pycom05g22400

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr5
OG0000158
Physical Location & Seq
Forward (+)
24759347 .. 24760775
1429 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom05g22400.3

Sequence Viewer

Length: 954 bp
ATGCAACTGAAAATAAATTTGACTTTTTTAACAACTACTTATAGTAGAAACCACTTCCCGGGCCCGCTCCACCACCGTAGCACGATATTGTCCGCTTTGGGCTTAGCATTCCCTCACGGTTTTGTTTTTGGGAACTCACGAGCAACTTCCCAGTGGGTCACCCATCATGGGATTGCTCTAGCCCTCTTTTCGCTTAACTTCGGAGTTCCTACGGAACCTGAAGTCAATACATTTAAGGATCACTCCCCTGGCGATGTGGGATGTCACAATCCACCCTCCTTAGGGGCCCGACGTCCTCGTCGGCATACCACGACCAGGCACTTCCCAGGCCCGCTCCACCACTGTAGCACTATATTGTCCACTTTGGGCTTACCATTCCCTCACGGTTTTGTTTTTGGGAACTCACGAGCAACTTCCCAGTGGGTCACCCATCATGGGATTGCTCTAGCCTTCTTCTCGCTTAACTTCGGAGTTCCTACGGAGCCCGAAGCCAGTGAGCTCCTAAAAGGCCTCGTGCTAAGTAGGGATGAGAATATACATTTAAGGATCACTCCCCTGGGCGATGTGGGATTATTAAGAGTTGACAAAATATTTTTTAGTGCAATAAGTTTTGTACGTACCAAAATAAGGATAATACAACATACTAATAACTTGATACACGTACCCGGATTAAATTTACATAACGTAACAATAACATACCAAATGATTGGTACATTATATTTAATATATGTGCATGTTATATTTCATAATTGTATGTTAATAAGATGTTTATGTGATGTTTGTGGTGATTTTAGAATATTTATGATATTATTTTCTGAATTATTTGTAAAAAAATTCAAAATTGAGGCATCTATATCAAAATACTCCCCTAACAATTACGGAAGACCTCACAAGGGAGGCTTCCGATTATTTCTCATGAACCACCTTGTCGATCTCACAAATATATTACTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

318

Amino Acids

35.7

Weight (kDa)

9.75

Isoelectric Point (pI)

38.0

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000158)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g10163
malus_domestica MD04G1068000.v1.1 MD05G1130900.v1.1 MD06G1153600.v1.1 MD10G1255900.v1.1 MD10G1282000.v1.1 MD13G1075400.v1.1 MD13G1192400.v1.1
pyrus_communis pycom01g00130 pycom01g00390 pycom01g00700 pycom01g00720 pycom01g00750 pycom01g00850 pycom01g00870 pycom01g00910 pycom01g01250 pycom01g01560 pycom01g01680 pycom01g01860 pycom01g01900 pycom01g01910 pycom01g02200 pycom01g02260 pycom01g02270 pycom01g02280 pycom01g02330 pycom01g02480 pycom01g02720 pycom01g02730 pycom01g02750 pycom01g02770 pycom01g02780 pycom01g02860 pycom01g02910 pycom01g03540 pycom01g04090 pycom01g04100 pycom01g04150 pycom01g04250 pycom01g04430 pycom01g11810 pycom01g11860 pycom01g11940 pycom01g21380 pycom02g06650 pycom02g08490 pycom02g08600 pycom02g18230 pycom02g18450 pycom02g18800 pycom02g19150 pycom02g20740 pycom02g21340 pycom02g26210 pycom03g12060 pycom03g19060 pycom03g19100 pycom03g19120 pycom04g06890 pycom04g08960 pycom05g01790 pycom05g07910 pycom05g08080 pycom05g08100 pycom05g08570 pycom05g21500 pycom05g22400 pycom05g22510 pycom05g22620 pycom05g23020 pycom05g23720 pycom05g23890 pycom05g24040 pycom07g12080 pycom08g07930 pycom08g11940 pycom09g12120 pycom10g03890 pycom10g23360 pycom10g28250 pycom11g02850 pycom11g14370 pycom11g14400 pycom11g21840 pycom11g21860 pycom11g21980 pycom11g23580 pycom11g23650 pycom11g24050 pycom11g25610 pycom12424g00060 pycom1256g00130 pycom12661g00030 pycom12g09520 pycom12g09530 pycom12g09660 pycom12g09730 pycom12g11210 pycom12g16710 pycom12g16740 pycom12g16750 pycom13g08800 pycom13g18580 pycom13g18670 pycom13g18770 pycom13g22900 pycom13g23050 pycom13g23160 pycom13g23480 pycom13g23610 pycom13g23660 pycom13g23790 pycom13g23840 pycom13g24010 pycom13g24140 pycom13g24210 pycom13g24300 pycom13g24310 pycom13g24480 pycom13g24520 pycom13g24570 pycom13g24730 pycom13g24760 pycom13g24820 pycom13g25010 pycom13g25020 pycom13g25270 pycom13g25620 pycom13g25670 pycom13g25760 pycom13g25800 pycom13g25900 pycom13g26620 pycom13g26640 pycom13g26670 pycom13g26940 pycom13g27040 pycom13g27130 pycom13g27530 pycom13g27770 pycom13g27830 pycom13g27920 pycom13g27940 pycom13g28100 pycom13g28420 pycom13g28430 pycom13g28460 pycom13g28520 pycom13g29160 pycom14g05380 pycom15g03480 pycom15g04370 pycom15g27500 pycom16g13590 pycom16g13610 pycom16g13630 pycom16g14390 pycom16g18310 pycom17g01940 pycom17g04000 pycom17g16100 pycom17g16220 pycom17g16230 pycom17g16340 pycom17g16430 pycom17g16460 pycom17g16740 pycom17g16960 pycom17g17020 pycom17g17090 pycom17g17100 pycom17g17170 pycom17g17430 pycom17g17850 pycom17g18230 pycom17g18250 pycom17g18380 pycom17g21170 pycom17g21330 pycom520g00150 pycom520g00160 pycom808g00030 pycom808g00160 pycom808g00250 pycom808g00290
rosa_chinensis RchiOBHm_Chr5g0054451

