI CCCWGGG 1 cut(s) 82
PctI GAATGC 1 cut(s) 54
PfeI GAWTC 1 cut(s) 347
Ppu21I YACGTR 1 cut(s) 268
PshBI ATTAAT 1 cut(s) 384
PsiI TTATAA 1 cut(s) 426
Psp6I CCWGG 1 cut(s) 81
PspEI GGTNACC 1 cut(s) 137
PspGI CCWGG 1 cut(s) 81
PspN4I GGNNCC 3 cut(s) 199, 200, 239
PspOMI GGGCCC 2 cut(s) 198, 237
PspPI GGNCC 4 cut(s) 198, 199, 237, 238
PsuI RGATCY 1 cut(s) 68
RseI CAYNNNNRTG 3 cut(s) 128, 402, 408
SaqAI TTAA 3 cut(s) 285, 324, 384
Sau3AI GATC 3 cut(s) 68, 91, 406
Sau96I GGNCC 4 cut(s) 198, 199, 237, 238
ScrFI CCNGG 3 cut(s) 83, 241, 242
SduI GDGCHC 2 cut(s) 202, 241
SetI ASST 3 cut(s) 122, 155, 270
SmaI CCCGGG 1 cut(s) 242
SmiMI CAYNNNNRTG 3 cut(s) 128, 402, 408
Sse9I AATT 5 cut(s) 281, 294, 304, 381, 433
SsiI CCGC 2 cut(s) 235, 430
StyD4I CCNGG 3 cut(s) 81, 239, 240
TaaI ACNGT 2 cut(s) 226, 331
TaiI ACGT 1 cut(s) 270
TaqI TCGA 1 cut(s) 350
TasI AATT 5 cut(s) 281, 294, 304, 381, 433
TfiI GAWTC 1 cut(s) 347
Tru1I TTAA 3 cut(s) 285, 324, 384
Tru9I TTAA 3 cut(s) 285, 324, 384
TscAI CASTG 1 cut(s) 150
TseFI GTSAC 3 cut(s) 137, 247, 457
Tsp45I GTSAC 3 cut(s) 137, 247, 457
TspDTI ATGAA 1 cut(s) 426
TspMI CCCGGG 1 cut(s) 240
TspRI CASTG 1 cut(s) 150
VspI ATTAAT 1 cut(s) 384
XapI RAATTY 2 cut(s) 281, 294
XmaI CCCGGG 1 cut(s) 240
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.