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 297
AatII GACGTC 1 cut(s) 295
AccBSI CCGCTC 2 cut(s) 67, 334
AciI CCGC 3 cut(s) 65, 93, 332
AclWI GGATC 2 cut(s) 246, 554
AcsI RAATTY 3 cut(s) 16, 673, 833
AcuI CTGAAG 1 cut(s) 240
AcyI GRCGYC 1 cut(s) 292
AfaI GTAC 4 cut(s) 615, 619, 663, 712
AfiI CCNNNNNNNGG 8 cut(s) 58, 168, 281, 282, 315, 435, 627, 893
AflIII ACRYGT 1 cut(s) 658
AgsI TTSAA 1 cut(s) 838
AjnI CCWGG 4 cut(s) 247, 314, 325, 555
AluBI AGCT 1 cut(s) 499
AluI AGCT 1 cut(s) 499
Alw21I GWGCWC 1 cut(s) 501
AlwI GGATC 2 cut(s) 246, 554
Ama87I CYCGRG 1 cut(s) 58
AoxI GGCC 4 cut(s) 61, 285, 328, 508
ApaI GGGCCC 2 cut(s) 65, 289
ApoI RAATTY 3 cut(s) 16, 673, 833
AspS9I GGNCC 5 cut(s) 61, 62, 285, 286, 329
AsuC2I CCSGG 3 cut(s) 59, 60, 666
AsuHPI GGTGA 3 cut(s) 151, 418, 797
AvaI CYCGRG 1 cut(s) 58
AxyI CCTNAGG 1 cut(s) 280
BaeGI GKGCMC 2 cut(s) 65, 289
BanII GRGCYC 4 cut(s) 65, 289, 486, 501
BauI CACGAG 3 cut(s) 138, 405, 512
BbsI GAAGAC 1 cut(s) 889
Bbv12I GWGCWC 1 cut(s) 501
BccI CCATC 2 cut(s) 171, 438
BciT130I CCWGG 4 cut(s) 249, 316, 327, 557
BcnI CCSGG 3 cut(s) 59, 60, 666
BfaI CTAG 2 cut(s) 179, 446
BfmI CTRYAG 1 cut(s) 343
BlpI GCTNAGC 1 cut(s) 103
Bme1390I CCNGG 7 cut(s) 59, 60, 249, 316, 327, 557, 666
BmeT110I CYCGRG 1 cut(s) 58
BmgT120I GGNCC 5 cut(s) 61, 62, 285, 286, 329
BmiI GGNNCC 5 cut(s) 63, 216, 286, 287, 483
BmrFI CCNGG 7 cut(s) 59, 60, 249, 316, 327, 557, 666
BmrI ACTGGG 2 cut(s) 145, 412
BmsI GCATC 1 cut(s) 857
BmuI ACTGGG 2 cut(s) 145, 412
BpiI GAAGAC 1 cut(s) 889
Bpu1102I GCTNAGC 1 cut(s) 103
BpuMI CCSGG 3 cut(s) 59, 60, 666
BsaAI YACGTR 2 cut(s) 617, 661
BsaHI GRCGYC 1 cut(s) 292
BsaJI CCNNGG 5 cut(s) 58, 247, 325, 555, 556
Bsc4I CCNNNNNNNGG 8 cut(s) 58, 168, 281, 282, 315, 435, 627, 893
Bse1I ACTGG 3 cut(s) 151, 418, 492
Bse21I CCTNAGG 1 cut(s) 280
BseBI CCWGG 4 cut(s) 249, 316, 327, 557
BseDI CCNNGG 5 cut(s) 58, 247, 325, 555, 556
BseGI GGATG 2 cut(s) 266, 532
BseLI CCNNNNNNNGG 8 cut(s) 58, 168, 281, 282, 315, 435, 627, 893
BseNI ACTGG 3 cut(s) 151, 418, 492
BseSI GKGCMC 2 cut(s) 65, 289
BshFI GGCC 4 cut(s) 63, 287, 330, 510
BsiHKAI GWGCWC 1 cut(s) 501
BsiHKCI CYCGRG 1 cut(s) 58
BsiSI CCGG 2 cut(s) 59, 666
BslI CCNNNNNNNGG 8 cut(s) 58, 168, 281, 282, 315, 435, 627, 893
BsmI GAATGC 1 cut(s) 107
BsnI GGCC 4 cut(s) 63, 287, 330, 510
BsoBI CYCGRG 1 cut(s) 58
Bsp120I GGGCCC 2 cut(s) 61, 285
Bsp1286I GDGCHC 4 cut(s) 65, 289, 486, 501
Bsp143I GATC 3 cut(s) 238, 546, 931
Bsp1720I GCTNAGC 1 cut(s) 103
BspACI CCGC 3 cut(s) 65, 93, 332
BspANI GGCC 4 cut(s) 63, 287, 330, 510
BspHI TCATGA 1 cut(s) 915
BspLI GGNNCC 5 cut(s) 63, 216, 286, 287, 483
BspPI GGATC 2 cut(s) 246, 554
BsrBI CCGCTC 2 cut(s) 67, 334
BsrI ACTGG 3 cut(s) 151, 418, 492
BssECI CCNNGG 5 cut(s) 58, 247, 325, 555, 556
BssMI GATC 3 cut(s) 238, 546, 931
BssNI GRCGYC 1 cut(s) 292
BssSI CACGAG 3 cut(s) 138, 405, 512
Bst2BI CACGAG 3 cut(s) 138, 405, 512
Bst2UI CCWGG 4 cut(s) 249, 316, 327, 557
Bst4CI ACNGT 4 cut(s) 77, 119, 344, 386
BstACI GRCGYC 1 cut(s) 292
BstBAI YACGTR 2 cut(s) 617, 661
BstC8I GCNNGC 2 cut(s) 65, 332
BstDEI CTNAG 3 cut(s) 103, 280, 518
BstEII GGTNACC 2 cut(s) 157, 424
BstF5I GGATG 2 cut(s) 266, 532
BstKTI GATC 3 cut(s) 241, 549, 934
BstMBI GATC 3 cut(s) 238, 546, 931
BstNI CCWGG 4 cut(s) 249, 316, 327, 557
BstNSI RCATGY 1 cut(s) 737
BstPI GGTNACC 2 cut(s) 157, 424
BstSCI CCNGG 7 cut(s) 57, 58, 247, 314, 325, 555, 664
BstSFI CTRYAG 1 cut(s) 343
BstSLI GKGCMC 2 cut(s) 65, 289
BstSNI TACGTA 1 cut(s) 617
BstV2I GAAGAC 1 cut(s) 889
BstXI CCANNNNNNTGG 1 cut(s) 707
Bsu36I CCTNAGG 1 cut(s) 280
BsuRI GGCC 4 cut(s) 63, 287, 330, 510
BtgZI GCGATG 2 cut(s) 267, 576
BtsCI GGATG 2 cut(s) 266, 532
BtsIMutI CAGTG 4 cut(s) 158, 340, 425, 499
Cac8I GCNNGC 2 cut(s) 65, 332
CciI TCATGA 1 cut(s) 915
Cfr13I GGNCC 5 cut(s) 61, 62, 285, 286, 329
Cfr9I CCCGGG 1 cut(s) 58
Csp6I GTAC 4 cut(s) 614, 618, 662, 711
CviAII CATG 4 cut(s) 167, 434, 734, 916
CviQI GTAC 4 cut(s) 614, 618, 662, 711
DdeI CTNAG 3 cut(s) 103, 280, 518
DpnI GATC 3 cut(s) 240, 548, 933
DpnII GATC 3 cut(s) 238, 546, 931
DrdI GACNNNNNNGTC 1 cut(s) 297
DseDI GACNNNNNNGTC 1 cut(s) 297
Ecl136II GAGCTC 1 cut(s) 499
Eco105I TACGTA 1 cut(s) 617
Eco147I AGGCCT 1 cut(s) 510
Eco24I GRGCYC 4 cut(s) 65, 289, 486, 501
Eco53kI GAGCTC 1 cut(s) 499
Eco57I CTGAAG 1 cut(s) 240
Eco81I CCTNAGG 1 cut(s) 280
Eco88I CYCGRG 1 cut(s) 58
Eco91I GGTNACC 2 cut(s) 157, 424
EcoICRI GAGCTC 1 cut(s) 499
EcoO109I RGGNCCY 1 cut(s) 285
EcoO65I GGTNACC 2 cut(s) 157, 424
EcoRII CCWGG 4 cut(s) 247, 314, 325, 555
EcoT38I GRGCYC 4 cut(s) 65, 289, 486, 501
FaeI CATG 4 cut(s) 170, 437, 737, 919
FalI AAGNNNNNCTT 2 cut(s) 884, 916
FatI CATG 4 cut(s) 166, 433, 733, 915
FauI CCCGC 2 cut(s) 72, 339
FokI GGATG 2 cut(s) 273, 539
FriOI GRGCYC 4 cut(s) 65, 289, 486, 501
FspBI CTAG 2 cut(s) 179, 446
HaeIII GGCC 4 cut(s) 63, 287, 330, 510
HapII CCGG 2 cut(s) 59, 666
Hin1I GRCGYC 1 cut(s) 292
Hin1II CATG 4 cut(s) 170, 437, 737, 919
HincII GTYRAC 1 cut(s) 583
HindII GTYRAC 1 cut(s) 583
HpaII CCGG 2 cut(s) 59, 666
HphI GGTGA 3 cut(s) 151, 418, 797
Hpy166II GTNNAC 2 cut(s) 360, 583
Hpy188I TCNGA 4 cut(s) 203, 470, 817, 905
Hpy188III TCNNGA 3 cut(s) 138, 405, 916
Hpy8I GTNNAC 2 cut(s) 360, 583
Hpy99I CGWCG 2 cut(s) 294, 303
HpyAV CCTTC 1 cut(s) 460
HpyCH4III ACNGT 4 cut(s) 77, 119, 344, 386
HpyCH4IV ACGT 4 cut(s) 292, 616, 660, 684
HpyCH4V TGCA 3 cut(s) 4, 602, 733
HpyF3I CTNAG 3 cut(s) 103, 280, 518
HpySE526I ACGT 4 cut(s) 292, 616, 660, 684
Hsp92I GRCGYC 1 cut(s) 292
Hsp92II CATG 4 cut(s) 170, 437, 737, 919
Kzo9I GATC 3 cut(s) 238, 546, 931
LmnI GCTCC 4 cut(s) 72, 339, 481, 504
LweI GCATC 1 cut(s) 857
MaeI CTAG 2 cut(s) 179, 446
MaeII ACGT 4 cut(s) 292, 616, 660, 684
MaeIII GTNAC 4 cut(s) 157, 263, 424, 685
MalI GATC 3 cut(s) 240, 548, 933
MbiI CCGCTC 2 cut(s) 67, 334
MboI GATC 3 cut(s) 238, 546, 931
MboII GAAGA 2 cut(s) 445, 894
MhlI GDGCHC 4 cut(s) 65, 289, 486, 501
MluCI AATT 7 cut(s) 16, 673, 748, 818, 833, 840, 874
MnlI CCTC 9 cut(s) 123, 194, 286, 306, 390, 521, 838, 890, 897
MseI TTAA 9 cut(s) 29, 195, 234, 462, 542, 575, 671, 722, 758
MspI CCGG 2 cut(s) 59, 666
MspR9I CCNGG 7 cut(s) 59, 60, 249, 316, 327, 557, 666
Mva1269I GAATGC 1 cut(s) 107
MvaI CCWGG 4 cut(s) 249, 316, 327, 557
NciI CCSGG 3 cut(s) 59, 60, 666
NdeII GATC 3 cut(s) 238, 546, 931
NlaIII CATG 4 cut(s) 170, 437, 737, 919
NlaIV GGNNCC 5 cut(s) 63, 216, 286, 287, 483
NmuCI GTSAC 3 cut(s) 157, 263, 424
NspI RCATGY 1 cut(s) 737
PagI TCATGA 1 cut(s) 915
PasI CCCWGGG 1 cut(s) 556
PceI AGGCCT 1 cut(s) 510
PctI GAATGC 1 cut(s) 107
Ppu21I YACGTR 2 cut(s) 617, 661
Psp124BI GAGCTC 1 cut(s) 501
Psp6I CCWGG 4 cut(s) 247, 314, 325, 555
PspEI GGTNACC 2 cut(s) 157, 424
PspGI CCWGG 4 cut(s) 247, 314, 325, 555
PspN4I GGNNCC 5 cut(s) 63, 216, 286, 287, 483
PspOMI GGGCCC 2 cut(s) 61, 285
PspPI GGNCC 5 cut(s) 61, 62, 285, 286, 329
RsaI GTAC 4 cut(s) 615, 619, 663, 712
RsaNI GTAC 4 cut(s) 614, 618, 662, 711
SacI GAGCTC 1 cut(s) 501
SaqAI TTAA 9 cut(s) 29, 195, 234, 462, 542, 575, 671, 722, 758
Sau3AI GATC 3 cut(s) 238, 546, 931
Sau96I GGNCC 5 cut(s) 61, 62, 285, 286, 329
ScrFI CCNGG 7 cut(s) 59, 60, 249, 316, 327, 557, 666
SduI GDGCHC 4 cut(s) 65, 289, 486, 501
SetI ASST 8 cut(s) 220, 295, 501, 619, 663, 687, 889, 927
SfaNI GCATC 1 cut(s) 857
SfcI CTRYAG 1 cut(s) 343
SmaI CCCGGG 1 cut(s) 60
SnaBI TACGTA 1 cut(s) 617
Sse9I AATT 7 cut(s) 16, 673, 748, 818, 833, 840, 874
SseBI AGGCCT 1 cut(s) 510
SsiI CCGC 3 cut(s) 65, 93, 332
SspI AATATT 2 cut(s) 591, 798
SspMI CTAG 2 cut(s) 179, 446
SstI GAGCTC 1 cut(s) 501
StuI AGGCCT 1 cut(s) 510
StyD4I CCNGG 7 cut(s) 57, 58, 247, 314, 325, 555, 664
TaaI ACNGT 4 cut(s) 77, 119, 344, 386
TaiI ACGT 4 cut(s) 295, 619, 663, 687
TaqI TCGA 1 cut(s) 930
TasI AATT 7 cut(s) 16, 673, 748, 818, 833, 840, 874
Tru1I TTAA 9 cut(s) 29, 195, 234, 462, 542, 575, 671, 722, 758
Tru9I TTAA 9 cut(s) 29, 195, 234, 462, 542, 575, 671, 722, 758
TscAI CASTG 4 cut(s) 158, 347, 425, 499
TseFI GTSAC 3 cut(s) 157, 263, 424
Tsp45I GTSAC 3 cut(s) 157, 263, 424
TspDTI ATGAA 2 cut(s) 734, 932
TspGWI ACGGA 3 cut(s) 227, 494, 894
TspMI CCCGGG 1 cut(s) 58
TspRI CASTG 4 cut(s) 158, 347, 425, 499
XapI RAATTY 3 cut(s) 16, 673, 833
XceI RCATGY 1 cut(s) 737
XmaI CCCGGG 1 cut(s) 58
XspI CTAG 2 cut(s) 179, 446
ZraI GACGTC 1 cut(s) 293
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.